ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Πρόσκληση υποβολής προσφοράς

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

Shiraia sp. Slf14 III

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Cellular Physiology and Biochemistry

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

,Ab 2 Ab 1. (internal image) Ab 2 : (1) Ab 1,

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

High mobility group 1 HMG1

College of Life Science, Dalian Nationalities University, Dalian , PR China.

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

Studies on purification and characteristics of glycosyltransferase from an engineering strain

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Supporting Information

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA

BL21 (D E3)2p E T28a ( + )2bgl 2

TGFp FSH INH INH

ER-Tree (Extended R*-Tree)

BGP TRACP-5b BGP TRACP-5b P 0.05

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Optimization of fermentation process for achieving high product concentration high yield and high productivity

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ

Regioselectivity in the Stille coupling reactions of 3,5- dibromo-2-pyrone.

Electronic Supplementary Information

Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

CHINA BIOTECHNOLOGY ,720 PEG PEG. 20kDa ; [2 ] PEG. (methoxypoly ethylene glycol,mpeg), [4 ] PEG [1 ] PEG. (1 50kDa),, mpeg. 3,

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

CorV CVAC. CorV TU317. 1

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Identification of Fish Species using DNA Method

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Supporting Information

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Analysis on construction application of lager diameter pile foundation engineering in Guangdong coastal areas

Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Humanization of Ovarian Carcinoma Anti2idiotype Single2chain

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Supporting Information

30s 56 60s 72 60s dntp cm s s s 23

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ

Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

Supporting Information

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Supporting Information

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή διατριβή. Ονοματεπώνυμο: Αργυρώ Ιωάννου. Επιβλέπων καθηγητής: Δρ. Αντρέας Χαραλάμπους

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris

Supplementary information

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Τα αναλώσιμα μαζί με τα τεχνικά χαρακτηριστικά τους περιγράφονται αναλυτικά ανά ομάδα:

ΤΜΗΜΑ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΡΓΙΚΩΝ ΠΡΟΪΟΝΤΩΝ

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

Supporting Information. Experimental section

Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3

An HBsAg Binding Protein Expressed in Pichia pastoris Can be Used as an HBV Vaccine Adjuvant

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Angioarrestin( harp1) C FD

Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ

Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

Transcript:

China Biotechnology 2011 31 8 110-117 * ScFv-Fc 1** 2 1 4 1 3 2 1 510006 2 130021 3 510632 4 130021 ScFv ScFv-Fc RT- PCR IgG1 Fc ppiczα ppiczα/fc Fc 2 ScFv-Fc ScFv ScFv ppiczα/fc 1L protein A PCR ELISA Western blotting 1L 20 ~30mg /L protein A >95% ScFv-Fc ScFv-Fc Q81 1988 Skerra Better ScFv-Fc ScFv-Fc IgG1 Fc ppiczα Fc 2 ScFv-Fc ScFv ppiczα /ScFv-Fc His-tag 3-4 ScFv ScFv 37 ScFv ppiczα /Fc ScFv-Fc 5 ScFv-Fc ScFv-Fc ScFv-Fc Fc 1 A G 1. 1 2011-06-10 2011-07-06 XL1-Blue Zeocin X33 ppiczα Invitrogene * 81000923 ** wangdingding305@ 163. com T4 DNA DNA

2011 31 8 ScFv-Fc TaKaRa Trizol RNA DNA Invitrogene RNA LA PCR Kit TaKaRa Omega IgG-HRP ELISA ScFv -HBsAg ScFv 6 PCR United Biochemical Int 1 PCR 1 94 2min 294 1min 55 1. 2 1. 2. 1 ppiczα /Fc 1 ppiczα ScFv-Fc ppiczα / ScFv-Fc F1 F2 1 HBsAg ppiczα /ScFv-Fc RbAg 1μg TE 40μl 100 15min 1. 2. 3 ScFv-Fc ppiczα / Xho I EcoR I ScFv-Fc HBsAg ppiczα /ScFv-Fc RbAg EcoR I Apa I Sac I 1μg Acc I Xho I EcoR I 80μl 0. 2cm ppiczα 5min fungi-pulse 16 XL1-Blue Zeocin 1ml 25 μg /ml Apa I Bgl II 1. 5ml EP 28 1 ~ 2h 50 ~ DNA 100μl Zeocin 100μg /ml 2 10ml YPD 28 2 ~ 3 10 Trizol RNA RT-PCR Zeocin 10ml BMGY 28 IgG1 Fc C H 2 C H 3 C1 C2 1 PCR 1 94 2min 2 94 30s 58 1min 72 1. 5min 28 3 72 1. 2. 2 ScFv-Fc PCR B1 B2 R1 R2 1min 72 2min 30 272 10min Xho I Apa I PCR ppiczα /Fc α 3' Fc 5' 24h OD 600 2. 0 ~ 6. 0 10ml BMMY 28 24h 10min 0. 5% ppiczα 0h 24h 48h 72h 96h 120h 144h α 3' Apa I 1ml -HBs Xba I ppiczα ELISA Apa I Xba I Fc PCR Apa I Xba I 1 Table 1 Fc ScFv The sequences of primers and synthetic nucleotide chains Pimers and synthetic nucleotide chains Sequences 5' - 3' Fc upstream C1 5' - TAAGGGCCCCTGAGCCCAAATCTTGTG - 3' Fc downstream C2 5' - CCGTCTAGATCATTTACCCGGAGACAGGG - 3' synthetic nucleotide chain F1 TCGAGAAGAGACAGGTCGACCTGGTGGAGGGGCCCG synthetic nucleotide chain complementary F2 AATTCGGGCCCCTCCACCAGGTCGACCTGTCTCTTCTCGA anti-hbsag ScFv upstream B1 TATCTCGAGAAGAGACAGGTCGACCTGGTGGAG anti-hbsag ScFv downstream B2 ATCGAATTCGGGCCCCCGTTTGATTTCAACCTTGGTCCC anti-rabies ScFv upstream R1 TTACTCGAGAAGAGAGAGGTGCAGCTGCTGCAG anti-rabies ScFv downstream R2 ATTGAATTCGGGCCCTTTGATTTCCACCTTGGTCCC The restriction enzymes sites for Xho I CTCGAG BamH I GAATTC Xba I TCTAGA and Apa I GGGCCC included in the PCR primers are indicated by underlining. 111

China Biotechnology Vol. 31 No. 8 2011 1. 2. 4 DNA PCR 200 mmol /L ph7. 0 ph DNA PCR 7. 0 A 5 20 ScFv-Fc mmol /L ph7. 0 0. 1 mol /L pmd18-t DNA 7 ph3. 0 1 mol /L Tris- 1. 2. 5 SDS-PAGE ELISA HCl ph9. 0 60 ~ 200μl /ml SDS-PAGE 10% ph 5% Bradford BSA 72h 4 1 5 SDS 8 3 ~ 5min 10 000 SDS-PAGE ScFvr /min 30s 60μl 40V Fc ELISA 100V 1. 2. 8 ELISA 1 ScFv-Fc 0. 1 mol /L NaHCO 3 ph9. 6 1. 2. 6 Western blot 1 ScFv-Fc IgG 1 1000 4 2% BSA 37 SDS-PAGE 1 h 37 1 h HRP 2% BSA IgG 1 800 37 1 h NC 2 NC 2 mol /L H 2 SO 4 OD 450 0. 1ml /cm 2 IgG 2 ScFv-Fc IgG 1 100 ~ 1 1000 1 ~ 4h TTBS NC 5min / 3 ~ 5 1 200 48h 72h 96h 120h 144h ELISA ~1 1000 1 ~4h TTBS NC 5min / 3 ~ 5 DAB 2 10min DAB ScFv-Fc 1 ~ 3min HRIG ScFv-Fc TBS 2 RV ScFv-Fc SDS-PAGE NC -HBs ScFv-Fc ScFv-Fc HRP IgG DAB 1. 2. 7 ScFv-Fc ScFv-Fc 1L 2. 1 ppiczα 0. 5% 10% ~ 30% Xho I EcoR I ppiczα 45% ~ 70% 10000 r /min 4 20min PBS 1 DNA 24 ~ 48h 4 3 ~ 6h ppiczα -HBs ELISA 24h 1. 2. 9 RV 37 1. 5 h 6 30 μl 5 14 2 Xho I EcoR I Bgl II Apa I 1100bp EcoR I Apa I Protein A Sepharose CL-4B 2. 2 Fc ScFv-Fc 1. 5 RT-PCR 5 20 mmol /L 750bp 2 ph7. 0 1 /10 Fc 112

2011 31 8 ScFv-Fc 2. 3 ppiczα/fc ppiczα α 3' ApaI Xba I ppiczα ApaI Xba I Fc ppiczα ppiczα /Fc ApaI Xba I 750bp 3 DNA ppiczα /Fc 4 5 2. 4 ScFv-Fc PCR Zeocin 0h 24h ScFv anti-rabies 48h 72h 96h 120h 1ml ScFv anti-hbsag -HBs 750bp Xho I Apa ELISA I ppiczα /Fc SDS-PAGE Western blot Zeocin ScFv-Fc anti-rabies ScFv Fc 6 XhoI ApaI XhoI Xba I 750bp 1500bp 6 DNA ScFv 2. 5 DNA PCR 8 DNA PCR 1500bp pmd18- T DNA 2. 6 ScFv-Fc ScFv-Fc anti-rabies ScFv- Fc anti-hbsag YPD 10 anti-hbsag 56kDa 113

China Biotechnology Vol. 31 No. 8 2011 SDS-PAGE ScFv-Fc 115kDa 55kDa 7 Bradford 1L 20 ~ 30mg /L protein A > 95% ELISA ScFv-Fc anti-rabies ScFv-Fc anti-hbsag 8 2. 7 ScFv-Fc 2. 8 ScFv-Fc ScFv-Fc 1L Protein A Sepharose CL- ScFv-Fc RV 4B 100% HRIG HRIG 150 IU /ml 114

2011 31 8 ScFv-Fc ScFv-Fc RV and Drug Administration FDA 10-1 33. 3% 10-4 30% ScFv-Fc 2 2 ScFv-Fc Table 2 Detection of rabies virus in supernatant of ScFv-Fc fusion protein by inoculating mouse brain Group Survival no. after 5 days Survival no. after 14 days survival % HRIG + RV 6 6 100 Virus control 0 0 0 Negative control 6 6 100 ScFv-Fc + RV 10-4 6 6 100 ScFv-Fc + RV 10-3 6 5 83 ScFv-Fc + RV 10-2 5 4 66. 7 ScFv-Fc + RV 10-1 4 2 33. 3 ScFv-Fc + RV 6 0 0 3 Asn-X-Ser /Thr ScFv-Fc 13-14 3 ScFv ScFv-Fc 90% 15 4 AOX1 15 Fab ScFv Fv C 9 10 1g C 10g ScFv scfv 16-17 Fab 18 scfv-fc 19 20 sc Fv 2 2 11 scfv Fc Fc 4. 2 g /L 21 Freyre 22 CEA immunoadhesin 12 1. 2 g /L 0. 44 TNFR 93% IgG Fc TNFR-Fc TNF-α 3 1 AOXI 2 8 ~ 14 ppiczα ScFv-Fc FDA Food IgG1 Fc 115

China Biotechnology Vol. 31 No. 8 2011 ppiczα 6 Yan W Q Wang D D. Recombinant antibody against rabies Fc 2 ScFv-Fc ScFv antigen. China 200710055307. 1. 7 Sambrook J Russell D. Molecular Cloning A Laboratory Manual 2001. 663-667. ppiczα /ScFv-Fc 8 Bradford M M. A rapid and sensitive method for the quantitation ScFv of microgram quantities of protein utilizing the principle of ppiczα /ScFv-Fc protein-dye binding Anal Biochem 1976 72 248-254. 9 Stish B J Chen H Shu Y et al. Increasing anticarcinoma ScFv-Fc activity of an anti-erbb2 recombinant immunotoxin by the addition ppiczα / of an anti-epcam sfv. Clin Cancer Res 2007 13 10 3058-3067. ScFv-Fc Fc ScFv 10 Hamada T S Suzuki K Akahori Y. Antibody-dependent cellmediated cytotoxicity is induced by a single-chain Fv-protein III EcoR I ppiczα Apa I Acc I ScFv fusion in the presence of a rabbit anti-protein III polyclonal ScFv Acc antibody. Immunol Lett 2011 136 1 44-48. I 11 Niculescu-/duvaz I Springer C J. Antibody-dircted enzyme prodrug therapy ADEPT a review. Adv Drup Deliv Rev 1997 26 151-172. 12 Chamow S M Ashkenazi A. Immunoadhesins principles and app1ication. TIBTECH 1996 14 52-60. 13 Fischer R Drossard J Emans N et al. Towards molecular farming in the future Pichia pastoris-based production of singlechain antibody fragments. Biotechnol Appl Biochem 1999 30 117-120. His-tag Ni 14 Shapiro R I Wen D Levesque M et al. Expression of Sonic protein A hedgehog-fc fusion protein in Pichia pastoris. Identification and control of post-translational chemical and proteolytic modifications. Protein Expr Purif 2003 29 2 272-283. 15 Cregg J M Vedvick T S Raschke W C. Advances in the expression of foreign genes in Pichia pastoris. Biotechnology 1 Skerra A Pluckthun A. Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science 1988 240 1038-1041. 2 Better M Chang C P Robinson R R et al. Escherichia coli secretion of an active chimeric antibody fragment. Science 1988 2 40 1041-1043. 3 Desplancq D Rinaldi A Stoessed A et al. Single-chain Fv fragment antibodies selected from an intrabody library as effective mono-or bivalent reagents for in vitro proten detection. J immunol Methods 2011 in print. 4 Sakamoto S Taura F Tsuchihashi R et al. Expression purification and characterization of anti-plumbagin single-chain variable fragment antibody in Sf9 insect cell. Hybridoma Larchmt 2010 29 6 481-488. 5 Sandrine M Ahmed E M Ole V et al. A multi-fc-species system for recombinant antibody production. BMC Biotechnology 116 2009 9 Article ID 14. 1993 11 905-910. 16 Jafari R Sundstrom B E Holm P. Optimization of production of the anti-keratin 8 single-chain Fv TS1-218 in Pichia pastoris using design of experiments. Microb Cell Fact 2011 10 1 34-41. 17 Gurkan C Symeonides S N Ellar D J. High-level production in Pichia pastoris of an anti-p185her-2 single-chain antibody fragment using an alternative secretion expression vector. Biotechnol Appl Biochem 2004 39 1 115-122. 18 Schoonooghe S Kaigorodov V Zawisza M et al. Efficient production of human bivalent and trivalent anti-muc1 Fab-scFv antibodies in Pichia pastoris. BMC Biotechnol 2009 9 70-84. 19 Yamawaki S Matsumoto T Ohnishi Y et al. Production of single-chain variable fragment antibody scfv in fed-batch and continuous culture of Pichia pastoris by two different methanol feeding methods. J Biosci Bioeng 2007 104 5 403-407. 20 Jafari R Holm P Piercecchi M et al. Construction of divalent anti-keratin 8 single-chain antibodies sc Fv 2 expression

2011 31 8 ScFv-Fc in Pichia pastoris and their reactivity with multicellular tumor spheroids. J Immunol Methods 2011 364 1-2 65-76. 21 Damasceno L M Pla I Chang H J et al. An optimized fermentation process for high-level production of a single-chain Fv antibody fragment in Pichia pastoris. Protein Expr Purif 2004 37 1 18-26. 22 Freyre F M Vazquez J E Ayala M et al. Very high expression of an anti-carcinoembryonic antigen single chain Fv antibody fragment in the yeast Pichia pastoris. J Biotechnol 2000 76 2-3 157-163. A Vector System for the Production of Single-chain Fv-Fc Fusions in Pichia pastoris WANG Ding-ding 1 SU Man-man 2 HU Li-li 1 YUAN Li-ying 4 SUN Yan 1 WANG Ju 3 YAN Wei-qun 2 1 Institute of Life Science and Biological Pharmacy Guangdong Pharmaceutical University Guangzhou 510006 China 2 College of Pharmaceutical Jilin University Changchun 130021 China 3 College of Life Science and Technology Jinan University Guangzhou 510632 China 4 The 3rd Kindergarten Affiliated to Jilin University Changchun 130021 China Abstract Recombinant antibodies especially ScFv fragments can be applied as detection reagents and even substitute for some reagents used in immunoassays such as antibody-enzyme conjugates. For ScFv fragments a universal system available is necessary. A vector system was constructed based on ppiczα /Fc in which the hinge CH2 and CH3 domains Fc fragment of human IgG1 and His-tag were cloned into the Pichia expression vector ppiczα. Two fragments of ScFv were introduced into ppiczα /Fc which can bind HBsAg and rabies virus antigen to yield the expression cassette ppiczα /ScFv-Fc. Following fermentation in a 1-liter reactor the fusions were expressed at high levels in the methylotrophic yeast Pichia pastoris secreted as dimeric forms in the culture and purified by protein A column chromatography. The expression yield can reach 20 ~ 30mg / L of culture medium. The ScFv-Fc fusion proteins retain the biological binding ability of the parent ScFv. Furthermore successful expression and maintenance of the binding activity verify the efficacy of the vector system for use as detection reagents in vitro by reacting with the specific antigens and being readily detected using general anti-human IgG antibodies. Key words Fusion protein ScFv-Fc Vector system Expression Pichia pastoris 117