Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Transcript

1 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM ~ cfu/ ml 2. 4 ~ cfu bp cdna Gateway Q785 A Construction of a cdna Library of Pepper for Yeast Two - hybrid Analysis Using Gateway Technology QIU Ai-lian LIU Lin-lin CAI Han-yang ZHU Wan-li HUANG Mu-kun CHEN Xiong HE Shui-lin * ZHANG Jian * College of Life Science Fujian Agriculture and Forestry University Fuzhou China Abstract It s an important prerequisite work to construct a cdna library for isolating a specific cdna u- sing yeast two - hybrid technology. In this study after successfully extracting total RNA and isolating mrna of pepper the authors synthesized three - frame cdnas performed BP reactions to generate corresponding entry libraries and then performed LR reactions to transfer cdna into destination vector of pdest TM 22 directionally and quickly to form a high - quality destination library using Gateway technology. It has been detected that both entry library and destination library in this report have a high titer of 4. 0 ~ cfu /ml and contain a total clones of 2. 4 ~ cfu with an average insert size of about bp it can be suitable for analyzing the interaction protein cdna of the interested destination gene of pepper by two - hybrid system. Key words pepper entry library destination library Gateway yeast two - hybrid J J F E - mail qiual888@ sina. com *

2 cdna RNA mrna Gateway λ BP LR cdna LR cdna Gateway 95% 8 - Gateway 10 Gateway Ohara cdna 2003 Invitrogen Gateway CloneMiner TM cdna Library Construction Kit cdna cdna cdna cdna ProQuest TM ROP WRKY Gateway SA cdna cdna RNA 120 # TRIzol Reagent CloneMiner TM cdna Library Construction Kit LR Clonase Enzyme Mix PureLink TM HiPure Plasmid DNA Midiprep Kit Invitrogen Oligotex TM - dt30 Super mr- NA Purification Kit BsrGⅠ NEB cdna cdna 5 3 attb1 A RFA 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGG CCCCTGTTGAAACATGTTTTTTCAACCp 5 B RFB 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGGA CCCCTGTTGAAACATGTTTTTTCAACCTp 5 C RFC 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAA CCCCTGTTGAAACATGTTTTTTCAACCTTp 5 Invitrogen RNA mrna salicylic acid SA 20 d 20 μmol /L SA 12 h RNA RNA TRIzol 1 g 10 ml TRIzol RNase TRIzol RNA 600 μg RNA Oligotex TM - dt30 Super mrna mrna 10 g /L

3 4 Gateway cdna cdna 3 3 cd- NA 2 μg mrna CloneMiner TM cdna attb1 3 cdna 3 cdna 1-20 cdna μlcdna 9 10 cdna cdna BP cdna /2-20 cdna ml 10 μlbp cdna 100 ng /μl 1 μl pdonr TM ng /μl 1 μl 5 BP ClonaseTM Reaction Buffer 2 μl TE Buffer ph μl 3 μl BP Clonase TM Enzyme mix 2 ~ 5 BP 16 ~ 20 h DH10B 40% S O C 100 μl S O C 100 μl μl 50 μg /ml LB cfu /ml = / ml Total cfu = cfu /ml ml cdna 22 Gateway BsrG I pdonr TM 222 M13 Forward GTAAAACGACGGCCAG - 3 M13 Reverse 5 - CAGGA AACAGCTATGAC -3 PCR /2 cdna 50 ml 50 μg /ml LB 200 r /min 37 6 h OD 1. 0 PureLink TM HiPure DNA cdna TE 2 3 DNA 50 ng DNA pdest TM 22 LR DH10B PCR 22F 5 - TATAACGCGTTTGGAA TCACT R 5 - AGCCGACAACCTTGATTGGAGAC RNA mrna RNA OD 260 /280 = μg /μl 600 μl 10 g /L RNA 28 S 18 S 28 S rrna 18 S rrna 2 5 S rrna RNA 1 Oligotex TM - dt30 Super mrna mrna 0. 5 ~ 12 kb rrna mrna 2 mrna 6 μg cdna 2. 2 cdna cdna cdna /2 1 ~ 2. 5 kb 4 cdna 1

4 A 10 g /L B A 10 g/l agarose gel B Formaldehyde denaturing gel. Fig. 1 1 RNA Electrophoresis of pepper total RNA Fig. 2 2 M DL Marker. mrna Agarose gel electrophoresis of mrna A B 9 A tube B tube 9. M 1 DL Marker M 2 DL2 000 Marker. M 1 DL Marker M 2 DL2 000 Marker. 3 cdna Fig. 4 The pooled cdna of tube 3 - tube 6 Fig. 3 Agarose gel electrophoresis of size fractionated cdna and half of tube /2 7 cdna 3 cdna attb1 attb2 Gateway BP cdna pdonr TM 222 cdna 3 cdna cfu /ml cfu /ml 22 PCR 5 A 100% 0. 5 ~ 3. 0 kb 1. 3 cdna EST cdna 2. 4 LR cdna pdest TM 22 cdna PCR 6 A 100% 0. 5 ~ 3. 0 kb 1. 2 cdna 3 Gateway λ

5 4 Gateway cdna CK pdonr222 A PCR B clones CK pdonr TM 222 A PCR detection B Restriction analysis M DL2 000Marker. Fig. 5 5 A cdna Qualifing the entry cdna library of reading frame A clones M DL Marker. Fig. 6 6 cdna PCR PCR detection of the destination cdna library BP LR BP DNA LR PCR BP cdna LR cdna BP LR PCR mrna 5 cdna N 3 attb 1 cdna 3 cdna cdna plate spotting assay PSA cdna cdna

6 SA SA SA SA 6-7 SA mrna cdna Proquest TM SA SA 1 Desikan R Cheng M K Bright J et al. ABA hydrogen peroxide and nitric oxide signalling in stomatal guard cells J. J Exp Bot Neill S R Desikan R Hancock J Hydrogen peroxide signalling J. Curr Opin Plant Biol Konigshofer H Tromballa H W Loppert H G. Early events in signalling high - temperature stress in tobacco BY2 cells involve alterations in membrane fluidity and enhanced hydrogen peroxide production J. Plant Cell Environ Miller G Suzuki IV Rizhsky L et al. Double mutants deficient in cytosolic and thylakoid ascorbate peroxidase reveal a complex mode of interaction between reactive oxygen species plant development and response to abiotic stresses J. Plant Physiol Boussiba S Rikin A ERichmond A The role of abscisic acid in cross - adaptation of tobacco plants J. Plant Physiol Vasiukova N I Ozeretskovskaia O L. Induced plant resistance and salicylic acid A review J. Prikl Biokhim Mikrobiol Yalpani N Raskin I. Salicylic acid a systemic signal in induced plant disease resistance J. Trends Microbiol Hartley J L Temple G F Brasch M A. DNA cloning using in vitro site - specific recombination J. Genome Res Wu X Webster S R Chen J. Characterization of tumor - associated Chk2 mutations J. J Biol Chem Gomes M D Lecker S H Jagoe R T et al. Atrogin - 1 a muscle - specific F - box protein highly expressed during muscle atrophy J. Proc Natl Acad Sci U S A Ohara O Temple G Directional cdna library construction assisted by the in vitro recombination reaction J. Nucleic Acids Res Ohara O Temple G. Characterization of size - fractionated cdna libraries generated by the in vitro recombination - assisted method J. DNA Res Gateway JH505 cdna J cdna J