Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro

32 2 Vol 32 No 2 2013 6 Journal of South-Central University for NationalitiesNat Sci Edition Jun 2013 1 1 1 1 1 2* 1 4300742 430074 CGA MC3T3-E1 MTT 11 02 22 05 44 0988 19μmol /L CGA ALP PCR 11 02 ~ 88 19μmol /L CGA 2 d 44 09 μmol /L CGA ALP 22 0544 09 μmol /L CGA ALP Runx2 Osterix c-jun c-fos 6 d 44 09 μmol /L CGA c-fos I Col-I CGA Q813 1Q786 A 1672-4321201302-0046-05 Effects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro Wang Chaoyuan 1 Yi Jiling 1 Song Chao 1 Wei Tiantian 1 Tang Junlong 1 Yang Guangzhong 2* 1 College of Life ScienceSouth-central University for NationalitiesWuhan 430074China 2 College of PharmacySouth-central University for NationalitiesWuhan 430074China Abstract To investigate the effect of chlorogenic acid CGA one of the components of Sambucus chinensison the osteogenic activity of cultured osteoblastsosteoblasts were treated with 11 02 22 0544 0988 19 μmol /L CGA respectively MTT assayalkaline phosphatealpkitreal-time PCR were used to measure the proliferation ratealp activity and expression of bone-related genes in osteoblasts The results showed that 11 02 ~ 88 19 μmol /L CGA could promote the proliferation rate remarkably The activity of ALP in osteoblasts was up-regulated when treated with 44 09μmol / L CGA for 2 d The expression of bone-related genes such as ALP Runx2 Osterix c-jun and c-fos could be enhanced when treated with 22 05 44 09 μmol /L CGA for 2 d The expression of c-fos could be promoted when treated with 44 09 μmol /L CGA for 6 days In the whole process the expression of Col-I was increased in a time-dependent and concentration-dependent manner ThereforeCGA showed osteogenic activity which demonstrated that it was one of the osteogenic active ingredients of Sambucus chinensis Keywords chlorogenic acidosteoblastsalp activitybone differentiation related genes Sambucus chinensis 2012-11-26 * 1968- E-mailyanggz888 @ 126 com 1964- E-mailwangchaoyuan@ mail scuec edu cn 2009CDZ033 3 chlorogenic acid CGA 4 5 CGA 1 2

2 47 6-8 37 3 ~ 4d 1 MC3T3-E1 CGA 90% 0 25% ALP 1 2 1 4 CGA 1 1 1 CGASIGMA-ALDRICH α-mem CO 2 4 h Thermo 150 μl DMSO 37 0 25% Thermo 10 min Thermo DMSO Amresco 0231 MTT Amerro 1 5 CGA BCA MC3T3-E1 10 5 / Thermo SYBR Green 24 37 5% CO 2 TOYOBO Corning 96 24 6 Corning CO 2 3 2 4 6 d HF90 /240 ALP BCA Motic AE21 ALP MULTISKAN ASCENT 354 thermo PCR 1 6 CGA Biometra JS-380A PCR ABI 7500 fast 1 2 CGA 0 05g CGA 50 ml α-mem 3 1 3 MC3T3-E1 MC3T3-E1 10% α-mem MC3T3-E1 5 10 3 / 96 37 5% CO 2 CGA 5 0 13 d 20 μl MTT 37 5% 492nm OD 22 0544 09 μmol /L MC3T3-E1 2 10 5 / 6 37 5% CO 2 1 mg /ml 246 d Trizol 10% α-mem CGA RNA cdna real-time 11 0222 0544 0988 19μmol /L PCR 95 15s60 15s72 45s40 Tab 1 1 GAPDH 3 2 ΔΔCt 9 PCR 1 PCR Primer sequences of real-time PCR 5'-3' 5'-3' 3- GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA c-fos CCAGTCAAGAGCATCAGCAA AAGTAGTGCAGCCCGGAGTA c-jun TCCCCTATCGACATGGAGTC TGAGTTGGCACCCACTGTTA Runx2 TCACTACCAGCCACCGAGAC ACGCCATAGTCCCTCCTTTT Osterix ATGGCGTCCTCTCTGCTTGAG AGGACTGCCTGCAGGAGAGAG ALP GCTGATCATTCCCACGTTTT CTGGGCCTGGTAGTTGTTGT I Col-I ACGTCCTGGTGAAGTTGGTC CAGGGAAGCCTCTTTCTCCT 1 7 F = 2 Ct- Ct- Ct- Ct one-way ANOVA

48 32 2 2 1 CGA P < 0 05 6d 22 05 μmol /L CGA CGA c-fos P < 0 01 1 1 CGA 11 02 ~ 88 19μmol /L 22 05 44 09 μmol /L 3 2d 2 CGA c-fos P < 0 01 4d 44 09 μmol /L CGA c-fos 1control2 ~5 11 02 22 05 44 09 88 19μmol /L CGA 1 Fig 1 ** P < 0 01 n = 3 CGA Effect of different concentrations of CGA on the proliferation of osteolasts 2 2 CGA ALP CGA ALP 2 c-jun P < 0 01 4 2 2 d 44 09 μmol /L CGA ~ 6 d P < 0 01 CGA MC3T3-E1ALP P < 0 01 c-jun 4 d CGA MC3T3-E1ALP P > 0 05 6d 22 05 44 09 μmol /L CGA ALP P < 0 05 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 3 * P < 0 05 ** P < 0 01 n = 3 3 CGA c-fos Effect of CGA on c-fos expression of osteoblasts CGA c-jun 4 4 22 05 μmol /L CGA 2 ~ 4 d c-jun P > 0 05 6 d P < 0 05 44 09 μmol /L CGA 2 d 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 2 * P < 0 05 ** P < 0 01 n = 3 2 Effect of chlorogenic acid on ALP activity of osteoblasts 1control222 05 μmol /L CGA344 09 μmol /L CGA * P < 0 05 ** P < 0 01 n = 3 Runx2 P < 0 01 2 3 CGA mrna P < 0 01 P > 0 01 CGA c-fos mrna 3 Fig 4 4 CGA c-jun Effect of CGA on c-jun expression of osteoblasts CGA Runx2 5 5 22 05 μmol /L CGA 2 ~ 4d Runx2 P < 0 016 d P < 0 01 44 09 μmol /L CGA 2d

2 49 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 5 * P < 0 05 ** P < 0 01 n = 3 5 CGA Runx2 Effect of CGA on Runx2 expression of osteoblasts 6 CGA osterix CGA 2 d Osterix P < 0 01 4 ~ 6 d CGA osterix P < 0 01 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 7 * P < 0 05**P < 0 01 n = 3 7 CGA ALP Effect of CGA on the ALP expression of osteoblasts 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 6 * P < 0 05 ** P < 0 01 n = 3 6 CGA Osterix Effect of CGA on Osterix expression of osteoblasts CGA 7 CGA ALP 11 02 ~ 88 19 μmol /L CGA osterix 2 d 2 CGA ALP P < 22 0544 09 μmol /L CGA 2 0 05 4 ~ 6 d 2 CGA ALP CGA P < 0 05 ALP 8 CGA Col-I CGA Osterix ALP 11 CGA ALP CGA Col-I 2 ~ 6 d 22 05 μmol /L μmol /L CGA ALP CGA Col-I P < 44 09 μmol /L CGA ALP 0 01 44 09 μmol /L CGA Col-I CGA ALP P < 0 05 P < 0 01 1control222 05 μmol /L CGA344 09 μmol /L CGA Fig 8 * P < 0 05 ** P < 0 01 n = 3 8 3 CGA Col-I Effect of CGA on Col-I expression of osteoblasts MC3T3-E1 C57BL /6 I 10 MC3T3-E1 2 ~ 6 d 22 05 CGA ALP mrna

50 32 Runx2 J 2009 37 14 Runx2 6461-6462 12 4 J 2011 428 1502-1504 Osterix 5 Osterix J 2001214 27-32 Runx2 6Hai-Tao Lu Application of preparative high-speed countercounter chromatography for separation of chlorogenic acid Osterix from Flos Loncease J J Chromatogr A200410261/ I 13 CGA Runx2 Osterix 2185-190 7 Runx2 Osterix mrna J 2011 1719 199-202 CGA 8 J 2011224 961-963 9Livak K JSchmittgen T D Analysis of relative gene expression data using real-time quantitative PCR and the CGA Col-I 2 -ΔΔT method J Methods 2001 254 402-408 I 10 Sudo HKodama HAmagai Yet al In vitro 14 differentiation and calcification in a new clone 2 d 22 05μmol /LCGA osteogenic cell line derived from newborn mouse Col-I P < 0 054 calvaria J J Cell Biol 1983961 191-198 ~ 6 d CGA Col-I 11Effenberger K E Johnsen S A Monroe D Get al CGA Regulation of osteoblastic phenotype and gene expression by hop-derived phytoestrogensj J Steroid Biochem Mol Biol 2005965 387-399 c-fos c-jun 12 Ducy PStarbuck MPriemel Met a1 A Cbfaldependent genetic pathway controls bone formation -1AP-1 beyond embryonic development J Genes Dev 15 c-jun 1999 138 1025-1036 I 13Ohyama YNifuji AMaeda Yet al Spacioternporal 16 c-jun association and bone morphogenetic protein regulation of CGA c-fos c-jun sclerostin and osterix expression during embryonic osteogenesis J Endocrinology2004145 10 CGA 4685-4692 CGA 14Raisz L G Fall P M Gabbitas B Y et al Effects of prostaglandine2 on bone formation in cultured fetal rat ALP CGA calvariae roleofinsulin-like growth factor-i J I Endocrinology 1993 1334 1504-1510 CGA 15 c-fos J 2004 211 8-11 1 J 2010286 62-65 16 Palcy SBolivar IGoltzman D Role of activator protein 1 transcriptional activity in the regulation of 2 J osteoblast-like cells J J Bone Miner Res200015 2009321 74-75 12 2352-2361 3 gene expression by transforming growth factor beta1 and bone morphogenetic protein 2 in ROS17 /2 8