ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042) 1 (glutaredoxin1,grx1) 2,. Grx1, pcdna311 ( + )2hGrx1 HEK293T, RT2PCR Western, Grx1 ; H 2 O 2,, Grx1, (MDA), (SOD) (LDH), Grx1 ; 100 molπl H 2 O 2, Western 120 min HEK293T p38mapk.,hek293t Grx1, ; p38mapk H 2 O 2 5 min,15 min, 120 min ; Grx1 p38mapk H 2 O 2, Grx1 H 2 O 2 p38mapk. ; HEK293T ; ; p38mapk; Q51 Grx1 Overexpression Inhibited Activation of P38 MAPK Signal 2) Transduction Pathway Induced by H 2 O 2 in HEK293T Cells ZOU Chao2Xia 1), LI Qiang 2), LIU Ying2Ying 1), WU Li2Fang 1), ZHANG Chun2Jing 3), FANG Shao2Hong 1), ZHOU Hong2Bo 1) 3 ( 1) Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin 150081, China ; Department of 4 th General Surgery, Second Affiliated Hospital of Harbin Medical University, Harbin 150081, China ; 3) Department of Biochemistry, Qiqihar Medical University, Qiqihar 161042, China) Abstract Glutaredoxin1 ( Grx1) is an important thiol2disulfide oxidoreductase in the cells, and it plays a crucial role in the maintenance of cellular redox homeostasis and the defense against oxidative stress. In order to study the anti2oxidative mechanism of Grx1, a recombinant expression vector pcdna311 ( + ) 2hGrx1 was transfected into HEK293T cells by transient transfection. The level of transient expressed recombinant human Grx1 was assayed by RT2PCR and Western blot analysis. The oxidation damage cell model was established by treating the HEK293T cells with H 2 O 2. The viability and antioxidant effect of the cells were evaluated by MTT : 2007211216 ; : 2008201227 (No. D2007213) ; (No. 2005238) ; (No. 066024) 3 Tel : 04512866716842319,E2mail : hongbozhou67 @yahoo. com. cn Received : November 16, 2007 ;Accepted : January 27,2008 Supported by Heilongjiang Natural Science Foundation (No. D2007213) ;Heilongjiang Health Bureau Foundation (No. 2005238) and Fund for Young Teachers of Harbin Medical University(No. 066024) 3 Corresponding author Tel : 04512866716842319,E2mail : hongbozhou67 @yahoo. com. cn
538 24 assay, LDH release assay, MDA contents measurement and the SOD activity test. Western blot analysis was also used to estimate p38mapk activation following 100 molπl H 2 O 2 exposure in HEK293T cells during 120 min. The results showed that Grx1 overexpression was able to relieve the H 2 O 2 2induced cellular oxidative stress in HEK293T cells. The level p38mapk phosphorylation was increased at 5 min, reached the maximum at 15 min and lasted until 120 min in pcdna311 ( + ) transfected control group, whereas the p38mapk phosphorylation level remained stable in pcdna311 ( + ) 2hGrx1 pre2transfected group. These results suggested that Grx1 exerted an anti2oxidation activity by inhibiting the p38mapk pathway. Key words glutaredoxin1 ; HEK293T cells ; oxidative stress ; p38mapk; transient transfection (glutaredoxin, Grx) 2, [1 ]. Grx 2, Grx1 ; Grx2 [2 ]. Grx1 Cys 22 2Pro2Tyr2Cys 25 (CPYC),, [3 ]. Grx1,. [4,5 ], Grx1, JNK Akt., p38mapk, Grx1 p38mapk. Grx1 p38mapk, HEK293T Grx1, Grx1 p38mapk, Grx1. 1 111 RPMI1640,DMEM Gibco.. Trizol ThermoScript RT2PCR System platinum Taq DNA polymerase lipofectamine2000 Invitrogen. (MTT) Sigma.. Grx1 Abcom. p2p38 ( IgM) ( HRP) IgM Santa cruz. HRP IgG. ECL plus Amersham. MDA SOD LDH. 112 pcdna311 ( + ) Invitrogen, pcdna311 ( + )2hGrx1 [6 ] 1HEK293T( 293T) ( ) 10 % DMEM (100 IUΠmL 100 mgπl ), 37,5 % CO 2. 113 293T 24 h, 112 10 5 Πml 6. 50 % 70 %, Lipofectamine2000, pcdna311 ( + ) pcdna311 ( + )2hGrx1 ( Grx1 ). 24 h,. 114 RT2PCR 293T, Trizol RNA, RT2PCR. Grx1 5 2CTGAA TTCGGCATGGCTCAAGAGTT23 ; 5 2 CGTCTAGAGGGCCTGTTCTGTGGTTACTG23 ; : 94 2 min ;94 30 s,57 30 s,72 45 s,30,72 10 min., 2 : 5 2AAGGATTCCTATGTGGGC23, 5 2CATCT CTTGCTCGAAGTC23. :94 2 min ;94 30 s, 55 30 s,72 45 s,30 72 10 min. 115 %, YLN2000. 115 Grx1 : 293T, 30 min,12 000 rπmin 15 min,,. 75 g 15 % SDS2PAGE,,40 V,4 2 h,1 TBST( 0105 % Tween20), 5 % 1 TBST 115 h, ( Grx1,1 1 000 ),4,, (1 5 000 ) 1 h,, ECLplus.,
6 : Grx1 HEK293T H 2 O 2 p38mapk 539 1 200. p38mapk : 24 h, Grx1, 100 molπl H 2 O 2 PBS, 5 min 15 min 30 min 60 min 90 min 120 min.,, 100 g, 10 %SDS2PAGE.,,, 5 % BSA 1 TBST( 0105 %Tween20) 37 1 h, ( p2p38,1 200 ) 4,, ( HRP PBS 10 l, 300 molπl, 1 PBS,, SOD MDA LDH,.. 118 ( gx s), SPSS1310. (One2Way ANOVA) t ( t2test). IgM,1 1 000 ) 115 h,,eclplus 2., 1 200. 211 Grx1 116 293T Grx1 24 h, Grx1, RNA, RT2PCR H 2 O 2 PBS 10 l, H 2 O 2 100 Western., Grx1 200 300 400 500 molπl,, Grx1 mrna 1 PBS, 6. [7 ]., ( P < 117 0105) ( Fig11). Grx1 24 h, Grx1 H 2 O 2. Fig.1 Detection of transient overexpression of Grx1 gene in 293T cells 293T cells were transfected with pcdna311 ( + ) or pcdna311 ( + ) 2hGrx1 for 24 hours, Grx1 mrna (A) and protein(b) were determined by relative quantitative reverse transcription2pcr and Western blotting. Grx1 mrna levels were expressed as relative intensity of Grx1 to 2actin. The data in (A) represented mean SD, derived from three independent experiments. Grx1 mrna level in pcdna311 ( + ) 2hGrx1 group was significantly higher than pcdna311 ( + ) group. (A) 1 : pcdna311 ( + ) ;2 : pcdna311 ( + )2hGrx1 ; M:Marker ; (B) 1 : pcdna311 ( + ) ; 2 : pcdna311 ( + )2hGrx1 ; 3 P < 0105 vs pcdna311 ( + ) group 212 Grx1 293T Grx1, (MTT ) SOD MDA LDH. MTT, Grx1 H 2 O 2 ;, H 2 O 2 ; H 2 O 2, Grx1,
540 24 ( P < 0105) (Fig12). Table 1, H 2 O 2, MDA SOD ( P < 0105). 300 molπl H 2 O 2 3 h, MDA ( P < 0101), Grx1 MDA ( P < 0105), Grx1 MDA ( P < 0105) ; SOD ( P < 0101), Grx1 SOD ( P < 0105) 1 H 2 O 2, LDH ( P > 0105), 300 molπl H 2 O 2, LDH, Grx1 LDH ( P < 0105) (Fig13). 213 Grx1 H 2 O 2 p38mapk H 2 O 2, p38mapk ; 100 molπl H 2 O 2 5 min,p38mapk,15 min, 120 min. 293T,100 molπl H 2 O 2 p38mapk Fig. 2 Effect of Grx1 overexpression on cell viability in 293T cells by MTT assay 293T cells transfected with pcdna311 ( + ) or pcdna311 ( + ) 2hGrx1 were treated with different concentration of H 2 O 2 for 3 hours. The cell viability in pcdna311 ( + ) 2hGrx1 group was significantly increased as compared with pcdna311 ( + ) group. Each group contained six wells and the assay was repeated three times. 3 P < 0105, # P < 0101 vs pcdna311 ( + ) group ; Grx1, 100 molπl H 2 O 2 p38mapk., Grx1 H 2 O 2 p38mapk (Fig14). 3 Grx 2, (CPYC) 2,,., Grx1 Fig. 3 Cell damage induced by H 2 O 2 was measured by LD H release assay in 293T cells 293T cells transfected with pcdna311( + ) or pcdna311 ( + )2hGrx1 were treated with 300 molπl of H 2 O 2 for the indicated period. The activity of cytoplasmic enzyme released was shown as a percentage of LDH (glutathione,gsh) NADPH Grx1, activity in the medium over the total enzyme activity. The LDH release rate in pcdna311 ( + )2hGrx1 group was significantly., Grx1 decreased as compared with pcdna311 ( + ) group. The data represent mean S1D. derived from three independent, experiments. 3 P < 0105, # P < 0101 vs pcdna311( + ) group Table 1 Effect of Grx1 overexpression on MDA contents and SOD activity in 293T cells Group Control H 2 O 2 MDAΠnmol mg - 1 protein SOD/ U mg - 1 protein pcdna311 ( + ) pcdna311 ( + )2hGrx1 pcdna311 ( + ) pcdna311 ( + )2hGrx1 21652 01684 21373 01708 411751 51220 431582 41276 51852 01732 # 31848 11128 3 181714 41519 # 271882 51458 3 # 293T cells transfected with pcdna311 ( + ) or pcdna311 ( + )2hGrx1 were treated with 300 molπl of H 2 O 2 for 3 hours. The MDA contents in pcdna311 ( + )2 hgrx1 group was significantly decreased as compared with pcdna311 ( + ) group. The SOD activity in pcdna311 ( + )2hGrx1 group was significantly increased as compared with pcdna311 ( + ) group. The data represent mean S1D. derived from six independent experiments 3 P < 0105 vs pcdna311 ( + ) group, P < 0105 vs control, # P < 0101vs control
6 : Grx1 HEK293T H 2 O 2 p38mapk 541 Fig. 4 Effect of Grx1 overexpression on p38mapk phosphorylation level in 293T cells under oxidative stress 293T cells transfected with pcdna311 ( + ) (A) or pcdna311 ( + )2hGrx1 (B) were treated with 100 molπl H 2 O 2 for the indicated period. The phosphorylation level of p38mapk was detected by Western blotting analysis. The peak value of phosphorylated p38mapk was detected at 15 min after stimulation with 100 molπl H 2 O 2. p2p38 :phosphor2p38 [8 ].,, GSH Grx1. Grx1, H 2 O 2,, MTT, MDA SOD LDH.,H 2 O 2, Grx1, MDA, SOD, LDH,, Grx1, Grx1 293T. (MAPK),,. 5 MAPK, ERK1Π2 JNK ERK5ΠBMK1 ERK3Π4 p38 MAPK [9 ]., p38mapk H 2 O 2. Ushio2Fukai [10 ] 50 100 200 molπl H 2 O 2 (VSMC),, H 2 O 2 p38mapk, 200 molπl H 2 O 2 2 min p38mapk, 15 min. [11 ],H 2 O 2 p38mapk,,100 molπl H 2 O 2 VSMC 5 min p38mapk, 10 min 120 min.,h 2 O 2 p38mapk., 100 molπl H 2 O 2 5 min 15 min 30 min 60 min 90 min 120 min p38mapk,.,, 100 molπl H 2 O 2 5 min, p38mapk,15 min, 120 min ; Grx1 p38mapk, Grx1 H 2 O 2 p38mapk. Grx1 p38mapk?, : MAPKKK, MAPKK;MAPKK MAPK. p38mapk MKK3 MKK6, ASK1 p38mapk MAPKKK [12 ]. Song [4 ],,Grx1 C ASK1,., H 2 O 2,, GSH GSSG,GSSG Grx1, Grx1, Grx1 ASK1, ASK12SEK12JNK1,., Grx1 ASK1., Grx1 ASK1, ASK1 MKK3 MKK6 p38mapk,.,.,grx1 p38mapk, Grx1 p38mapk,. ( References) [ 1 ] Fernandes A P, Holmgren A. Glutaredoxins : glutathione2dependent redox enzymes with functions far beyond a simple thioredoxin backup system [J ]. Antioxid Redox Signal, 2004,6 (1) :63274 [ 2 ] Lundberg M, Johansson C, Chandra J. Cloning and expression of a novel human glutaredoxin ( Grx2) with mitochondrial and nuclear
542 24 isoforms [J ]. J Biol Chem,2001,276 (28) :26269226275 [ 3 ],,,. [J ]. ( Zhang Chun2Jing, Yu Hai2 Tao, Zou Chao2Xia, et al. Biological activities and the relation with human disease of glutaredoxin[j ]. Chem Life),2006,26(2) :1632165 [ 4 ] Song J J, Rhee J G, Suntharalingam M, et al. Role of glutaredoxin in metabolic oxidative stress. Glutaredoxin as a sensor of oxidative stress mediated by H 2 O 2 [J ]. J Biol Chem, 2002, 277 (48) :465662 46575 [ 5 ] Murata H, Ihara Y, Nakamura H, et al. Glutaredoxin exerts an antiapoptotic effect by regulating the redox state of Akt [J ]. J Biol Chem,2003,278(50) :50226250233 [ 6 ],,,. 1 [J ]. ( Zou Chao2Xia, Zhang Chun2Jing, Wu Li2Fang, et al. Cloning of human glutaredoxin 1 gene and construction of its eukaryotic expression vector [ J ]. J Harbin Medical University),2006,40(5) :3542357 [ 7 ],,,. [J ]. (Zhou Hong2Bo, Wang Xiu2Hong, Wang Ai2Min, et al. Protection of hemin against oxidative2stress damage in human umbilicus vein endothelial cells[j ]. Chin J Biochem Mol Biol), 2003,19 (4) : 5282 532 [ 8 ] Holmgren A. Antioxidant function of thiodoxin and glutaredoxin systems [J ]. Antioxid Redox Signal, 2000, 2 (4) :8112820 [ 9 ],,,. p38 LPS Raw26417 [J ]. (Zhang Lin, Liu Nu2Yun, Jiang Yong, et al. p38 signaling pathway involved in LPS induced cytoskeleton rearrangement in Raw264. 7 cells[j ]. Chin J Biochem Mol Biol),2007,23 (5) : 4002404 [10 ] Ushio2Fukai M, Alexander R W, Akers M, et al. p38 mitogen2 activated protein kinase is a critical component of the redox2 sensitive signaling pathways by angiotensin II : role in vascular smooth muscle cell hypertrophy[j ]. J Biol Chem, 1998, 273 (24) :15022215029 [11 ] Blanc A, Pandey N R, Srivastava A K. Synchronous activation of ERK 1Π2, p38mapk and PKBΠAkt signaling by H 2 O 2 in vascular smooth muscle cells : potential involvement in vascular disease (review) [J ]. Int J Mol Med, 2003,11(2) :2292234 [12 ] Torres M. Mitogen2activated protein kinase pathways in redox signaling [J ]. Front Biosci, 2003,8 : d3692391 DNA,.,, DNA. DNA, 583 000, DNA 18. Mycoplasma genitalium,,.,,., 101,., DNA 5 000 6 000. 101 DNA, 1 80,., 4, 1Π4.,,4 DNA E. coli, E. coli DNA.,.,Smith. DNA 4, 2008 1 24 Science. DNA,.,,,.,.,.,. ( P. Barry :Science News, January 26,2008,Vol. 173,p. 52)