33 12 2011 12 Journal of Ningxia Medical University 1131 1674-6309 2011 12-1131 - 04 1 2 1 2 1. 750004 2. 100193 8 43 15min 1 12 18 25d 35d PCNA 4 2 10 15 20d 25d RT - PCR GDNF SCF 12d 18d 22% 75% P < 0. 05 93% 25d GDNF mrna 4h 15d P < 0. 05 SCF mrna 4h 10 P < 0. 05 GDNF SCF R321. 1 A 2 ~ 8 1 2-5 42 20min PCNA RT - PCR 28d 2 GDNF SCF 43 20 min 4d 15d 68d 1 5 42 30min 1. 1 8 10 ~ 32 4 Rockett 2001 43 20 20 12h min 23 ~ 28d 5 12h 1. 2 8 TUNEL 1 ml kg - 1 4h 6 24h II 43 5 15 min 7 glial cell derived neu- rotrophic factor GDNF stem cell factor 8 - SCF 10 11 8 2011-09 - 27 NZ1080 1979-1968 - E - mail tianjh@cau. edu. cn 1. 3 PCNA 1 12 18 25 35d 6 4% 4 48h 2% ZLI - 9022 30min

1132 33 1 50 PCNA Santa Cruz 4h 2d 10d 15d 20d 25d Biotechnology FL - 261 4 RNA TRITC ZF - 0316 DNA 2h PBS Hoechst GenBank β - actin GDNF SCF cdna Oligo 6. 0 5 1 cdna PCR 1. 4 RT - PCR GDNF SCF β - actin 1 5 3 F TGAAGATTATCCTGACCAGTTTG R GTCAGATACATCCACACCGTTTAG F ATAGTGGATGACCTCGTGTTATG R ACCTAATGTTGAAGAGAGCACAC F TTGTAACCAACTTGGGACGATATGG - 3' R GATCTTGATCTTCATGGTGCTAGG - 3' RT - PCR /bps r / 241 AF349464 60 28 286 AF349462 59 28 300 NM_001009784 60 28 1. 5 3 GDNF SCF SPSS 4h 2d 10d GDNF mrna P one - way ANOVA P < 0. 05 < 0. 05 15d GDNF mrna 2 2. 1 1 4h 3 2 1d 2d 10d SCF mrna P < 0. 05 15d 20d SCF mrna 12d P < 0. 05 25d 18d SCF mrna GDNF 21. 6% 74. 8% 92. 55% P SCF < 0. 05 25 35 1 P < 0. 05 20d 25d GDNF mrna CON a b c d CON a b c d A B C D E GDNF SCF P < 0. 05 3 3 GDNF SCF mrna P < 0. 05 2 2 ~ 8 1 2. 2 GDNF SCFmRNA

12. 1133 5 1 Danno S Itoh K Matsuda T Fujita J. Decreased expression of mouse Rbm3 a cold - shock protein in Sertoli cells of cryptorchid testis J. Am J Pathol A B 2000 156 5 1685-1692. A 2 Jannes P Spiessens C Van der Auwera I et al. Male A simgle subfertility induced by acute scrotal heating affects embryo quality in normal female mice J. Hum Reprod A 12 s 1998 13 2 372-375. 3 Setchell BP Ekpe G Zupp JL et al. Transient retardation in embryo growth in normal female mice made PCNA pregnant by males whose testes had been heated J. 65d Hum Reprod 1998 13 2 342-347. 5 4 Setchell BP D'Occhio MJ Hall MJ et al. Is embryonic mortality increased in normal female rats mated to subfertile males J. J Reprod Fertil 1988 82 2 567-574. niche GDNF 5 Rockett JC Mapp FL Garges JB et al. Effects of hyperthermia on spermatogenesis apoptosis gene expres- SCF a 1 Glial cell line sion and fertility in adult male mice J. Biol Reprod derived neurotrophic factor family receptor alpha 1 2001 65 1 229-239. GFRa1 GDNF 6 Zhang Y Yang X Cao H et al. Heat stress induces 13-20 SC- Cdc2 protein decrease prior to mouse spermatogenic cell FR or C - Kit SCF apoptosis J. Acta Histochem 2008 110 4 21 276-284. 7 Schmidt JA Avarbock MR Tobias JW et al. Identification of glial cell line - derived neurotrophic factor - 38 GFRa1 C - Kit 22 regulated genes important for spermatogonial stem cell self - renewal in the rat J. Biol Reprod 2009 81 56-66. 23 8 Unni SK Modi DN Pathak SG et al. Stage - specific 24 localization and expression of c - kit in the adult human GDNF SCF testis J. J Histochem Cytochem 2009 57 GDNF 861-869. SCF 9 de Rooij DG. The spermatogonial stem cell niche J. Microsc Res Tech 2009 72 580-585. 10 Weise JM Gunes C. Differential regulation of human and mouse telomerase reverse transcriptase TERT promoter activity during testis development J. Mol Reprod Dev 2009 76 309-317. 11 Lue YH Hikim AP Swerdloff RS et al. Single exposure to heat induces stage - specific germ cell apoptosis in rats role of intratesticular testosterone on stage specificity J. Endocrinology 1999 140 4 GDNF SCF mrna 1709-1717. 12 de Rooij DG Stem cells in the testis J. Int J Exp Pathol 1998 79 2 67-80.

1134 33 13 Naughton CK Jain S Strickland AM et al. Glial cell - line derived neurotrophic factor - mediated RET signaling regulates spermatogonial stem cell fate J. Biol Reprod 2006 74 2 314-321. 14 Chowdhury AK Steinberger E. A Quantitative Study of the Effect of Heat on Germinal Epithelium of Rat Testes J. Am J Anat 1964 115 509-524. 15 Zhang XS Zhang ZH Jin X et al. Dedifferentiation of adult monkey Sertoli cells through activation of extracellularly regulated kinase 1 /2 induced by heat treatment J. Endocrinology 2006 147 3 1237-1245. 16 Kubota H Avarbock MR Brinster RL. Culture conditions and single growth factors affect fate determination of mouse spermatogonial stem cells J. Biol Reprod 2004 71 3 722-731. 17 Kubota H Avarbock MR Brinster RL. Growth factors essential for self - renewal and expansion of mouse spermatogonial stem cells J. Proc Natl Acad Sci USA 2004 101 47 16489-16494. 18 Tadokoro Y Yomogida K Ohta H et al. Homeostatic regulation of germinal stem cell proliferation by the GDNF /FSH pathway J. Mech Dev 2002 113 1 29-39. 19 Yomogida K Yagura Y Tadokoro Y et al. Dramatic expansion of germinal stem cells by ectopically expressed human glial cell line - derived neurotrophic factor in mouse Sertoli cells J. Biol Reprod 2003 69 4 1303-1307. 20 Creemers LB Meng X den Ouden K et al. Transplantation of germ cells from glial cell line - derived neurotrophic factor - overexpressing mice to host testes depleted of endogenous spermatogenesis by fractionated irradiation J. Biol Reprod 2002 66 6 1579-1584. 21 Meng X Lindahl M Hyvonen ME et al. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF J. Science 2000 287 5457 1489-1493. 22 Hofmann MC Braydich - Stolle L Dym M. Isolation of male germ - line stem cells influence of GDNF J. Dev Biol 2005 279 1 114-124. 23 Viglietto G Dolci S Bruni P et al. Glial cell line - derived neutrotrophic factor and neurturin can act as paracrine growth factors stimulating DNA synthesis of Ret - expressing spermatogonia J. Int J Oncol 2000 16 4 689-694. 24 Ohta H Yomogida K Dohmae K et al. Regulation of proliferation and differentiation in spermatogonial stem cells the role of c - kit and its ligand SCF J. Development 2000 127 10 2125-2131. Effect of Heat Shock Treatment on Proliferation of Spermatogonia MA Wen - zhi 1 2 WANG Yan - rong 1 TIAN Jian - hui 2 1. Key Laboratory of Fertility Preservation and Maintenance of Ministry of Education and Key Laboratory of Reproduction and Heredity of Ningxia Hui Autonomous Region School of Basic Medicine Scientific Ningxia Medical University Yinchuan Ningxia Hui Autonomous Region P. R. Yinchuan 750004 2. Key Laboratory of Animal Genetics and Breeding of the Ministry of Agriculture China Agricultural University Beijing 100193 Abstract Objective To understand the effect of heat shock on mouse spermatogonia proliferation and to explore the mechanism of male short - term infertility caused by high - temperature. Methods Eight - week - old male KM mice were treated with 43 heat shock for 15 minutes. Spermatogonia proliferation and GDNF and SCF gene expression was detected by PCNA immunofluorescence staining at the 1 12 18 25d and 35d after heat shock - treatment and by RT - PCR at the 4h 2d 10d 15d 20d and 25d after heat shock - treatment respectively. Results At the 12 th and 18 th day after heat - shock treatment spermatogonia proliferation index were 22% and 75% which were significantly lower P < 0. 05 than 93% in the control group. At the 25 th day after heat - shock treatment the proliferation levels returned to normal levels. The expression levels of stem cell proliferation promoting regulatory factor GDNF in spermatogonial stem - cell micro - environment significantly P < 0. 05 down - regulated during the 4 th h to 15 th day after shock treatment Stem cell differentiation regulatory factor SCF expression levels was significantly P < 0. 05 down - regulated at the 4 th h to 10 th days after heat shock treatment. Conclusion The expression of GDNF and SCF genes significantly reduced shortly after heat shock treatment and permatogonia proliferation was inhibited. Key words heat shock spermatogonia proliferation niche