ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ"

Transcript

1 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. 1. Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffith στο γνωστό πείραμα, είναι: α. μύκητας. β. βακτήριο. γ. ιός. δ. πρωτόζωο. 2. Η ομάδα αίματος του ανθρώπου ελέγχεται από: α. πολλαπλά αλληλόμορφα, όλα ισοεπικρατή. β. δύο αλληλόμορφα με σχέση υποτελούς-επικρατούς. γ. δύο υπολειπόμενα και ένα επικρατές. δ. δύο συνεπικρατή γονίδια και ένα υπολειπόμενο. 3. Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται: α. στον πυρήνα. β. στο κυτταρόπλασμα. γ. στα μιτοχόνδρια. δ. στο κυτταρικό τοίχωμα. 4. Οι περιοριστικές ενδονουκλεάσες: α. είναι απαραίτητες για την έναρξη της μεταγραφής. β. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του RNA σε ειδικές θέσεις. γ. περιορίζουν τη μεταγραφή του DNA. δ. κόβουν το DNA σε ειδικές θέσεις.

2 5. Τα ζώα, που έχουν υποστεί γενετική τροποποίηση λέγονται: α. πολυγενετικά. β. διαγονιδιακά. γ. πολυπλοειδικά. δ. πολυγονικά. ΘΕΜΑ 2 ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Πώς αναστέλλεται η δράση των ογκοκατασταλτικών γονιδίων; Να αναφέρετε ένα χαρακτηριστικό παράδειγμα. 2. Πώς ονομάζεται η αλλαγή που παρουσιάζεται στον καρυότυπο ενός ανθρώπου, όταν εμφανίζεται ένα επιπλέον χρωμόσωμα 21 και πώς προκύπτει αυτό; Μονάδες 8 3. Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων; Μονάδες 7 4. Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα; ΘΕΜΑ 3ο Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη. 1. Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων;

3 2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού, όπως τα νευρικά και τα μυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη μορφή και τη λειτουργία. Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ; Μονάδες 8 3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA, ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών; Μονάδες 12 ΘΕΜΑ 4ο Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήμα. Οι ελικάσες ξετυλίγουν τη διπλή έλικα ιχάλα αντιγραφής B Η DNA-δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (μονάδες 4). Ποιά ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους

4 έχουν; (μονάδες 7). Στην κωδική αλυσίδα Α το γονίδιο, που είναι υπεύθυνο για την παραγωγή ενός πεπτιδίου, έχει την εξής αλληλουχία βάσεων: 5... ATG CCA TGC AAA CCG AAA TGA 3 Να γράψετε την αλληλουχία του mrna που προκύπτει (μονάδες 2). Κάποια αλλαγή που συνέβη στην παραπάνω κωδική αλυσίδα του DNA, έχει ως αποτέλεσμα το 4ο κωδικόνιο στο μεταγραφόμενο mrna να έχει τις βάσεις UAA και ο αριθμός των κωδικονίων να παραμένει σταθερός. Αφού γράψετε το νέο mrna που προκύπτει, να εξηγήσετε ποια είναι η συγκεκριμένη αλλαγή που συνέβη και τι συνέπειες μπορεί να έχει για το πεπτίδιο; (μονάδες 8). Γιατί η πρωτεϊνοσύνθεση στους ευκαρυωτικούς οργανισμούς είναι μια «οικονομική διαδικασία»; (μονάδες 4). Μονάδες 25 ΘΕΜΑ 1 Ο 1. β 2. δ 3. β 4. δ 5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2 Ο 1. Τα ογκοκατασταλτικά γονίδια είναι γονίδια που ελέγχουν την κυτταρική διαίρεση, καταστέλλοντάς την, οπότε είναι απαραίτητο. Η αναστολή της δράσης τους που είναι συνήθως αποτέλεσμα μετάλλαξης, κυρίως έλλειψης γονιδίου, αφαιρεί από το κύτταρο την δυνατότητα ελέγχου του πολλαπλασιασμού και οδηγεί σε καρκινογένεση. Χαρακτηριστικό παράδειγμα αποτελεί ο καρκίνος του αμφιβληστροειδούς (ρετινιβλάστωμα) που είναι αποτέλεσμα έλλειψης ενός ογκοκατασταλτικού γονιδίου. 2. Τα άτομα που έχουν περίσσεια ή έλλειψη μικρού αριθμού

5 χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η ύπαρξη ενός επιπλέον χρωμοσώματος τρισωμία. Η αριθμητική χρωμοσωμική ανωμαλία κατά την οποία εμφανίζεται στον καρυότυπο ενός ανθρώπου ένα επιπλέον χρωμόσωμα ονομάζεται σύνδρομο Down. Η ύπαρξη του επιπλέον χρωμοσώματος είναι αποτέλεσμα μη διαχωρισμού των χρωμοσωμάτων του 21 ου ζεύγους κατά τον σχηματισμό των γαμετών στη μείωση. Με αυτόν τον τρόπο δημιουργείται ωάριο, και σχετικά λιγότερες περιπτώσεις σπερματοζωάριο, με δύο χρωμοσώματα 21. γονιμοποίηση του γαμέτη που έχει το επιπλέον χρωμόσωμα 21 με έναν φυσιολογικό θα δημιουργήσει στο ζυγωτό τρισωμία Η ανάλυση του ανθρώπινου γονιδιώματος θα συμβάλει: - Στη μελέτη της εξέλιξης του ανθρώπινου γονιδιώματος. Για το σκοπό αυτό βρίσκονται παράλληλα στην εξέλιξη πρόγραμμα έως και σε πολλούς μικροοργανισμούς. - Στην μαζική παραγωγή προϊόντων, με τις μεθόδους που χρησιμοποιεί η βιοτεχνολογία, μετά την απομόνωση των γονιδίων, τα οποία είναι χρήσιμα στην φαρμακοβιομηχανία, στη βιομηχανία, στη γεωργία και στην κτηνοτροφία. (σελίδα σχολικού βιβλίου 126). 4. Ο όρος αδελφές χρωματίδες χρησιμοποιείται, για να περιγράψει τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο. Εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης στο στάδιο της μετάφασης. Στο τέλος της μίτωσης προκύπτουν δύο νέα κύτταρα, γενετικά όμοια μεταξύ τους, και με το αρχικό, αφού το καθένα περιέχει τη μία από τις δύο αδελφές χρωματίδες από κάθε χρωμόσωμα. ΘΕΜΑ 3 Ο 1. Στα βακτήρια η ρύθμιση της γονιδιακής έκφρασης αποσκοπεί κυρίως στην προσαρμογή του οργανισμού στις εναλλαγές του περιβάλλοντος, έτσι ώστε να εξασφαλίζονται οι καλύτερες συνθήκες για τη βασική λειτουργία του που είναι η αύξηση και η διαίρεση. 2. Στα αρχικά στάδια της εμβρυογένεσης τα κύτταρα εξιδικεύονται, για να εκτελέσουν επιμέρους λειτουργίες. Η διαδικασία αυτή ονομάζεται κυτταρική διαφοροποίηση. Μολονότι όλα τα κύτταρα έχουν τις ίδιες γενετικές οδηγίες, έχουν αναπτύξει μηχανισμούς που τους επιτρέπουν να εκφράζουν τη γενετική τους πληροφορία επιλεκτικά και να ακολουθούν μόνο τις οδηγίες που χρειάζονται κάθε χρονική στιγμή.

6 3. Τα ρυθμιστικά στοιχεία της μεταγραφής του DNA είναι οι υποκινητές και οι μεταγραφικοί παράγοντες και επιτρέπουν στην RNA πολυμεράση, το ένζυμο που καταλύει την μεταγραφή, να αρχίσει την μεταγραφή του DNA. Η RNA πολυμεράση λειτουργεί με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Στους ευκαρυωτικούς οργανισμούς οι μεταγραφικοί πράγοντες παρουσιάζουν τεράστια ποικιλία. Κάθε κυτταρικός τύπος περιέχει διαφορετικά είδη μεταγραφικών πραραγόντων. Διαφορετικούς συνδυασμούς μεταγραφικών παραγόντων ρυθμίζει τη μεταγραφή κάθε γονιδίου. Μόνο όταν ο σωστός συνδυασμός των μεταγραφικών παραγόντων προσδεθεί στον υποκινητή ενός γονιδίου, αρχίζει η RNA πολυμεράση της μεταγραφή ενός γονιδίου. ΘΕΜΑ 4 Ο A RNA DNA RNA DNA 3 B 5 Οι δύο αλυσίδες του DNA είναι αντιπαράλληλες, δηλαδή το 3 άκρο της μίας είναι απέναντι από το 5 άκρο της άλλης. Η αντιγραφή γίνεται με προσανατολισμό 5 προς 3. Κάθε νεοσυνθετόμενη αλυσίδα θα έχει προσανατολισμό 5 3. Σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Η σύνθεση των νέων αλυσίδων του DNA είναι συνεχής στην αλυσίδα Α και ασυνεχής στην αλυσίδα Β. Τα κύρια ένζυμα, που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Ένα ειδικό σύμπλοκο το πριμόσωμα, που αποτελείται από πολλά ένζυμα, συνθέτει στις θέσεις έναρξης αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες τα οποία ονομάζονται πρωταρχικά τμήματα. Οι πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά νουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA. Οι DNA πολυμεράσες επίσης επιδιορθώνουν λάθη που συμβαίνουν κατά

7 την διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να «βλέπουν» και να απομακρύνουν νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA. Η κωδική αλυσίδα Α είναι συμπληρωματική και αντιπαράλληλη με την μη κωδική αλυσίδα Β που μεταγράφεται. Το m-rna που προκύπτει θα είναι συμπληρωματικό και αντιπαράλληλο με την μη κωδική αλυσίδα Β. Άρα θα έχει τον ίδιο προσανατολισμό και την ίδια αλληλουχία βάσεων με την κωδική αλυσίδα Α του DNA μόνο που στη θέση της Τ θα έχει U. Άρα η αλληλουχία του m-rna που προκύπτει θα είναι: 5 AUGCCAUGCAAACCGAAAUGA... 3 Το νέο m-rna που προκύπτει είναι: 5 AUGCCAUGCUAACCGAAAUGA 3 Η αλλαγή που συνέβη είναι αποτέλεσμα γονιδιακής μετάλλαξης και συγκεκριμένα αντικατάσταση βάσης στο τέταρτο κωδικόνιο του γονιδίου. Η Α του τέταρτου κωδικονίου στη κωδική αλυσίδα Α του DNA αντικαταστάθηκε από τη βάση Τ (αντίστοιχη αλλαγή συνέβη και στην μη κωδική αλυσίδα του DNA όπου η T αντικαταστάθηκε από Α) με αποτέλεσμα να δημιουργηθεί ένα καινούργιο κωδικόνιο. Το νέο κωδικόνιο που σχηματίστηκε το ΤΑΑ αντιστοιχεί σε ένα από τα τρία κωδικόνια λήξης, με αποτέλεσμα τον τερματισμό σύνθεσης της πολυπεπτιδικής αλυσίδας, που παράγεται. Στην συγκεκριμένη περίπτωση το πεπτίδιο που παράγεται από το m-rna θα αποτελείται από 3 αμινοξέα αντί των 6 αμινοξέων που αποτελούσαν το φυσιολογικό πεπτίδιο. Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα m-rna, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφραστεί τα πρώτα κωδικόνια, η θέση έναρξης του m-rna είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το m-rna ονομάζεται πολύσωμα. Έτσι, η πρωτεϊνοσύνθεση είναι μια «οικονομική διαδικασία». Ένα κύτταρο μπορεί να παράγει μεγάλα ποσά μιας πρωτεΐνης από ένα ή δύο αντίγραφα ενός γονιδίου.

8 Τα θέματα επιμελήθηκαν τα φροντιστήρια «ΟΜΟΚΕΝΤΡΟ» Φλωρόπουλου. Γκιγκέλου Φ. Χατζηγιαννάκη Α.

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 27/5/2016

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 27/5/2016 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 27/5/2016 ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 1 Α 2 Γ 3Α 4 Β 5 Α 6 Α 7 Γ Β2 Κάθε φυσιολογικό μεταφασικά χρωμόσωμα αποτελείται από δύο αδελφές χρωματίδες, οι οποίες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ Α Α. 1 Β. 4 Γ. 3 Δ. 2 Ε. 1 ΘΕΜΑ Β Β1. Οι λόγοι που μπορεί να

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Α1=β,

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 16 ΣΕΠΤΕΜΒΡΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα