Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας"


1 Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας

2 Αντιγραφή του DNA Οι Watson & Crick το 1953 μαζί με το μοντέλο της διπλής έλικας, πρότειναν και έναν τρόπο με τον οποίο το DNA μπορεί να αντιγράφει τον εαυτό του. Η κεντρική ιδέα είναι ότι η διπλή έλικα ξετυλίγεται και κάθε αλυσίδα λειτουργεί σαν καλούπι για τη δημιουργία μίας νέας συμπληρωματικής αλυσίδας. Έτσι τα δύο θυγατρικά μόρια είναι πανομοιότυπα με το μητρικό και καθένα αποτελείται από μία παλιά και μία καινούργια αλυσίδα. Ο μηχανισμός αυτός ονομάστηκε ημισυντηρητικός.

3 Αντιγραφή του DNA Αν και παρουσιάζεται σχετικά απλή, η διαδικασία είναι πολύπλοκη. Η αντιγραφή μελετήθηκε στο βακτήριο Escherichia coli γιατί το DNA είναι μικρότερο και απλούστερα οργανωμένο. Παρ όλα αυτά τα βασικά στάδια του μηχανισμού είναι τα ίδια σε προκαρυώτες και ευκαρυώτες. Η αντιγραφή ξεκινάει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Στο βακτηριακό DNA εμφανίζεται μία (1) θέση αντιγραφής και αντιγράφεται σε λιγότερο από 30 λεπτά όταν οι συνθήκες είναι ευνοϊκές. Στο ευκαρυωτικό DNA εμφανίζονται περισσότερες θέσεις λόγω μεγαλύτερου μεγέθους. Με αυτό τον τρόπο, αν και φορές μεγαλύτερο από των προκαρυωτών, το γενετικό υλικό αντιγράφεται πολύ γρήγορα.

4 Αντιγραφή του DNA Βήμα 1 ο Για να ανοίξει η διπλή έλικα, πρέπει να σπάσουν οι δεσμοί υδρογόνου που αναπτύσσονται ανάμεσα στις συμπληρωματικές βάσεις. Υπεύθυνα για αυτή τη δουλειά είναι τα ένζυμα που ονομάζονται DNA ελικάσες (1 ο ένζυμο). Όταν ανοίξει η έλικα δημιουργείται μία «θηλιά», η οποία αυξάνεται και προς τις δύο κατευθύνσεις. Οι θηλιές είναι ορατές με το ηλεκτρονικό μικροσκόπιο.

5 Αντιγραφή του DNA Βήμα 2 ο Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή όμως δεν έχουν την ικανότητα να ξεκινήσουν την αντιγραφή, υπάρχει ένα άλλο ειδικό σύμπλοκο από πολλά ένζυμα που ονομάζεται πριμόσωμα(2 ο ένζυμο). Ο ρόλος του πριμοσώματος είναι να συνθέσει στη θέση έναρξης της αντιγραφής, μικρά τμήματα RNA, συμπληρωματικά ως προς την μητρική αλυσίδα, τα οποία ονομάζονται πρωταρχικά τμήματα. Οι DNA πολυμεράσες (3 ο ένζυμο): i. επιμηκύνουν αυτά τα πρωταρχικά τμήματα (δηλαδή προσθέτουν δεσοξυριβονουκλεοτίδια) δημιουργώντας τη θυγατρική αλυσίδα. ii. ταυτόχρονα ελέγχουν και για την πιθανή ύπαρξη λαθών κατά την αντιγραφή (νουκλεοτίδια που τοποθετήθηκαν κατά παράβαση του κανόνα της συμπληρωματικότητας. iii. απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA

6 Αντιγραφή του DNA Βήμα 3 ο Οι DNA πολυμεράσες λειτουργούν μόνο προς μία κατεύθυνση. Μπορούν να τοποθετήσουν νουκλεοτίδια μόνο στο 3 ελεύθερο άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου. Για αυτό η αντιγραφή έχει προσανατολισμό 5 3. Ετσι σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες είναι αντιπαράλληλες. Για να συμβεί αυτό όμως, η σύνθεση του DNA στη μία αλυσίδα είναι συνεχής και στην άλλη ασυνεχής. Τα τμήματα της ασυνεχούς αλυσίδας ενώνονται με τη βοήθεια ενός ενζύμουπουονομάζεται DNA δεσμάση (4 ο ένζυμο).

7 Αντιγραφή του DNA Βήμα 4 ο Το τελικό στάδιο απαιτεί τον έλεγχο του τελικού προϊόντος (δύο νέες αλυσίδες) Ένας πρώτος έλεγχος γίνεται από τις DNA πολυμεράσες την ώρα που δημιουργούν τα νέα τμήματα. Ό,τι ξεφεύγει ελέγχεται στην πορεία και επιδιορθώνεται με τη χρήση ειδικών επιδιορθωτικώνενζύμων (5 ο ένζυμο). Η μεγάλη ακρίβεια του μηχανισμού επιτρέπει την ύπαρξη ενός λάθους νουκλεοτιδίου ανά Στους ευκαρυωτικούς τα λάθη περιορίζονται στο 1/10 10.

8 Έκφραση της γενετικής πληροφορίας Η γενετική πληροφορία βρίσκεται αποθηκευμένη στο γενετικό υλικό και περιέχει τις πληροφορίες για τη δομή και τη λειτουργία του οργανισμού. Ταυτόχρονα περιέχει και την πληροφορία για τον αυτοδιπλασιασμό της, εξασφαλίζοντας τη μεταβίβασή της από κύτταρο σε κύτταρο και κατ επέκταση από έναν οργανισμό στους απογόνους της. Το πρώτο βήμα για την έκφραση της γενετικής πληροφορίας που υπάρχει στοdnaείναιημεταφοράτηςστοrnaμετηδιαδικασίατης μεταγραφής. ΤοRNAστηνπορείαμεταφέρειαυτήτηνπληροφορίαστιςπρωτεΐνεςμετη διαδικασία της μετάφρασης. Οι πρωτεΐνες είναι υπεύθυνες για τη δομή και τη λειτουργία των κυττάρων και κατ επέκταση των οργανισμών. Η σχέση αυτή απεικονίζεται στο σχήμα που είναι γνωστό ως ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ και προτάθηκε από τον Crick το 1958.

9 Έκφραση της γενετικής πληροφορίας Η γενετική πληροφορία οργανώνεται σε τμήματα DNA με συγκεκριμένη αλληλουχία που ονομάζονται γονίδια. Τα γονίδια μέσα από τη μεταγραφή και τη μετάφραση καθορίζουν τη σειρά των αμινοξέων στις πρωτεΐνες. Οι πορείες της μεταγραφής και της μετάφρασης αποτελούν τη γονιδιακή έκφραση. Μέχρι της ανακάλυψης των RNA ιών, πιστεύαμε ότι η μεταγραφή γινόταν μόνο από το DNA προς το RNA. Οι RNA ιοί διαθέτουν ένα ένζυμο που ονομάζεται αντίστροφη μεταγραφάση και επιτρέπει τη μεταγραφή του RNA σε DNA. Σε ορισμένους ιούς, το RNA έχει την ικανότητα του αυτοδιπλασιασμού. Έτσι το κεντρικό δόγμα σήμερα εμφανίζεται ως εξής:

10 Έκφραση της γενετικής πληροφορίας Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν το ίδιο DNA. Όμως σε κάθε ομάδα κυττάρων εκφράζονται διαφορετικά γονίδια (π.χ. αιμοσφαιρίνη στα ερυθρά αιμοσφαίρια και αντισώματα στα β-λεμφοκύτταρα). Τα γονίδια διακρίνονται σε δύο κατηγορίες: i. Γονίδια που μεταγράφονται σε mrna και στη συνέχεια μεταφράζονται σε πρωτεΐνες ii. Γονίδια που μεταγράφονται και παράγουν trna, rrna και snrna. Από τα 3x10 9 ζεύγη βάσεων του ανθρώπινου γονιδιώματος μικρό ποσοστό μεταγράφεται σε RNA.

11 Είδη RNA mrna: (Προκαρυωτικοί + Ευκαρυωτικοί) Μεταφέρουν την πληροφορία του DNA για την παραγωγή μίας πολυπεπτιδικής αλυσίδας trna: (Προκαρυωτικοί + Ευκαρυωτικοί) Συνδέονται με τα αμινοξέα και τα μεταφέρουν στη θέση της πρωτεϊνοσύνθεσης rrna: (Προκαρυωτικοί + Ευκαρυωτικοί) Συνδέεται με πρωτεΐνες και δημιουργούν το ριβόσωμα snrna: (Ευκαρυωτικοί) Μικρά μόρια που συνδέονται με πρωτεΐνες και σχηματίζουν μικρά ριβονουκλεοπρωτεϊνικά σωματίδια (snrnps). Καταλύουν την ωρίμανση του mrna(διαδικασία που γίνεται μόνο στους ευκαρυωτικούς).

12 Σημαντικό Arthur Kronberg Ηνωμένες Πολιτείες Αμερικής Νόμπελ Ιατρικής 1959 DNA πολυμεράση Mahlon Hoagland Ηνωμένες Πολιτείες Αμερικής Δεν έλαβε βραβείο Νόμπελ trna

13 Σημαντικό Matthew Meselson Ηνωμένες Πολιτείες Αμερικής Franklin Stahl 1929 Ηνωμένες Πολιτείες Αμερικής Δεν έλαβαν βραβείο Νόμπελ Απέδειξαν τον ημισυντηρητικότρόπο διπλασιασμού (1959) Πείραμα των Meselson - Stahl

14 Μεταγραφή του DNA Ο μηχανισμός είναι κοινός στους ευκαρυωτικούς και προκαρυωτικούς οργανισμούς Το ένζυμο που καταλύει την αντίδραση λέγεται RNA πολυμεράση (στους ευκαρυωτικούς υπάρχουν τρία είδη RNA πολυμερασών) Η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA που ονομάζονται υποκινητές. Σε αυτό βοηθάνε πρωτεΐνες που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν τα ρυθμιστικά στοιχεία της μεταγραφής του DNA. Οι υποκινητές βρίσκονται πάντα πριν από την αρχή κάθε γονιδίου.

15 Μεταγραφή του DNA Δράση της RNA πολυμεράσης κατά την έναρξη της μεταγραφής: 1. Πρόσδεση στον υποκινητή 2. Τοπικό ξετύλιγμα της διπλής έλικας του DNA 3. Τοποθέτηση ριβονουκλεοτιδίων απέναντι από τα δεοξυριβονουκλεοτίδια της μίας αλυσίδας του DNA (βάση κανόνα συμπληρωματικότητας με ουρακίλη να τοποθετείται απέναντι από αδενίνη). ΠΡΟΣΟΧΗ: Η μεταγραφή έχει επίσης προσανατολισμό Η σύνθεση του RNA σταματάει στο τέλος του γονιδίου, όπου ειδικές αλληλουχίες που ονομάζονται αλληλουχίες λήξης της μεταγραφής επιτρέπουν την απελευθέρωσή του.

16 Μεταγραφή του DNA Μη κωδική αλυσίδα: Είναι η μεταγραφόμενη, δηλαδή η συμπληρωματική με το RNA που δημιουργήθηκε. Κωδική αλυσίδα: η συμπληρωματική αλυσίδα του DNA του γονιδίου. Η αλληλουχία της είναι η ίδια με το RNA που δημιουργήθηκε. Στους προκαρυωτικούς οργανισμούς το mrna αρχίζει να μεταφράζεται σε πρωτεΐνη πριν ακόμα ολοκληρωθεί η μεταγραφή του. Στους ευκαρυωτικούς το mrna που παράγεται συνήθως δεν είναι έτοιμο για μετάφραση, αλλά πρέπει να υποστεί μία πολύπλοκη διαδικασία ωρίμανσης. Η ανακάλυψή της οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες εσώνια.

17 Σημαντικό Sir Richard Roberts Ηνωμένο Βασίλειο Phillip Sharp 1944 Ηνωμένες Πολιτείες Αμερικής Bραβείο Νόμπελ 1993 Διαδικασία ωρίμανσης Ασυνεχή γονίδια

18 Ωρίμανση -Splicing Διαδικασία που μετατρέπει το πρόδρομο mrna σε ώριμο. Τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτϊνικά σωματίδια και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snrna και πρωτεΐνες. Ο ρόλος τους είναι η απομάκρυνση των εσωνίων και η συρραφή των εξωνίων. ΈτσιπροκύπτειτοώριμοRNA. Το ώριμο RNA περιέχει αμετάφραστες περιοχές και προς το 3 και προς το 5 άκρο(3 και 5 αμετάφραστες περιοχές)

19 Μετάφραση

20 Γενετικός κώδικας Γενετικό κώδικα ονομάζουμε τον κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών. Θεωρήθηκε πιθανό ότι τρία νουκλεοτίδια αντιστοιχούν σε ένα αμινοξύ και για αυτό ονομάστηκε «κώδικας τριπλέτας».

21 Γενετικός κώδικας Βασικά χαρακτηριστικά: 1. Κώδικας τριπλέτας- κωδικόνιο 2. Συνεχής 3. Μη επικαλυπτόμενος 4. Σχεδόν καθολικός 5. Εκφυλισμένος 6. Κωδικόνια έναρξης και τερματισμού AUG Κωδικοποιεί μεθειονίνη UAG, UGA, UAA Κωδικόνια λήξης

22 Μετάφραση Πραγματοποιείται στα ριβοσώματα με τη βοήθεια των trna, τη συμμετοχή αρκετών πρωτεϊνών και ενέργειας. Τα ριβοσώματα μπορούν να μεταφράσουν οποιοδήποτε mrna. Για αυτό και βακτήρια μπορούν να μεταφράσουν ανθρώπινο mrna και να δημιουργήσουν ανθρώπινες πρωτεΐνες. Δομή ριβοσώματος: Αποτελείται από δύο υπομονάδες. Μία μικρή και μία μεγάλη. Η μικρή διαθέτει μία θέση πρόσδεσης του mrna, ενώ η μεγάλη διαθέτει δύο θέσεις εισδοχής trna. Κρυσταλλική δομή ριβοσώματος με τη χρήση της τεχνικής της κρυσταλλογραφίας ακτίνων X(Thomas Stetz, 1998)



25 trna Κάθε μόριο trna διαθέτει: μία τριπλέτα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται με το αντίστοιχο κωδικόνιο του mrna. Καθώς επίσης μία ειδική θέση σύνδεσης με ένα συγκεκριμένο αμινοξύ.

26 Φάση 1 -Έναρξη Το mrna προσδένεται μέσω μίας αλληλουχίας που υπάρχει στην 5 αμετάφραστη περιοχή με το rrna της μικρής υπομονάδας του ριβοσώματος. Το πρώτο κωδικόνιο του mrna είναι πάντα AUG που μεταφράζεται σε μεθειονίνη. Όμως δεν έχουν όλες οι πρωτεΐνες ως πρώτο αμινοξύ τη μεθειονίνη. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του mrna στη μικρή υπομονάδα του ριβοσώματος και του trna που μεταφέρει μεθειονίνη ονομάζεται σύμπλοκο έναρξης. Στη συνέχεια η μεγάλη υπομονάδα συνδέεται με τη μικρή.

27 Φάση 2 -Επιμήκυνση

28 Φάση 3 -Λήξη Η επιμήκυνση σταματά σε ένα κωδικόνιο λήξης (UGA, UAG ή UAA), επειδή δεν υπάρχουν trna που να αντιστοιχούν σε αυτά. Το τελευταίο trna απομακρύνεται από το ριβόσωμα και η πολυπεπτιδική αλυσίδα απελευθερώνεται.

29 Μία «οικονομική» διαδικασία Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mrna. Το σύμπλεγμα των ριβοσωμάτων με mrna ονομάζεται πολύσωμα.

30 Γονιδιακή ρύθμιση Γονιδιακή ρύθμιση ονομάζουμε τον έλεγχο της γονιδιακής έκφρασης (Υπενθύμιση: Γονιδιακή έκφραση αποτελεί η μεταγραφή και η μετάφραση) Συνολικά όταν χρησιμοποιούμε τον όρο γονιδιακή έκφραση αναφερόμαστε σε όλη τη διαδικασία ενεργοποίησης ενός γονιδίου για την παραγωγή μίας πρωτεΐνης. Δεδομένο Σε κάθε κύτταρο δεν παράγονται όλες οι πρωτεΐνες κάθε στιγμή Η κάθε πρωτεΐνη χρειάζεται σε συγκεκριμένη ποσότητα (άρα θα ήταν ανούσιο να παράγονται όλες στις ίδιες ποσότητες, αφού άλλες θα περίσσευαν και άλλες θα έλειπαν). Εξήγηση Υπαρξη και λειτουργία ενός προγράμματος ρύθμισης της γονιδιακής έκφρασης. Ελέγχει το πότε, το ποιες και το πόσες πρωτεΐνες θα παραχθούν

31 Γονιδιακή ρύθμιση

32 Γονιδιακή ρύθμιση (βακτήρια) Σκοπός Η προσαρμογή του οργανισμού στις αλλαγές των περιβαλλοντικών συνθηκών ώστε να εξασφαλίζονται οι βέλτιστες συνθήκες για την επιβίωση (αύξηση) και την αναπαραγωγή του(διαίρεση).

33 Σημαντικό Νόμπελ Ιατρικής και Φυσιολογίας 1965

34 Γονιδιακή ρύθμιση (βακτήρια) Ένα βακτηριακό κύτταρο E. coli έχει περίπου γονίδια Άλλα εκφράζονται συνεχώς γιατί χρειάζονται για βασικές λειτουργίες του κυττάρου Άλλα εκφράζονται κάτω από ιδιαίτερες περιβαλλοντικές συνθήκες, γιατί τα προϊόντα τους χρειάζονται μόνο σε αυτές τις ιδιαίτερες συνθήκες Παράδειγμα Αν το E. coli αναπτύσσεται σε ένα περιβάλλον χωρίς γλυκόζη (κύριος μεταβολίτης), αλλά πλούσιο σε λακτόζη (δισακχαρίτης: γαλακτόζη + γλυκόζη), πώς θα συμπεριφερθεί; Θα μπορέσει να τον διασπάσει και να χρησιμοποιήσει την πολυπόθητη γλυκόζη;

35 Γονιδιακή ρύθμιση (βακτήρια) Οι Jacob και Monod το 1961 απέδειξαν ότι τα τρία ένζυμα (βγαλακτοζιδάση, περμεάση, τρανσακετυλάση) που απαιτούνται για τη διάσπαση της λακτόζης βρίσκονται το ένα δίπλα στο άλλο πάνω στο γονιδίωμα και αποτελούν μία μονάδα. Αυτή την ομάδα την ονόμασαν οπερόνιο της λακτόζης. Το οπερόνιο της λακτόζης περιλαμβάνει εκτός των 3 γονιδίων των ενζύμων(δομικά) και αλληλουχίες DNA που ρυθμίζουν την έκφρασή τους. Οι αλληλουχίες αυτές βρίσκονται μπροστά από τα δομικά γονίδια και είναι κατά σειρά ένα ρυθμιστικό γονίδιο, ο υποκινητής και ο χειριστής. Όταν απουσιάζει η λακτόζη από το περιβάλλον του βακτηρίου, τότε το οπερόνιο βρίσκεται σε καταστολή(δε μεταγράφεται, ούτε μεταφράζεται). gene-machine-lac-operon_en.jar

36 Γονιδιακή ρύθμιση (πολυκύτταροι)

37 Κυτταρική διαφοροποίηση

38 Γονιδιακή ρύθμιση (πολυκύτταροι) Όλατακύτταραέχουντοίδιογενετικόυλικό,άρακαιταίδιαγονίδια Ημορφήόμωςκαιηλειτουργίατουςδενείναιηίδια Έχουν αναπτύξει μηχανισμούς που επιτρέπουν την επιλεκτική έκφραση της γενετικής πληροφορίας που χρειάζονται κάθε χρονική στιγμή Κάθε κυτταρικός τύπος έχει εξειδικευμένη λειτουργία. Ταυτόχρονα πρέπει να υπάρχει συντονισμός των λειτουργιών όλων των κυττάρων. Άρα η τελειοποίηση των συστημάτων ελέγχου είναι αναγκαία

39 Γονιδιακή ρύθμιση (πολυκύτταροι) Στη μεταγραφή Τεράστια ποικιλία μεταγραφικών παραγόντων Κάθε γονίδιο τον δικό του υποκινητή Μέτα-μεταγραφικά Καθορισμός ταχύτητας ωρίμανσης mrna και ελευθέρωσής του στο κυτταρόπλασμα Επίπεδα ρύθμισης Στη μετάφραση Χρόνος ζωής του mrna στο κυτταρόπλασμα Ποικιλία στην ικανότητα σύνδεσης στο ριβόσωμα Μέτα-μεταφραστικά Τροποποίηση του τελικού προϊόντος ώστε να γίνει βιολογικά λειτουργικό

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής


Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα