33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1 E2924X P = 0. 037 IVS21-66T /C 16 56. 25% 20% χ 2 = 4. 699 P < 0. 05 BRCA2 BRCA2 Q754 A 67 48. 87 ± 9. 49 BRCA2 BRCA1 t = 1. 708 P > 0. 05 40% 1 14% BRCA2 2 1. 2 DNA BRCA2 5mL EDTA - 2 3-6 PCR DNA - 80 16 DP318 DNA BRCA2 120μL TE - 20 1 1. 3 1. 1 http / /genome. ucsc. 2008 5-2010 7 edu / 7 3 1 3 1 1 BRCA2 2 2 Exon Size bp 5 3 3 F AAGCAGTCTTCCTGCCTCAG 11A 754 63 4 16 16 R TTTCAGGTGGCAACAGCTC 21 ~ 61 43. 62 ± 10. 69 F GCAATTTTAGCAGTTTCAGGAC 14-2 429 58. 6 R GGGCTTTAAAATTACCACCA 30 31 ~ F TTTGTCCTGTTTAAAGCCATC 22 409 58 R AGTGGATTTTGCTTCTCTGA 2010-10 - 22 2008 6 1983 - E - mail c340@163. com E - mail yjjster@gmail. com 1. 4 PCR 50μL 10 PCR Buffer 5μL 10mmol L - 1 dntp 1. 2μL 25 mmol L - 1 MgCl 2 3μL Taq DNA 1U DNA 200ng 0. 33μmol L - 1 ddh 2 O
516 33 50μL 94 3 min 94 30s s 1 72 30s 72 5min 4 PCR 10μL 1. 5% 110V 30min 1. 5 PCR 2. 1 16 3 2 2 11 1. 6 2405 delt 2610 G > C 1 2 2 BIC GenBank BRCA2 1 22 8998 G > T 3 2 BIC 46 5 Blast ht- 2 tp / /blast. ncbi. nlm. nih. gov /Blast. cgi 2 BRCA2 / / BIC F6 46 exon11 2610 G > C MET to Ile 50 0 F10 41 exon22 8998 G > T Glu to stop 45 4 F15 58 exon11 2405 delt Stop 729 53 0 F2 48 Intron14 7663 + 53 C > T No coding 60 4 F13 44 exon14 7470 A > G Ser to Ser 53 10 S22 31 exon11 2457 T > C His to His 7 S23 35 Intron10 2138-51 G > T No coding 0 37 ~ 67 Intron21 8983-66 T > C No coding 9 6 4 F1 ~ F16 S1 ~ S30 GenBank BRCA2 U43746. 1 BIC 2. 2 3 2610 G > C 794 IVS21-66T > C 16 56. 25% 9 /16 MET Ile MET 20% 6 /30 χ 2 = 4. 699 P < 1 0. 05 8998 G > T 2924 Glu 3 BRCA 2 13q12 ~ 13 8 1 2405 del T 27 mrna 11386bp 729 3418 BRCA1 BRCA2 3 BRCA2 16 18. 75% 10% ~ 20% BRCA2 1 0 /30 BRCA2 P = 0. 037 2. 3 BIC 5 1 60% ~ 70%
6. 16 BRCA2 517 Wilkins 2000. 16 3 3. 219 18. 75% BRCA1 BRCA2 J. 9-12 2008 18 5 370-374. 4. 2 BIC BRCA1 BRCA2 J. 1 2610 G > C 794 MET Ile MET 5. BRCA1 BRCA2 DBC2 J. 2010 4 2 198-201. 46 50 6. BRCA2 BRCA1 BRCA2 J. 1 2405 delt 726 2006 23 1 27-31. 7 Eva Gross Norbert Arnold Katharina Pfeifer et al. I- 729 dentification of specific BRCA1 and BRCA2 variants by 53 DHPLC J. Human Mutation 2000 16 345-353. 13 /25 5 8 Wooster R Bignell G Lancaster J et al. Identification 2 /2 of the breast cancer susceptibility gene BRCA2 J. Nature 1995 378 789-792. BRCA2 9 Ikeda N Miyoshi Y Yoneda K et al. Frequency of 16 9 BRCA1 and BRCA2 germline muta - tions in Japanese IVS21-66T > C breast cancer families J. Int J Cancer 2001 91 83-88. P < 0. 05 10 Shoei S Li L Tseng HM et al. Molecular characterization of germline mutations in the BRCA1 and mrna BRCA2 genes from breast cancer families in Taiwan J. Hum Genet 1999 104 201-204. BRCA2 0 /3 11 Kwong A Wong LP Wong HN et al. A BRCA2 BRCA2 founder mutation and seven novel deleterious BRCA mutations in southern Chinese women with breast and ovarian cancer J. Breast Cancer Res Treat 2009 1 Berchuck A Carney M Lancaster JM et al. Familial breast - ovarian cancer syndromes BRCA1 and BRCA2 J. Clin Obstet Gynecol 1998 41 1 157-166. 2 Harris JR Lippman MG Morrow M et al. Diseases of the breast second edition M. Lippincott Williams & 2008 18 8 566-572. 117 3 683-686. 12 Jara L Ampuero S Santibanez E et al. BRCA1 and BRCA2 mutations in a south American population J. Cancer Genet Cytogenet 2006 166 36-45. Analysis of the Mutations of BRCA2 Gene among Patients with Familial Breast Cancer CUI Zhen 1 YANG Yun-zhen 2 YU Hui 2 ZHANG Da-qing 1 YU Jian-jun 3 1. Ningxia Medical University Yinchuan 750004 2. Ningxia People s Hospital Yinchuan 750021 3. The General Hospital of Ningxia Med. Univ. Yinchuan 750004 Abstract Objective To analyze the prevalence of BRCA2 gene mutations in patients with familial breast cancer. Methods Peripheral blood Samples were collected from 16 patients with familial breast cancer from 16 breast cancer families and 30 sporadic breast cancer patients controls. BRCA2 gene mutations were de-
518 33 tected by polymerase chain reaction PCR and direct sequencing. Results Three pathogenic mutations were found in these 16 familial breast cancer patients 18. 75% and two of them were novel mutations missense mutation 2610 G > C and frameshift mutation 2405 del T. No pathogenic mutations were detected in 30 sporadic breast cancer patients 18. 75% VS 0 P = 0. 037. Nine familial and six poradic breast cancer patients showed a known variation in intron 21 IVS21-66T > C. The mutation ratio of familial breast cancer patients 56. 25% 9 /16 was higher than that of controls 20% 6 /30 and the difference was significant χ 2 = 4. 699 P < 0. 05. Conclusion The mutations of BRCA2 is related to Chinese familial breast cancer in Ningxia. It is necessary to give genetic test for familial breast cancer patients especially in those population with high familial risk of breast cancer. Key words breast cancer BRAC2 mutation polymorphism 510 12 Park YW Zhu S Palaniappan L et al. The metabolic syndrome prevalence and associated risk factor findings in the third national health and nutrition examina- 9. tion surrey 1988-1994 J. Arch Intern Med J. 2009 25 12 1411-1413. 10. J 2010 22 J 2009 20 4 132-134. 3 338-339. 2003 163 4 427-436. 13. 715-721. 11. 14 Park YW Zhu S Palaniappan L et al. The metabolic J. 2008 30 syndrome prevalence and associated risk factor findings in the third national health and nutrition examination surrey 1988-1994 J. Arch Intern Med 2003 163 4 427-436. Risk Factors of Metabolic Syndrome in Han and Hui Ethnic Group of Yinchuan BAI Dan ZHU Ling - qin JI Wen - wu LIU Xiu - fang YANG Hui - fang School of Public Health Ningxia Medical University Yinchuan 750004 Abstract Objective To investigate the risk factors and its characteristics in patients with metabolic syndrome MS in Yinchuan. Methods A case - control study was performed. 200 patients were selected as case group and matched the controls according to gender age and ethnicity A questionnaire survey was conducted. The relationship between risk factors and MS was analyzed by multivariate logistic regression analysis. Results 1. Body weight BMI systolic blood pressure diastolic blood pressure were the risk factors for MS P < 0. 05. 2. Analysis showed that addicted to meat OR = 2. 890 Hui OR = 2. 741 Han OR = 3. 154 addicted to salt OR = 1. 752 Hui OR = 2. 089 were the risk factors for MS P < 0. 05. Conclusion Weight hypertension and eating habits are the risk factors for MS and the MS risk factors of Hui and Han ethnic group in Yinchuan showed ethnic differences. Key words metabolic syndrome Hui nationality risk factors