Isolation and Identification of Vibrio vulnificus from Infected Tilapia and Its Drug-sensitivity Analysis

Σχετικά έγγραφα
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Isolation of Pathogenic Bacteria Aeromonas hydrophila from. Acipenser baerii and Immune Effect of Its whole Cell Vaccine

Identification of Fish Species using DNA Method

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

V G III MIC. Table 1. Methods and reporting values of antimicrobial susceptibility testing and their interpretations

K-B 16S rdna Shewanella putrefaciens LD cfu / g A

30s 56 60s 72 60s dntp cm s s s 23

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Biapenem BIPM Lot No g mg

MSM Men who have Sex with Men HIV -

Escherichia coli. Escherichia coli Proteus mirabilis Klebsiella pneumoniae

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

capitis subsp. ureolyticus

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

(Fenneropenaeus chinensis)

Clostridium 1) C. symbiosum. a-galactocidase C. hathewayi cellobiose a-arabinosidase. clostridioforme

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

, DYY-8B, ; : Centrifuge 11 R. min

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο

MRSA PRSP BLNAR 40. Key words: antimicrobial resistance, respiratory tract infection, community-acquired infection MRSA (PC) (CP)

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Tazobactam piperacillin ESBL

Medicago marina 2012

Comparison of nutrient components in muscle of wild and farmed groups of Myxocyprinus asiaticus

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Etest. cefepime. oxacillin Staphylococcus aureus oxacillin. imipenem piperacillin ceftazidime cefpirome

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Ct L1 L2/L2a L3. NGU human papilloma virus HPV Ct human immunodeficiency virus HIV PCR RFLP

Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

SUPPORTING INFORMATION

16S rrna ARDRA Q938 A (2008) : (2006BAD07B03, 2006BAD08A08, 2006BAD17B08); (NYHYZX07-050)

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

272F : 56 2AGAGTTTGAT 70 %, ( Probiotics), DNA ) ; GIS22008 ( CCTGGCTCAG23,14922R : 5 2GGTTACCTTGTTACGAC. rdna,

Shiraia sp. Slf14 III

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Science of Sericulture

Arbitrage Analysis of Futures Market with Frictions

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

OBI. ELISA HBsAg - OBI. HBsAg + B V14G /A Y161F /S V168A P217L C E2G /A /V T118R /K /A /M P127T /L /H /S E164D /G L175S S174N

ESBL DNA SHV- 1 Kluyvera. Yoshikazu ISHII

Intestinal protozoal infection, Traveller's diarrhoea, Giardia lamblia

ER-Tree (Extended R*-Tree)

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Φυσικοθεραπευτής, MSc, Εργαστηριακός συνεργάτης, Τμήμα Φυσικοθεραπείας, ΑΤΕΙ Λαμίας Φυσικοθεραπευτής

Strain gauge and rosettes

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

Development of a Tiltmeter with a XY Magnetic Detector (Part +)

BGP TRACP-5b BGP TRACP-5b P 0.05

CorV CVAC. CorV TU317. 1

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

The Impact of Stopping IPO in Shenzhen A Stock Market on Guiding Pattern of Information in China s Stock Markets

Toxic Effects of Ammonia to Hemifusus tuba Juveniles at Different ph and Salinity

Approximation Expressions for the Temperature Integral

College of Life Science, Dalian Nationalities University, Dalian , PR China.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία


LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ

Nguyen Hien Trang* **

DNA, , DNA, 1 D NA . DNA

Research on Economics and Management

Γεωπονικό Πανεπιςτήμιο Αθηνών Τμήμα Αξιοποίηςησ Φυςικών Πόρων και Γεωργικήσ Μηχανικήσ

A life-table metamodel to support management of data deficient species, exemplified in sturgeons and shads. Electronic Supplementary Material

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

Key words : Vero toxin, O157, enterohemorrhagic E. coli, antibiotics

Molecular evolutionary dynamics of respiratory syncytial virus group A in

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

ICU ICU

In vitro και in vivo φαρμακοκινητική ανάλυση των παραγώγων ανθρακινόνης σε φυτικά σκευάσματα

Φαινομενολογία και γενετική ταξινόμηση της πρωτοπαθούς δυστονίας - Νεώτερα δεδομένα

High order interpolation function for surface contact problem

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

SMD Wire Wound Ferrite Chip Inductors - LS Series. LS Series. Product Identification. Shape and Dimensions / Recommended Pattern LS0402/0603/0805/1008

Transcript:

2011 33 5 0965 0970 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E mail ndxb7775@ sina. com 1 2 1 2* 1 2 1 1 1 1 1 1. 510380 2. 201306 2010 ZH1 ATB 32E 16S rrna Vibrio vulnificus 19 S965. 125 A 1000 2286 2011 05 0965 06 Isolation and Identification of Vibrio vulnificus from Infected Tilapia and Its Drugsensitivity Analysis LI Jiong 1 2 YE Xing 1 2* LU Maixin 1 2 DENG Guocheng 1 GAO Fengying 1 KE Xiaoli 1 ZHU Huaping 1 HUANG Zhanghan 1 1. Pearl River Fishery Research Institute CAFS Guangzhou 510380 China 2. College of Fisheries & Life Shanghai Ocean University Shanghai 201306 China Abstract In Spring of 2010 largeranging diseases occurred in tilapia farms in Guangdong and Hainan provinces. A Gramnegative pathogenic bacterial strain ZH1 was isolated from diseased tilapia fry cultured in a farm in Zhuhai Guangdong. Artificial infection experiments showed that the isolated strain possessed strong virulence. This isolated strain was identified as Vibrio vulnificus using ATB 32E identification and 16S rrna sequence analysis. The drugsensitivity test of a total of 29 antimicrobial agents showed that the strain ZH1 was highly sensitive to 18 agents such as Norfloxacin Cefaclor Ofloxacin and Spectinomycin. The results of pathogen identification and drug sensitivity test will be helpful for effective prevention of fish diseases. Key words tilapia Vibrio vulnificus isolation identification drug sensitivity 85 2010 280 t 8% 2010 120 t 2011 01 20 2011 07 10 863 2011AA100404 CARS 49 2009B020201003 A201001C05 1985 E mail gzlijiong@ 163. com * E mail gzyexing@ 163. com

966 33 48% 1 2009 Vibrio vulnificus 2 3 1970 Roland 4 1976 Hollis 5 1979 Farmer 6 7 metaprotease 8 a am 9 2006 10 2003 11 12 14 15 18 2005 Trachinotus Ovatus 19 2007 20 1988 10% ~ 20% 21 22 23 24 28 2010 3 5 1 1. 1 Oreochromis niloticus GIFT strain 0. 5 g 0. 5 g PCR EDC 810 ATB ID 32E Biomerieux PCR Takara 1. 2 75% v /v 28 24 h 1. 3 1 24 h 0. 65% 2 6 10 8 cfu /ml 6 10 7 cfu /ml 20 29 ~ 31 20 min 7 d 1. 4 1. 4. 1 24 h

5 967 ATB 1. 4. 2 LB 28 DNA Eppendorf DNA 29 1 16S rrna 1 500 bp AGAGTTTGATCCTG GCTCAG TACGGCTACCTTGTTACGACTT 20 μlpcr 10 Ex taq PCR 2 μl 4 dntp 0. 4 μl 0. 4 μl 20 μmol /L 15. 65 μl 1 μl 60 ng Ex taq 0. 15 μl 5 U /μl PCR 95 5 min 94 30 s 55 30 s 72 1 min50 s 32 72 7 min PCR 15 mg /g Omega pmd18 T Easy Vector Systems TaKaRa PCR Vector NTI suite 9. 0 BLAST http / /blast. ncbi. nlm. nih. gov /blast 1. 5 24 h 29 28 24 h 2 2. 1 7 d 2 6 10 8 cfu /ml 75% 15 /20 6 10 7 cfu /ml 45% 9 /20 2. 2 G ATB ID 32 E 1 Tab. 1 1 ATB 32E Identification of the isolated strain by ID 32 E Item Strain Item Strain d Glucose + 5 5 Ketogluconate Lipase + lysine decarboxylase L L arabitol L L arabinose d Mannitol Indole + Malonate d Galacturonate D D arabitol d Cellobiose + L Acide L aspartique arylamidase Adonitol Arginine dihydrolase Indole d Trehalose + β βglucuronidase β βglucuronidase + β βglucuronidase + α αmaltosidase + α αglucosidase d Maltose + Urease βn N Acetyl β Glucosaminidase d Sorbitol Saccharose Rouge de phenol + L Rhamnose Palatinose Ornithine decarboxylase + α α Galactosidase + + + Denotes positivity Denotes negativity.

968 33 2. 3 16S rrna 16S rrna PCR 1 500 bp 1 1 506 bp DNA NCBI Blast ZH1 7 V. vulnificus 96% 16S rrna Neighbor Joining ZH1 2 M DNA Marker DL 2000 1 ZH1 16S rrna 2. 4 Lane M DNA Marker Lane 1 16S rrna amplified product of ZH1 strain. 29 1 16S rrna PCR 19 Fig. 1 Amplification of 16S rrna gene of the isolated strain 5 5 2 3 ZH1 ATB ID 99. 9% T 2 16S rrna Fig. 2 Phylogenetic tree based on 16S rrna sequence of ZH1 0. 98 16S rrna > 96. 0% Antibiotics Tab. 2 2 29 Antibiotic sensitivities of the isolated strain /mm / μg 1 Antibacterial circle Sensitivity Antibiotics Contents diameter /mm / μg 1 Antibacterial circle Sensitivity Contents diameter Erythromycin 15 25 S Baytril 5 29 S Ceftriaxone 30 31 S Amoxicillin 10 0 R Minocycline 30 22 S Nalidixic acid 30 29 S Acetylspiramycin 30 14 I Ampicillin 10 0 R Norfloxacin 10 28 S Spectinomycin 100 26 S Cefaclor 30 20 S Tetracycline 30 19 I Oxacillin 1 0 S Lomenfloxacin 10 34 S Penicillin 1 13 R Streptomycin 10 22 S Cefazolin 30 29 S Amikacin 30 15 I Cefobis 75 26 S Necmycin 30 15 R Ofloxacin 5 30 S Tobramycin 10 17 S Cefalothin 30 17 I Gentamicin 10 17 S Midecamycin 30 16 I Enoxacin 10 30 S Roxithromycin 15 21 S Fleroxacin 5 30 S Cefalexin 30 13 R R I S R denotes low or no sensitivity I denotes moderate sensitivity S denotes high sensitivity.

5 969 16S rrna ZH1 21 26 30 34 25 18 ~ 20 21 23 10 UN BC 35 8 2 36 1. J. 2009 33 5 823831. 2 Wright A C Hill R T Johnson J A et al. Distribution of Vibrio vulnificus in the Chesapeake Bay J. Appl Environ Microbiol 1996 62 2 717724. 3 Chung P H Chusng S K Tsang T et al. Cutaneous injury and Vibrio vulnificus infection J. Emerg Infect Dis 2006 12 8 13021303. 4 Fredy P Roland M D Leg Gangrene et al. Endotoxin shock due to Vibrio parahaemolyticus An infection acquired in New England coastal waters J. N Engl J Med 1970 282 23 1306. 5 Hollis D G Weaver R E Baker C N et al. Halophilic Vibrio species isolated from blood cultures J. J Clin Microbiol 1976 3 4 425431. 6 Farmer J J. Vibrio Beneckea vulnificus the bacterium associated with sepsis septicaemia and the sea J. Lancet 1979 314 8148 903. 7 Amaro C Bosca E G. Vibrio vulnificus biotype 2 pathogenic for eels is also an opportunistic pathogen for humans J. Appl Environ Microbiol 1996 62 4 14541457. 8 Hlady W G Klontz K C. The epidemiology of Vibrio infections in Florida 1981 1993 J. J Infect Dis 1996 173 5 11761183. 9 Miyoshi S L Narukawa H Tomochika K I. Actions of Vibrio vulnificus metalloprotease on human plasma proteinase proteinase inhibitor systems a comparative study of native protease with its derivative modified by polyethylene glycol J. Microbiol Immunol 1995 39 12 959966. 10 Inoue H. Vibrio vulnificus infection of the hand J. J Orthop Sci 2006 11 1 8587. 11. J. 2003 22 1 4749. 12 Biosca E G Amaro C Rsreve C et al. First record of Vibrio vulnificus biotype 2 from diseased European eel Anguilla anguilla J. Fish Diseases 1991 14 1 103109. 13 Belen F Carmen A. Isolation of a new serovar of Vibrio vulnificus pathogenic for eels cultured in freshwater farms J. Aquculture 2003 217 1 677682. 14 Muroga K Jo Y Nishibuchi M. Pathogenic Vibrio isolated from cultured eels. 1. Characteristics and taxonomic status J. Fish Pathology 1976 11 10 141145.

970 33 15 Song Y L Cheng W Shen C H et al. Ocurrence of Vibrio vulnificus infection in cultured shrimp and eels in Taiwan J. Nat Sci Counc Synp Ser Taipei 1990 16 1 172179. 16. J. 1994 13 1 8186. 17. J. 2003 23 4 329330. 18 Sharshar K M Azab E A. Studies on diseased freshwater prawn Macrobrachium rosenbergii infected with Vibrio vulnificus J. Pak J Biol Sci 2008 11 17 20922010. 19 Lia G F Zhao D H Huang L et al. Identification and phylogenetic analysis of Vibrio vulnificus isolated from diseased Trachinotus ovatus in cage mariculture J. Aquaculture 2006 26 1 1725. 20. J. 2008 24 10 960964. 21 Sakata T Hattori M. Characteristics of Vibrio vulnificus isolated from diseased tilapia J. Fish Pothol 1988 23 1 3340. 22 Hsieh J C Pan C Y Chen J Y. Tilapia hepcidin TH 2 3 as a transgene in transgenic fish enhances resistance to Vibrio vulnificus infection and causes variations in immune related genes after infection by different bacterial species J. Fish Shellfish Immunol 2010 29 3 430439. 23 Zahid H M Anita C W Shankar C M et al. Genetic characterization of Vibrio vulnificus strains from tilapia aquaculture in Bangladesh J. Appl Environ Microbiol 2010 76 14 48904895. 24 Hsueh R P Lin C Y Tang H J et al. Vibrio vulnificus in Taiwan J. Emerging Infectious Diseases 2004 10 8 13631367. 25 Donald C V Samira M Bunmi F et al. Vibrio vulnificus septicemia after handling Tilapia species fish A Canadian case report and review J. Can J Infect Dis Med Microbiol 2006 17 2 129132. 26 Nudelman A Edelson G Linden A et al. Infection by Vibrio vulnificus after a prick from the spine of a Tilapia J. Harefuah 1997 133 10 444445. 27 Ronit Z Chantal S Larisa L et al. Clinical characteristics and molecular subtyping of Vibrio vulnificus illnesses Israel J. Emerg Infect Dis 2008 14 12 18751882. 28 Torres L Escobar S Lopez A I et al. Wound infection due to Vibrio vulnificus in Spain J. Eur J Clin Microbiol Infect Dis 2002 21 7 537538. 29 Messick J B Berent L M Cooper S K. Development and evaluation of a PCR based assay for detection of Haemobartonella felis in cats and differentiation of H. felis from related bacteria by restriction fragment length polymorphism analysis J. J Clinical Microbiology 1998 36 2 462466. 30. J. 2009 2 5 293296. 31. J. 2007 23 12 12071211. 32. J. 2007 17 10 13121313. 33. J. 2010 10 13 24732475. 34. J. 2005 14 3 242247. 35. J. 2005 5 3 8590. 36 Belen F Elena A Rodolfo B et al. Susceptibility of Nile tilapia Oreochromis niloticus to vibriosis due to Vibrio vulnificus biotype 2 serovar E J. Aquaculture 2002 212 4 2130.