Capillary Gel Electrophoresis for Ligase Detection Reaction Products

Σχετικά έγγραφα
Identification of Fish Species using DNA Method

30s 56 60s 72 60s dntp cm s s s 23

Methodology Research on Loss of Heterozygosity of APC Gene Detection Exon 11 of Gastric Cancer by Capillary Electrophoresis

Separation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Real-Time PCR Mycoplasma pneumoniae

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Electronic Supplementary Information

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

College of Life Science, Dalian Nationalities University, Dalian , PR China.

TABLE OF CONTENTS Page

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

J. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.

Analysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis

Τεχνικές παρασκευής ζεόλιθου ZSM-5 από τέφρα φλοιού ρυζιού με χρήση φούρνου μικροκυμάτων και τεχνικής sol-gel

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

, DYY-8B, ; : Centrifuge 11 R. min

Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Hydroxyapatite chromatography of guanidine denatured proteins 1. Guanidine containing phosphate buffer system

ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

EΘΝΙΚΟN ΚΑΙ ΚΑΠΟΔΙΣΤΡΙΑΚΟN ΠΑΝΕΠΙΣΤΗΜΙΟN ΑΘΗΝΩΝ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΚΟΝΔΥΛΙΩΝ ΕΡΕΥΝΑΣ ΓΡΑΜΜΑΤΕΙΑ ΕΠΙΤΡΟΠΗΣ ΕΡΕΥΝΩΝ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ

(bpy) 2 + , ECL, (polarization fluoroimmunometry) [8 ],HPLC [9 ] (CZE) [10 ] 2. 1 Ru(bpy) 3 Cl 2 6H 2 O Aldrich, ;

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Analysis of hydrophilic components in water. extract from Polygonum multiflorum using. micellar electrokinetic chromatography

Οδηγίες χρήσης Elucigene TRP

Supporting Information

) ; GSP ) ;PXD g, 100 ml

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Supplementary Information

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Potentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph

Genetic study of 46 Greek grape cultivars by random amplified polymorphic DNA markers (RAPD- PCR). K. Biniari and M.N.Stavrakakis

Conductivity Logging for Thermal Spring Well

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

SUPPORTING INFORMATION

MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:

Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer

Supporting Information

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

Detection and Recognition of Traffic Signal Using Machine Learning

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

2. Chemical Thermodynamics and Energetics - I

. (Coventor Ware, Version 2003, Coventor, Inc. )

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

Study of In-vehicle Sound Field Creation by Simultaneous Equation Method

Supporting Information

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

High order interpolation function for surface contact problem

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

ΦΙΛΙΚΗ ΠΡΟΣ ΤΟ ΠΕΡΙΒΑΛΛΟΝ ΧΗΜΙΚΗ ΑΝΑΚΥΚΛΩΣΗ ΦΙΑΛΩΝ ΑΠΟ ΡΕΤ ΜΕ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

svari Real-time RT-PCR RSV

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

ΜΕΛΕΤΗ ΤΗΣ ΠΛΑΣΤΙΚΟΤΗΤΑΣ ΑΡΓΙΛΟΥΧΩΝ ΜΙΓΜΑΤΩΝ ΜΕ ΠΡΟΣΘΗΚΗ ΣΙΔΗΡΑΛΟΥΜΙΝΑΣ ΑΠΟ ΤΗ ΔΙΕΡΓΑΣΙΑ BAYER

Electronic Supplementary Information

A/A Είδος Προδιαγραφές

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

difluoroboranyls derived from amides carrying donor group Supporting Information

Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014

Copper(II) complexes of salicylaldehydes and 2 hydroxyphenones: Synthesis, Structure,

Preparation of Hydroxyapatite Coatings on Enamel by Electrochemical Technique

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

MOTROL. COMMISSION OF MOTORIZATION AND ENERGETICS IN AGRICULTURE 2014, Vol. 16, No. 5,

Application of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy

Synthesis of α-deoxymono and -Difluorohexopyranosyl. 1-Phosphates and Kinetic Evaluation with Thymidylyl- and. Guanidylyltransferases

Food Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR

Research on Economics and Management

Supporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid

CdSe Hg? CdTe. Cu 2 + CdTe DNA. CdS / CdS /DNA NPs 10. CdSe /D-Pen /L-Cys Eeinburgh AFS-230E. D % Avocado Research Chemicals L- 98%

Transcript:

THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko TSUKAGOSHI*** (Received October 7, 2009) One technique that can distinguish low-abundant mutant DNA from wild-type DNA is the ligase detection reaction (LDR) coupled to a primary polymerase chain reaction (PCR). The LDR products obtained by the PCR/LDR assay can be analyzed in a variety of fashions such as microarray and slab gel electrophoresis. In the present work, we applied capillary gel electrophoresis (CGE) with fluorescence detection (FL) (CGE-FL) for analyzing the LDR products. Polyethylene oxide (PEO) polymer solution containing SYBR Gold, which could bind to a single strand DNA, was used as a separation matrix in the CGE-FL system. The LDR products could successfully be separated from other DNA fragments such as LDR primers and template, enabling the determination of the single base substitutions on codon 12 of K-ras gene. : capillary gel electrophoresis, polymer solution, point mutation, ligase detection reaction : * Department of Chemical Engineering and Materials Science, Doshisha University, Kyoto Telephone:+81-774-65-6594, Fax:+81-774-65-6803, E-mail: mahashim@mail.doshisha.ac.jp ** Former graduate student of Doshisha University *** Department of Chemical Engineering and Materials Science, Doshisha University, Kyoto Telephone:+81-774-65-6595, Fax:+81-774-65-6803, E-mail: ktsukago@mail.doshisha.ac.jp 6

165 Fig. 1. Conceptual schematic of the PCR/LDR assay. CGE PCR/LDR Fig. 1 PCR DNA PCR PCR DNA LDR LDR 3 (A, G, T, C) 4 5 3 LDR DNA DNA LDR DNA 1 DNA LDR T m LDR DNA 3 3 5 DNA 3 (LDR ) LDR DNA LDR LDR LDR LDR LDR LDR CGE (FL) 7

166 Table 1. Sequences of oligonucleotide used in the PCR/LDR assays Primer Sequences (5 3 ) Size (mer) K-ras forward TTAAAAGGTACTGGTGGAGTATTTGATA 28 K-ras reverse AAAATGGTCAGAGAAACCTTTATCTGT 27 K-ras Com-2 ptggcgtaggcaagagtgcct-fluorescein 20 K-ras c12.2 WtG AAACTTGTGGTAGTTGGAGCTGG 23 K-ras c12.2v AAACTTGTGGTAGTTGGAGCTGT 23 K-ras c12.2d AAACTTGTGGTAGTTGGAGCTGA 23 K-ras c12.2a AAACTTGTGGTAGTTGGAGCTGC 23 (CMC) ( ) (Tris) (EDTA) 10x Tris- -EDTA Bio-Rad Laboratories Taq DNA dntp mix (wild-type) DNA (G12G; GGT) Promega Taq DNA New England BioLabs SYBR Gold Invitrogen (PEO; M r 8,000,000) (PVP; M r 130,000) Sigma-Aldrich PCR LDR DNA (Table 1) Invitrogen Sigma Genosys nuclease-free water (Promega) CE (MILLIPORE, Elix 3 UV) RO K-ras 1 12.2 (G12V; GTT) (SW480) Gene Tex Wizard SV Genomic DNA Purification System (Promega) 200 μl PCR 1.5 mm MgCl 2 1x PCR 200 μm dntps 500 nm K-ras forward reverse (Table 1) 4.2 ng/ L DNA Master cycler (Eppendorf) PCR 95 2 min 2.5 U DNA ( 50 μl) 95 30 s 60 1 min 72 1 min 30 s 40 2 DNA 72 3 min Fig. 2. Size confirmation for the PCR products derived from (a) wild-type and (b) mutant (SW480). 500 bp PCR product was used as a size standard. Conditions: gel matrix, 0.5%(w/v) PEO in 1xTBE buffer containing 1x SYBR Gold; applied voltage, 12 kv. 8

167 PCR 290 bp PEO CGE (Fig. 2) 200 μl 20 mm Tris-HCl (ph 8.3) 25 mm 10 mm 10 mm DTT 1 mm NAD + 0.1 % Triton X-100 LDR Reaction buffer 30 nm 30 nm (Table 1) PCR 2 U Taq DNA Ligase ( 50 μl) Master cycler 94 2 min 94 30 s 65 2 min 40 LDR 4 3 4 DNA (G12V) 3 (K-ras c12.2v in Table 1) 43-mer LDR 1x TBE (89 mm Tris- -2 mm EDTA (ph 8.3)) 0.5 % (w/v) PEO 25 mm TGE (25 mm Tris- -5 mm EDTA (ph 8.3)) 0.3 % (w/v) CMC CGE 900 rpm 60 min 15 min CE (GL Sciences) (Model HZCE-30PNO.25 Matsuda Precision Devices Co.) FL (RF-550 Shimadzu) (CR-6A Shimadzu) Window Maker TM (Micro Solv) 2 mm 1 M NaOH 10 min 0.2 M NaOH 5 min RO 2 min 2.0 % (w/v) PVP PEO CMC ( 75 μm 150 μm, 70 cm ( 50 cm)) FL FL SW480 (G12V) K-ras 1 12.2 C A 6) 4 (K-ras c12.2wtg, c12.2v, c12.2d, c12.2a) (Table 1) K-ras c12.2v LDR LDR LDR 4 LDR FL CMC CGE LDR Fig. 3(a) 4 LDR 9

168 Fig. 3. Electropherograms of the LDR products without (a) and with 20-fold preconcentration (b). Conditions: gel matrix, 0.3%(w/v) CMC in 25 mm TGE buffer; applied voltage, 12 kv. LDR FL (2 x 10-7 M) LDR 30 % LDR 4 LDR ( 50 μl) 1 ( 200 μl) 10 μl 20 CMC CGE-FL Fig. 3 (b) LDR LDR 2 DNA DNA SYBR Gold 2 1 DNA SYBR Gold CGE 1 DNA 9) 3 SYBR Gold LDR SYBR Gold SYBR Gold LDR DNA ( DNA ) LDR LDR 20 SYBR Gold PEO CGE K-ras c12.2 WtG c12.2v c12.2d c12.2a LDR CGE-FL Fig. 4 (a) (d) Fig. 4 (a) (c) (d) 3 DNA 11 min 13 min (20-mer) (23-mer) 10

169 Fig. 4. Electropherograms of the LDR products obtained using the different discriminating primers of (a) K-ras c12.2wtg, (b) K-ras c12.2v, (c) K-ras c12.2d and (d) K-ras c12.2a. Conditions: gel matrix, 0.5%(w/v) PEO in 1xTBE buffer containing 1x SYBR Gold; applied voltage, 12 kv. Fig. 4(b) Fig. 4(a), (c), (d) LDR K-ras c12.2v G T DNA SYBR Gold CGE LDR DNA PCR/LDR LDR CGE LDR 30 % LDR SYBR Gold LDR CGE SW480 (G12V) K-ras 1 12.2 C A PCR/LDR SYBR Gold CGE-FL DNA 2008 1) M. Hashimoto, F. Barany and S. A. Soper, Polymerase chain reaction/ligase detection reaction/hybridization assays using flow-through microfluidic devices for the detection of low-abundant DNA point mutations, Biosens. Bioelectron., 21, 1915-1923 (2006). 2) N. P. Gerry, N. E. Witowski, J. Day, R. P. Hammer, G. Barany and F. Barany, Universal DNA microarray method for multiplex detection of low abundance point mutations, J. Mol. Bio., 292, 251-262 (1999). 3) M. Khanna, P. Park, M. Zirvi, W. Cao, A. Picon, J. Day, P. Paty and F. Barany, Multiplex PCR/LDR for detection of K-ras mutations in primary colon tumors, Oncogene, 18, 27-38 (1999). 4) K. Li, B. Chen, Y. Zhou, R. Huang, Y. Liang, Q. Wang, Z. Xiao and J. Xiao, Multiplex quantification of 16S rdna of predominant bacteria group within human fecal samples by polymerase chain reaction-ligase detection reaction (PCR-LDR), J Microbiol Methods., 76, 289-294 (2009). 5) D. K. Toubanaki, T. K. Christopoulos, P. C. Ioannou and C. S. Flordellis, Identification of single-nucleotide polymorphisms by the oligonucleotide ligation reaction: 11

170 a DNA biosensor for simultaneous visual detection of both alleles, Anal. Chem., 81, 218-224 (2009). 6) M. Hashimoto, M. L. Hupert, M. C. Murphy and S. A. Soper, Ligase detection reaction/hybridization assays using three-dimensional microfluidic networks for the detection of low-abundant DNA point mutations, Anal. Chem., 77, 3243-3255 (2005). 7) R. Sinville, J. Coyne, R. J. Meagher, Y.-W. Cheng, F. Barany, A. Barron and S. A. Soper, Ligase detection reaction for the analysis of point mutations using free-solution conjugate electrophoresis in a polymer microfluidic device, Electrophoresis, 29, 4751-4760 (2008). 8) P. Yi, Z. Chen, Y. Zhao, J. Guo, H. Hu, Y. Zhou L. Yu and L. Li, PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma, Prenat. Diagn., 29, 217-22 (2009). 9) R. Oba, Y. Kudo, N. Sato, R. Noda and Y. Otsuka, A new method of competitive reverse transcription polymerase chain reaction with SYBR Gold staining for quantitative analysis of mrna, Electrophoresis, 27, 2865-2868 (2008). 12