Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology (5) : Trx1 HBZY21 MMP9 1),2), 1), 1), 1), 1), 1) 1),3) 3, ( 1), ; 2), ; 3), ) 1 (thioredoxin1,trx1) 2,. Trx1 (glomerular mesangial cells) HBZY21 9 (matrix metalloproteinase 9, MMP9), Trx1 ; RT2PCR HBZY21 MMP9 mrna ;.,, MMP9 mrna 12 h 24 h 48 h ( P < 0105) ;HBZY21 Trx1,MMP9 mrna MMP9, ( P > 0105), Trx1,, ( P < 0101) ;, 12 h 24 h 48 h ( P < 0101), Trx1 Trx1,, ( P < 0105).,,Trx1 MMP9. Trx1, Trx1. ; 1 ; 9 ; Q51 Effect of Trx1 Overexpression on Expression Level of MMP9 under High Glucose Condition in HBZY21 FANG Shao2Hong 1),2), LIU Xin2Ping 1), J IN Yu2Hong 1), J IA Hui2Jie 1), NA Li2Ying 1), ZHENG Hai2Xia 1) 1),3) 3, ZHOU Hong2Bo ( 1) Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin , China ; 2) Department of Experimental Research Center, the Second Affiliated Hospital of Harbin Medical University, Harbin , China ; 3) Biotechnology Experimental Center for Teaching, Harbin Medical University, Harbin , China) Abstract Thioredoxin1 (Trx1) is an important thiol disulfide oxidoreductase in the cell,which plays a crucial role in the maintenance of cellular redox homeostasis against oxidative stress. To study the effects of Trx1 over2 expression on matrix metalloproteinase 9 ( MMP9) expression, HBZY21 cells were transfected with either PIRESpuro32sense2Trx1 and PIRESpuro32antisense2Trx1. The Trx1 expression was assayed by RT2PCR and Western blotting. The mrna level of MMP9 and its enzyme activity were determined by RT2PCR and gelatin zymography. The ROS level was detected by flow cytometry. The results showed that the MMP9 mrna and enzyme activity were significantly increased at 12, 24 and 48 hours under high glucose condition ( P < 0105). : ; : (No ), (No ) 3 Tel : ; E2mail : com. cn Received : December 10,2008 ;Accepted : March 4,2009 Supported by Heilongjiang Health Bureau Foundation (No ) and Fund for Young Teachers of Harbin Medical University (No ) 3 Corresponding author Tel : ; E2mail : com. cn

2 A similar response was showed in antisense2trx1 transfected cells ( P < 0101), but for sense2trx1 transfected cells, no such increase was observed ( P > 0105). The ROS level under high glucose was significantly higher than that under normal glucose at 12, 24, and 48 hours ( P < 0101). In sense2trx1 transfected cells, the ROS level was significantly lower than that in antisense2trx1 transfected cells ( P < 0105). Taken together, the inhibition of MMP9 expression and activity by Trx1 over2expression was regulated by the ROS level under high glucose conditions in HBZY21 cells. This suggests that Trx1 may be applied for the treatment of diabetic nephropathy. Key words diabetic nephropathy ; thioredoxin1 ; matrix metalloproteinase 9 ; reactive oxygen species 1 (thioredoxin1,trx1), 108, 12 kd. Cys2Gly2 Pro2Cys [1 ],.,Trx, [2 4 ]. (diabetic nephropathy,dn),. (extracellular matrix, ECM) DN. ECM. (matrix metalloproteinases,mmps) ECM, ECM [5,6 ], 9 (matrix metalloproteinase 9,MMP9) ECM., MMP9 [7 ]. Trx1,, Trx1 MMP9,., Trx1 MMP9. DN, DN Trizol RT2PCR Lipofectamine TM 2000 Invitrogen ; Trx1 Santa Cruz ; IgG ; ECL plus Amersham ; ROS ; DMEM, RPMI21640 Hyclone ; ; (gelatine) Sigma ;. 112 (HBZY21). :10 % DMEM, 37,5 % CO 2,2 3 d %,.. :, 60 %, 24 h, G 0, ( 516 mmolπl) ( 2515 mmolπl). 0,. Trx1 PIRESpuro32sense Trx1 PIRESpuro32antisense Trx1 thioredoxin21, David P. Carbone ; JM HBZY Πml 6, 70 % 90 %, Lipofectamine2000, 250 l 4 g,, 250 l 10 l, 5 min,, 20 min,,,, 6 h,48 h. 114 RT2PCR Trizol mrna. 1 % mrna, mrna. 1 g mrna RT2PCR cdna. cdna PCR ( Table 1) min,94 30 s,58 30 s,72 45 s,30 72

3 5 : Trx1 HBZY21 MMP9 467 Table 1 Primer sequences and annealing temperature in the different groups Gene 3 Primer sequences Amplified fragment lengthπbp Annealing temperatureπ rmmp29 5 2GGGAACGTATCTGGAAATTCG23 5 2CAGAACCGACCCTACAAAGTTG r2actb 5 2CCGTAAAGACCTCTATGCCAACA23 5 2CGGACTCATCGTACTCCTGCT htrx1 5 2GCGAATTCATGGTGAAGCAGATCGAGAG23 5 2GCGGATCCCACGCAGATGGCAACTGGT rmmp29 : rat MMl29 ; ractb :rat 2 actin ; htrx1 : human Trx1 10 min. 115 %,. 115 HBZY21, 30 min, rπmin 15 min,,. 70 g 15 % SDS2PAGE,,5 %, h 37 1 h, ECL plus,. Trx , ; 1 500, , BIO2RAD GS2800, X, 3, [8 ] g (01125 molπl Tris2HCl, ph 618, 10 %,2 % SDS,0101 % ), 011 % 10 % SDS2PAGE. (215 % Triton X2100,5 mmolπl CaCl 2,1 molπl ZnCl 2, 50 mmolπl Tris2HCl,pH 714) 1 h, ( 1 % Triton X2100, 5 mmolπl CaCl 2, 1 molπl ZnCl 2,50 mmolπl Tris2HCl ph 714) 37, 0135 % ( 25 %, 10 %)., ( PDI Inc,Quantity One,Version 215), HBZY21,, DCFH2DA (DCFH2DA : ), min. PBS 3 5,, PBS,1 000 rπmin, 10 min., 500 l PBS. 488 nm,525 nm. 118 SPSS1010. P < 0105, t. ( x s ) HBZY21 Trx1 HBZY21 Trx1, Trx1 Trx1. RNA, RT2PCR Western.,,RT2PCR, Trx1 Trx1, 421 bp, Trx1, (Fig11A). Western,, Trx1, Trx1 (Fig11B)., Trx1 HBZY21 Trx HBZY21 Trx1 MMP9 mrna (NG) ( HG) MMP9 mrna,,12 h HG NG %, ( P < 0105) ;24 h HG NG %, ( P < 0105) ;48 h HG NG %, ( P < 0105) ( Fig12A)., MMP9 mrna. Trx1 :, Trx1 ( 1, 2 ),HG MMP9 mrna NG ( P < 0105) ; Trx1 (3,4 ),HG MMP9 mrna NG %, ( P < 0101) ;

4 Fig.1 Transient overexpression of Trx1 gene in HBZY21 cells HBZY21 cells were transfected with PIRESpuro32sense Trx1, PIRESpuro32antisense Trx1 and control. After 24 hours, Trx1 mrna level and protein level were determined by RT2PCR and Western blotting. (A) RT2PCR. 1 : Marker ; 2 : PIRESpuro32sense Trx1 plasmid group ; 3 : PIRESpuro32antisense Trx1 plasmid group ; 4 : Control group. (B) Western blotting. 1 : PIRESpuro32sense Trx1 plasmid group ; 2 : PIRESpuro32antisense Trx1 plasmid group ; 3 : Control group (5,6 ),HG MMP9 mrna NG %, ( P < 0101)., MMP9 mrna ( P > 0105) (Fig12B)., Trx1 MMP9 mrna. Fig. 2 The effect of Trx1 overexpression on MMP29 mrna level in HBZY21 cells by RT2PCR (A) MMP9 mrna levels in HBZY21 under normal glucose (NG) and high glucose ( HG) condition for 12,24,48 hours were analyzed by RT2PCR. The data represented mean SD, derived from three independent experiments. 3 P < 0105 vs same time NG group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with normal glucose or high glucose for 48 hours. 1 : Sense Trx1 48 hours NG group ; 2 : Sense Trx1 48 hours HG group ; 3 : Antisense Trx1 48 hours NG group ; 4 : Antisense Trx1 48 hours HG group ; 5 : No transfection 48 hours NG group ; 6 : No transfection 48 hours HG group. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs transfection antisense Trx1 48 hours NG group, # P < 0101 vs no transfection 48 hours NG group 213 HBZY21 Trx1 MMP9, 12 h HG NG %, ( P < 0101),24 h HG NG %, ( P < 0101),48 h HG NG %, ( P < 0101) (Fig13A).,48 h MMP9. Trx1, HG MMP9 NG %, ( P > 0105) ; Trx1, HG MMP9 NG %,

5 5 : Trx1 HBZY21 MMP9 469 ( P < 0101) ;,HG MMP9 NG %, ( P < 0101).,1 3 5 MMP29, ( P > 0105) (Fig13B)., Trx1 MMP9. Fig. 3 The effect of Trx1 overexpression on gelatinic activity of MMP9 in HBZY21 by gelatin zymography (A) Gelatinic activities of MMP9 in the supernatant in HBZY21 under high glucose ( HG) condition were analyzed by gelatin zymography. The data represented mean SD,derived from three independent experiments. 3 P < 0101 vs same time normal glucose (NG) group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with NG or HG condition for 48 hours. 1 : Sense Trx1 plasmid 48 hours NG group ; 2 : Sense Trx1 plasmid 48 hours HG group ; 3 : Antisense Trx1 plasmid 48 hours NG group ; 4 : Antisense Trx1 plasmid 48 hours HG group ; 5 : No transfection 48 hours NG group ; 6 : No transfection 48 hours HG group. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs transfection antisense Trx1 48 hours NG group, # P < 0101 vs no transfection 48 hours NG group 214 Trx1 HBZY21, h, ROS ( P < 0101) (Fig14A). HBZY21 Trx1 ROS, NG, HG ROS, ( P < 0105) ; HBZY21 Trx1 Trx1 ROS, ( P < 0105). Trx1 ( P > 0105) (Fig14B). 3.., DN. MMPs, Gly2X(Leu Ile ), ECM,.,. MMP9, MMPs, [9 ].,, MMP9, MMP9 ECM [10 ]., MMP9.,HBZY h,mmp9, MMP2, [11 ]. [11 ], MMP9 ( B), MMP2 ( A), MMP9. Hirakawa [12 ],MMP9 CA DN. Trx1 MMP9

6 Fig. 4 The effect of Trx1 overexpression on intracellular ROS in HBZY21 cells by flow cytometry HBZY21 were treated with normal glucose (NG) or high glucose ( HG) condition for 48 hours, and intracellular ROS were detected by oxidation2sensitive fluorescent probe (DCFH2DA) with FACScan flow cytometer. (A) The effects of HG condition on intracellular ROS in HBZY21 by flow cytometry. The data represented mean SD, derived from three independent experiments. 3 P < 0101 vs NG group. (B) HBZY21 cells transfected with sense Trx1 plasmid or antisense Trx1 plasmid were treated with normal glucose or high glucose for 48 hours. The data represented mean SD,derived from three independent experiments. 3 P < 0105 vs NG group, # P < 0105 vs transfection sense Trx1 group

7 5 : Trx1 HBZY21 MMP9 471, Trx1,. : Trx1 Trx1 100 %, Trx1 Trx1 100 %, Western Trx1 Trx1, Trx1 Trx1,,.,, Trx1 HBZY21 MMP9 mrna, ; Trx1, MMP9mRNA.,Trx1 HBZY21 MMP9, Trx1. Trx1 MMP9?,.,, (H 2 O 2 ) (O - 2 ) (OH - ), Π,. C(protein kinase C,PKC) (mitogen activated protein kinase,mapk) 2 B ( nuclear factor kappab,nf2 B) 2l (activated protein l,ap21),,,, [13 15 ]. [16 ], 6 12, SOD CAT GSH2Px. Uemura [7 ], ( N2 ) MMP9,., HBZY21 MMP9., Trx1 MMP9? ROS, 12 h 48 h, ROS., ROS., HBZY21 Trx1 MMP9, ROS., Trx1 HBZY21 MMP9., Trx1.,,,, MMP9,.,,. ( References) [ 1 ] Tamura T, Stadtman T C. A new selenoprotein from human lung adenocarcinoma cells : purification, properties, and thioredoxin reductase activity[j ]. Proc Natl Acad Sci U S A,1996,93(3) : [ 2 ] Tomlinson D R. Mitogen2activated protein kinases as glucose transducers for diabetic complications [ J ]. Diabetologia, 1999, 42 (11) : [ 3 ] Arnold N B,Ketterer K,Kleeff J, et al. Thioredoxin is downstream of Smad7 in a pathway that promotes growth and suppresses cisplatin2 induced apoptosis in pancreatic cancer [ J ]. Cancer Res, 2004, 64 (10) : [ 4 ] Lovell M A, thioredoxin21 Xie C, Gabbita S P, et al. Decreased thioredoxin and increased thioredoxin reductase levels in Alzheimerπs disease brain[j ]. Free Radic Biol Med,2000,28(3) : [ 5 ] Murphy G, Docherty A J. The matrix metalloproteinases and their inhibitors[j ] Am J Respir Cell Mol Biol, 1992, 7 (2) : [ 6 ],,, [J ]. (Ding Zhi2Min,Wu Jian2Xin, Li Yuan2Yuan, et al. Clinical study of matrix metalloproteinase29 and transforming growth factor2 1 related with diabetic nephropathy[j ]. Chin J Diabetes),2003,11 (5) : [ 7 ] Uemura S,Matsushita H, Li W, et al. Diabetes mellitus enhances vascular matrix metalloproteinase activity : role of oxidative stress [J ]. Circ Res, 2001,88(12) : [ 8 ],,,. Grx1 HEK293T H 2 O 2 p38mapk [J ]. ( Zou Chao2Xia, Li Qiang, Liu Ying2Ying, et al. Grx1 overexpression inhibited activation of P38 MAPK signal transduction pathway induced by H2O2 in HEK293T cells[j ]. Chin J Biochem Mol Biol),2008,24 (6) : [ 9 ] Massova I, Kotra L P, Fridman R, et al. Matrix metalloproteinases structures, evolution, and diversification [ J ]. FASEB J, 1998, 12 (12) : [10 ] Bai Y,Wang L,Li Y, et al. High ambient glucose levels modulates the production of MMP29 and alpha5 ( ) collagen by cultured podocytes [J ]. Cell Physiol Biochem,2006,17 (122) : [11 ],,,. ERK1Π2 B [J ]. (Bai Ya2Ling, Huang Hai2

8 Chang,Li Jing2Zi,, et al. High glucose regulates the production of MMP9 in podocyte through ERK1Π2 signal pathway[j ]. Natl Med J China),2005,85 (21) : [12 ] Hirakawa S,Lange E M, Colicigno C J, et al. Evaluation of genetic variation and association in the matrix metalloproteinase 9 (MMP9) gene in ESRD patients[j ]. Am J Kidney Dis,2003,42(1) : [13 ] Ha H, Lee H B. Reactive oxygen species as glucose signaling molecules in mesangial cells cultured under high glucose [J ]. Kidney Int (Suppl), 2000, 77 : S19225 [14 ] Scivittaro V,Ganz M B,Weiss M F. AGEs induce oxidative stress and active protein kinase C2beta ( ) in neonatal mesangial cells[j ]. Am J Physiol Renal Physiol,2000,278(4) : [15 ] Suzuki S, Hinokio Y, Komatu K, et al. Oxidative damage to mitochondrial DNA and its relationship to diabetic complications[j ]. Diabetes Res Clin Pract,1999,45 (223) : [16 ],,,. 2 [J ]. (Chen Ling, Jia Ru2 Han, Ding Guo2Hua, et al. Renal protection of valerian oil and its mechanism in type 2 diabetic rats[j ]. Chin J Nephrol),2003,19(3) : RNA, ( RNA ), 50. RNA.,,. :,. David M. Brown RNA,. RNA, RNA., OPKO Health Allergan RNA ; RNA (VEGF),. 5, Ambati VEGF RNA,.,Ambati TLR3.,,. 600 TLR3., TLR3,., TLR3,., RNA, TLR3.., RNA TLR3,,,. OPKO Sam Reich. OPKO 400, ;, 600,., RNA,.,Brown TLR3, TLR3,.. ( Nature News,2008,doi : Πnews , )