2016 8 24 4 ACTA LABORATORIUM ANIMALIS SCIENTIA SINICA August 2016 Vol. 24 No. 4 M4 MT3 1, 1, 1, 1, 2 (1.,201508;2.,201508) M4 MT3 3 : + MT3,A,RT PCR TGF β2 mrna,+ MT3 ( - 1 44 ± 0 50) D (- ), (0 10 ± 0 02)mm (0 14 ± 0 07)mm(P = 0 001,P < 0 001,P < 0 001), ( P < 0 001,P < 0 001,P < 0 001) TGF β2 mrna (P < 0 001,P = 0 014);MT3 TGF β2 mrna (P < 0 001,P < 0 001) MT3, TGF β2 mrna M4 ;MT3;;TGF β2; Q95 33 A 1005 4847(2016)04 0403 05 Doi:10 3969 / j. issn. 1005-4847 2016 04 013 Preliminary study of the inhibitory effect of selective M4 muscarinic receptor antagonist MT3 on form deprivation myopia in guinea pigs LI Tao 1, ZHOU Xiao dong 1, LI Bing 1, LUO Xiu mei 1, GONG Zhe ping 2 (1. Jinshan Hospital of Fudan University; 2. Shanghai City Mengshan Middle School, Shanghai 201508, China) Abstract Objective To evaluate the inhibitory effect of highly selective M4 receptor antagonist MT3 on the form deprivation myopia in guinea pigs and its potential mechanism. Methods Thirty two healthy male guinea pigs were ran domly divided into three groups: control group, form deprivation group, and form deprivation + MT3 group, 8 animals in each group. Refraction was measured by retinoscopy after cycloplegia before and after the experiment. The ocular biological dimensions were measured by A scan ultrasound. RT PCR was used to detect the relative expression of TGF β2 mrna in the retina and choroid. Results Compared with the right eyes of control group, the right eyes of form deprivation + MT3 group developed relative myopia of - 1 44 ± 0 50 D (right left eye) (P = 0 001). The vitreous chamber depth and axial length of the right eyes were significantly prolonged by 0 10 ± 0 02 mm and 0 14 ± 0 07 mm ( P < 0 001, P < 0 001), respectively, but the increases of myopia and axial length were significantly smaller than that of the form deprivation group (P < 0 001, P < 0 001, P < 0 001). Down regulation of relative mrna expression of TGF β2 in retina and choroid was found in the form deprivation group (P < 0 001, P = 0 014) compared with the right eyes of the control group, while up regulation of relative mrna expression of TGF β2 in retina and choroid was found in the form deprivation + MT3 group ( P < 0 001, P < 0 001). Conclusions MT3 can inhibit the development of form deprivation myopia in guinea pigs, which may play an important role by the regulation of TGF β2 mrna level in the retina and choroid. [](13ZR1405800);(2013 121) [](1983 - ),,,: Email: litao13013@ sina. com [](1963 - ),,, Email: xdzhou2005@ 163. com
404 2016 8 24 4 Acta Lab Anim Sci Sin,August 2016,Vol. 24 No. 4 Key words M4 receptor antagonist; MT3; Form deprivation myopia; TGF β2; Gunea pigs Corresponding author: ZHOU Xiao dong. E mail: xdzhou2005@ 163. com,, M4 MT3 [1, 2] [3] TGF β,tgf β2, [4], MT3, TGF β2 MT3 1 1 1 3 32, SCXK ( ) 2012-0008,140 ~ 150 g, 3R SYXK ( ) 2010-0098 4,20 ~ 26,50%,,12 h 12 h; 1 2 24 :1:8,,4 ;2 :8,4, [5] ;3+ MT3 :8,4,2 d 1 MT3 ( 0 1mg /, Peptide Institute ) :25 μl 1 mm 10 μl (10 μmol / L)MT3, [1] 8, TGF β2 mrna 1 3 4 : 1 3 1 (,),5 min 1,4,30 min ( YZ24, ),( ) 1 3 2 Super SW1000 A,A 11 MHz,, A,5, 0 01 mm, 1 4 (3 ) 4 (7 ),,,- 80 1 5 RT PCR TRIzol RNA ( Invitrogen ), RNA,RNA In vitrogen M MLV, RNase free,cdna Genbank,Primer 5 0, TGF β2 : Forward primer:5 TACCGTTACTGTG GCTACTGG 3 ;Reverse primer:5 TAATTTGGACAG GATCTGACCG 3 PCR : 95, 2 min;95,15 s;60, 30 s;45 ;60 CT,2 - ΔΔCT GAPDH,:Forward primer:5 AAAGGCATCTTGGGCTACACCG 3 ; Reverse primer: 5 ATGAGGTCCACCACCCTGTTG 3 1 6 SPSS 11 6, GraphPad Prism 5 ± ( x - ± s), One way ANOVA,Bonferroni ; t P < 0 05 2 2 1 24,3
2016 8 24 4 Acta Lab Anim Sci Sin,August 2016,Vol. 24 No. 4 405 ( P > 0 05) 4,3 1, ( - 5 44 ± 1 05) D ( - ),(0 45 ± 0 02) mm (0 38 ± 0 04) mm(p < 0 001,P < 0 001,P < 0 001); + MT3 2 2 Groups Control group Form deprivation group + MT3 Form deprivation + MT3 group Tab. 1 Eye ( - 1 44 ± 0 50)D, (0 10 ± 0 02) mm (0 14 ± 0 07) mm (P = 0 001,P < 0 001,P < 0 001), (P < 0 001,P < 0 001,P < 0 001) 4,3 ( P = 0 329,P = 0 088) 1 4 Ocular refraction and biometric dimensions of the right and left eyes in the guinea pigs at the end of 4 week treatment period / D Refraction Axial length / mm / mm Anterior chamber depth / mm Lens thickness / mm Vitreous chamber depth 1 94 ± 0 38 8 29 ± 0 06 1 27 ± 0 06 3 40 ± 0 04 3 42 ± 0 04 1 88 ± 0 34 8 30 ± 0 06 1 27 ± 0 06 3 39 ± 0 04 3 44 ± 0 06-3 00 ± 0 72 8 60 ± 0 03 1 22 ± 0 06 3 35 ± 0 04 3 83 ± 0 05 2 44 ± 0 34 8 22 ± 0 03 1 23 ± 0 04 3 40 ± 0 06 3 38 ± 0 04 0 38 ± 0 35 ab 8 42 ± 0 06 ab 1 24 ± 0 05 3 40 ± 0 06 3 58 ± 0 03 ab 1 81 ± 0 36 8 28 ± 0 08 1 22 ± 0 03 3 38 ± 0 05 3 48 ± 0 04 : a P < 0 05,; b P < 0 05, Note. a P < 0 05, compared with the control group; b P < 0 05, compared with the form deprivation group. TGF β2mrna TGF β2 mrna, 3 TGF β2 mrna, TGF β2 mrna (1 2) 7 TGF β2 mrna 3 ( P < 0 001,P < 0 001) 4,, TGF β2 mrna (P < 0 001,P = 0 014);MT3 TGF β2 mrna (P < 0 001,P < 0 001)(1 2) 3 M4 MT3, MT3,,TGF β2 mrna 1 :a,3 ;b,7 ;c,; d,+ MT3 :3 ; :;#: TGF β2 mrna Note. A: 3 week group; b: 7 week control group; c: Form deprivation group; d: Form deprivation + MT3 group. : Compared with the 3 week group; : Compared with the control group; # : Compared with the form deprivation group. Fig. 1 Relative mrna expression of retinal TGF β2 among different groups.
406 2016 8 24 4 Acta Lab Anim Sci Sin,August 2016,Vol. 24 No. 4 :a,3 ;b,7 ;c,; d,+ MT3 :3 ; :;#: 2 TGF β2 mrna Note. A: 3 week group; b: 7 week control group; c: Form deprivation group; d, Form deprivation + MT3 group. : Compared with the 3 week group; : Compared with the control group; # : Compared with the form deprivation group. Fig. 2 Relative mrna expression of choroidal TGF β2 among the different groups. M [6] [7] [8] M1 / M4 [9], MT3 M4,M4 M1 102 [10],, M ( M3 ) McBrien [1] MT3 10 μmol / L MT3, 2 5 μmol / L,250 nmol / L MT3,MT3, Nickla [2] MT3, Arumugam [3] MT3 McBrien [1], 10 μm MT3,MT3 74% MT3 MT3 TGF β2,,tgf β2 Honda [11] TGF β2 mrna [12] TGF β2,seko [13] Kusakari [14], TGF β2, TGF β2 mrna [15], TGF β2 mrna [16] 3 TGF β2,,tgf β2 mrna TGF β2 mrna,honda [11] [12] TGF β2 (PAI 1),( PA) PA ( ECM), ( MMP),ECM,TGF β2,pai 1,PA, MMP, ECM, [17] MT3 TGF β2 mrna, MT3 TGF β2,,,,, MT3, TGF β2 mrna,,,tgf β2,,m4 MT3, TGF β2 mrna [ 1 ] McBrien NA, Arumugam B, Gentle A, et al. The M4 muscarinic antagonist MT 3 inhibits myopia in chick: evidence for site of ac tion [J]. Ophthal Physiol Opt, 2011, 31(5): 529-539. [ 2 ] Nickla DL, Yusupova Y, Totonelly K. The muscarinic antagonist
2016 8 24 4 Acta Lab Anim Sci Sin,August 2016,Vol. 24 No. 4 407 MT3 distinguishes between form deprivation and negative lens induced myopia in chicks [ J]. Curr Eye Res, 2015,40 (9 ): 962-967. [ 3 ] Arumugam B, Mcbrien NA. Muscarinic antagonist control of my opia: evidence for M4 and M1 receptor based pathways in the in hibition of experimentally induced axial myopia in the tree shrew [J]. Invest Ophthalmol Vis Sci, 2012, 53(9): 5827-5837. [ 4 ] McBrien NA. Regulation of scleral metabolism in myopia and the role of transforming growth factor beta [ J]. Exp Eye Res, 2013, 114: 128-140. [ 5 ],,,. [ J]., 2012, 20 (06): 51-56. [ 6 ] Diether S, Schaeffel F, Lambrou GN, et al. Effects of intravit really and intraperitoneally injected atropine on two types of ex perimental myopia in chicken [J]. Exp Eye Res, 2007, 84(2): 266-274. [ 7 ],,,. [J]., 2011, 19(4): 297-300. [ 8 ] Li T, Zhou XD, Chen Z, et al. Effects of cyclopentolate on form deprivation myopia in guinea pigs [ J]. Open J Ophthalmol, 2015, 5:10-18. [ 9 ] Cottriall CL, Mcbrien NA, Annies R, et al. Prevention of form deprivation myopia with pirenzepine: a study of drug delivery and distribution [ J]. Ophthal Physiol Opt, 1999, 19 (4): 327-335. [10] Liang JS, Carsi Gabrenas J, Krajewski JL, et al. Anti muscarin ic toxins from Dendroaspis angusticeps [ J]. Toxicon, 1996, 34 (11-12): 1257-1267. [11] Honda S, Fujii S, Sekiya Y, et al. Retinal control on the axial length mediated by transforming growth factor beta in chick eye [J]. Invest Ophthalmol Vis Sci, 1996, 37(12): 2519-2526. [12],,. TGF β2 [ J]., 2014, 14 (11): 1950-1952. [13] Seko Y, Shimokawa H, Tokoro T. Expression of bfgf and TGF beta 2 in experimental myopia in chicks [ J]. Invest Ophthalmol Vis Sci, 1995, 36(6): 1183-1187. [14] Kusakari T, Sato T, Tokoro T. Visual deprivation stimulates the exchange of the fibrous sclera into the cartilaginous sclera in chicks [J]. Exp Eye Res, 2001, 73(4): 533-546. [15] Jobling AI, Wan R, Gentle A, et al. Retinal and choroidal TGF beta in the tree shrew model of myopia: isoform expression, acti vation and effects on function [J]. Exp Eye Res, 2009, 88(3): 458-466. [16] Jobling AI, Nguyen M, Gentle A, et al. Isoform specific changes in scleral transforming growth factor beta expression and the regu lation of collagen synthesis during myopia progression [ J]. J Biol Chem, 2004, 279(18): 18121-18126. [17],,. β2 [ J]., 2007, 25 (3 ): 168-170. [] 2015 12 09