Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της"


1 ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική πληροφορία γενετική πληροφορία από κύτταρο σε μέσα στο ίδιο το κύτταρο κύτταρο και από οργανισμό σε οργανισμό 2. Απέναντι από την Α τοποθετείται Τ 2. Απέναντι από την Α τοποθετείται U 3. Γίνεται μια φορά κατά τον κυτταρικό κύκλο 3. Γίνεται πολλές φορές στη διάρκεια της ζωής ενός κυττάρου 4. Σχηματίζονται τα πρωταρχικά 4. Δε σχηματίζονται πρωταρχικά τμήματα τμήματα 5. Υπάρχουν ένζυμα επιδιόρθωσης 5. Δεν υπάρχουν ένζυμα επιδιόρθωσης 6. Διαφορετικό ένζυμο διασπά τους δεσμούς υδρογόνου και διαφορετικό 6. Το ίδιο ένζυμο κάνει και τις 2 διαδικασίες (RNA πολυμεράση) ένζυμο αντιγράφει 7. Ολοκληρώνεται πριν τη διαίρεση 7. Γίνεται πολλές φορές σε όλα τα κύτταρα ενός κυττάρου 8. Αντιγράφονται και οι 2 αλυσίδες 8. Μεταγράφεται μόνο η μη κωδική αλυσίδα 9. Από 1 μόριο DNA προκύπτουν 2 νέα 9. Προκύπτουν πολλά πανομοιότυπα μόρια μόρια DNA 10. Το μόριο DNA πριν αλλά και μετά την αντιγραφή βρίσκεται στον πυρήνα του κυττάρου 11. Αντιγράφεται όλο το μόριο του DNA ανεξάρτητα από το εάν εκφράζεται ή όχι 12. Η αντιγραφή των ευκαρυωτικών κυττάρων ξεκινάει από πολλά σημεία ταυτόχρονα 13. Το μόριο DNA που προκύπτει δεν υφίσταται επιπλέον διαδικασία 14. Δεν απαιτείται η σύνδεση ειδικών πρωτεϊνών με αλληλουχίες DNA για την έναρξη της αντιγραφής mrna 10. Το mrna που προκύπτει μεταφέρεται στο κυτταρόπλασμα 11. Μεταγράφεται ένα μόνο συγκεκριμένο γονίδιο 12. Η μεταγραφή ξεκινάει από ένα σημείο στον υποκινητή του γονιδίου 13. Το μόριο mrna που προκύπτει στους ευκαρυωτικούς οργανισμούς υφίσταται ωρίμανση 14. Απαιτείται η παρουσία μεταγραφικών παραγόντων Ομοιότητες Ισχύει η συμπληρωματικότητα των βάσεων Γίνονται με κατεύθυνση 5 3 Ένζυμο διασπά τους δεσμούς υδρογόνου και στη συνέχεια γίνεται ξετύλιγμα της αλυσίδας Γίνονται στον πυρήνα των ευκαρυωτικών κυττάρων, στα μιτοχόνδρια και στους χλωροπλάστες Απαιτούνται νουκλεοτίδια και ενέργεια Το καλούπι είναι το DNA 2. Ποια ένζυμα γνωρίζετε που διασπούν τους φωσφοδιεστερικούς δεσμούς μεταξύ των νουκλεοτιδίων; Τα ένζυμα που διασπούν τους φωσφοδιεστερικούς δεσμούς είναι:

2 DNA πολυμεράση, η οποία επιδιορθώνει λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Επιδιορθωτικά ένζυμα, τα οποία επιδιορθώνουν το μεγαλύτερο ποσοστό των λαθών που συμβαίνουν κατά την αντιγραφή. Ριβονουκλεοπρωτεϊνικά σωματίδια, τα οποία και απομακρύνουν τα εσώνια και συρράπτουν τα εξώνια κατά τη διαδικασία της ωρίμανσης. Περιοριστικές ενδονουκλεάσες, οι οποίες χρησιμοποιούνται για τη δημιουργία ανασυνδυασμένου DNA. 3. Σε ποιο στάδιο του κυτταρικού κύκλου και σε ποιο σημείο του κυττάρου γίνονται οι διαδικασίες της αντιγραφής, μεταγραφής και μετάφρασης; Αντιγραφή Ολοκληρώνεται στο στάδιο της μεσόφασης και μόνο μία φορά κατά τη διάρκεια του κυτταρικού κύκλου. Πραγματοποιείται στα: Ευκαρυωτικά κύτταρα: Στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Προκαρυωτικά κύτταρα: Στο κυτταρόπλασμα. Ιούς: Στο εσωτερικό του κυττάρου-ξενιστή. Μεταγραφή Πραγματοποιείται καθόλη τη διάρκεια της μεσόφασης πάρα πολλές φορές. Πραγματοποιείται στα: Ευκαρυωτικά κύτταρα: Στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Προκαρυωτικά κύτταρα: Στο κυτταρόπλασμα. Ιούς: Στο εσωτερικό του κυττάρου-ξενιστή Μετάφραση Πραγματοποιείται καθόλη τη διάρκεια της μεσόφασης πάρα πολλές φορές. Πραγματοποιείται στα: Ευκαρυωτικά κύτταρα: Στο κυτταρόπλασμα, στα μιτοχόνδρια και στους χλωροπλάστες. Προκαρυωτικά κύτταρα: Στο κυτταρόπλασμα. Ιούς: Στο εσωτερικό του κυττάρου-ξενιστή 4. Με ποιους τρόπους το mrna ρυθμίζει την γονιδιακή έκφραση των ευκαρυωτικών οργανισμών; Το mrna διαδραματίζει σημαντικό ρόλο σε δύο διαφορετικά επίπεδα της ρύθμισης της γονιδιακής έκφρασης των ευκαρυωτικών οργανισμών. Στο επίπεδο της μεταγραφής: Περιλαμβάνονται μηχανισμοί με τους οποίους γίνεται η ωρίμανση του πρόδρομου mrna και καθορίζεται η ταχύτητα με την οποία το ώριμο mrna εισέρχεται στο κυτταρόπλασμα. Στο επίπεδο της μετάφρασης: Τα διάφορα μόρια mrna δεν εμφανίζουν τον ίδιο χρόνο ζωής και την ίδια ικανότητα πρόσδεσης στα ριβοσώματα. 5. Ποια είναι η δομή του οπερονίου της λακτόζης; Το οπερόνιο της λακτόζης αποτελείται από 4 γονίδια (3 δομικά και 1 ρυθμιστικό), από ένα χειριστή (βρίσκεται μπροστά από τα δομικά γονίδια) και από 2 υποκινητές (έναν υποκινητή για τα 3 δομικά γονίδια και ένα για το ρυθμιστικό γονίδιο). Επαγωγή του οπερονίου έχει σαν αποτέλεσμα τη δημιουργία 2 mrna, από τα οποία το ένα mrna προέρχεται από το ρυθμιστικό γονίδιο και φέρει την πληροφορία για το σχηματισμό της πρωτεΐνης-καταστολέα και το άλλο mrna είναι το αποτέλεσμα της μεταγραφής και των 3 δομικών γονιδίων και κατά συνέπεια φέρει την πληροφορία για 3 διαφορετικά πρωτεϊνικά προϊόντα. 6. Σε ποια τμήματα του ευκαρυωτικού κυττάρου λειτουργεί η DNA δεσμάση; Η DNA δεσμάση είναι ένζυμο της αντιγραφής και οι λειτουργίες της είναι, αφενός να συνδέει τα κομμάτια της ασυνεχούς αλυσίδας, αφετέρου να συνδέει όλα τα κομμάτια που προκύπτουν από τις διαφορετικές θέσεις έναρξης της αντιγραφής. Κατά συνέπεια η DNA δεσμάση θα λειτουργεί στα τμήματα του κυττάρου που γίνεται αντιγραφή δηλαδή στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

3 7. Ποιες ριβονουκλεοπρωτεΐνες γνωρίζετε και ποιος ο ρόλος τους; Οι ριβονουκλεοπρωτεΐνες είναι υπερμοριακά συμπλέγματα που αποτελούνται από RNA και πρωτεΐνες. Ριβονουκλεοπρωτεΐνες είναι: 1. Το ριβόσωμα: Πάνω στο ριβόσωμα γίνεται η πρωτεϊνοσύνθεση. 2. Τα ριβονουκλεοπρωτεϊνικά σωματίδια: Καταλύουν την ωρίμανση του πρόδρομου mrna των ευκαρυωτικών κυττάρων. 8. Ποιες είναι οι σημαντικότερες διαφορές μεταξύ DNA και RNA πολυμεράσης: DNA πολυμεράση RNA πολυμεράση 1. Συνθέτουν DNA Συνθέτουν mrna 2. Είναι πολλών ειδών, η καθεμιά με Στους προκαρυωτικούς είναι 1 είδος διαφορετική λειτουργία στους ευκαρυωτικούς είναι 3 είδη 3. Χρησιμοποιούν δεοξυριβονουκλεοτίδια Χρησιμοποιούν ριβονουκλεοτίδια 4. Επιδιορθώνουν λάθη Δεν επιδιορθώνουν λάθη 5. Σπάνε φωσφοδιεστερικούς δεσμούς Δεν σπάνε φωσφοδιεστερικούς δεσμούς 6. Δεν σπάνε τους δεσμούς υδρογόνου και Σπάνε τους δεσμούς υδρογόνου και δεν ξετυλίγουν την αλυσίδα ξετυλίγουν την αλυσίδα 7. Χρειάζονται καλούπι (πρωταρχικά Δε χρειάζονται πρωταρχικά τμήματα τμήματα) για να επιμηκύνουν τη νεοσυντιθέμενη αλυσίδα 8. Αντιγράφουν όλο το μόριο DNA Μεταγράφουν μόνο το γονίδιο μέχρι τις αλληλουχίες λήξης της μεταγραφής Ποιοι δεσμοί και μεταξύ ποιων μορίων αναπτύσσονται κατά την πρωτεϊνοσύνθεση; Κατά την πρωτεϊνοσύνθεση σχηματίζονται: Δεσμοί υδρογόνου μεταξύ της μικρής υπομονάδας του ριβοσώματος και της 5 αμετάφραστης περιοχής του mrna. Δεσμοί μεταξύ της μικρής και μεγάλης υπομονάδας του ριβοσώματος. Δεσμοί υδρογόνου μεταξύ των αντικωδικονίων του trna και των κωδικονίων του mrna. Δεσμοί μεταξύ των trna και των αμινοξέων. Πεπτιδικοί δεσμοί μεταξύ των αμινοξέων. 10. Τα λάθη στην αντιγραφή ή στη μεταγραφή έχουν σημαντικότερες επιπτώσεις στην λειτουργία του κυττάρου; Τα λάθη στην αντιγραφή είναι σημαντικότερα αφού οδηγούν σε μόνιμες αλλαγές και στη δημιουργία διαφορετικού mrna και πρωτεϊνικού προϊόντος σε σχέση με τα αρχικά. Αντίθετα λάθη στη μεταγραφή οδηγούν «στιγμιαία» στην παραγωγή διαφορετικής πρωτεΐνης χωρίς όμως να προκαλούν μόνιμες αλλαγές του γενετικού υλικού. 11. Ποια τμήματα του DNA ενός κυττάρου: α. Δε μεταγράφονται. β. Μεταγράφονται, αλλά δε μεταφράζονται. α. Δε μεταγράφονται: Η κωδική αλυσίδα του DNA. Οι περιοχές του DNA που δεν αντιστοιχούν σε γονίδια (μη κωδικοποιούσα περιοχή). Τα γονίδια που δεν εκφράζονται στο συγκεκριμένο κυτταρικό τύπο. Ο υποκινητής. β. Μεταγράφονται, αλλά δε μεταφράζονται: Τα εσώνια των γονιδίων. Τα εξώνια που αντιστοιχούν στις 5 και 3 αμετάφραστες περιοχές.

4 Τα γονίδια των trna, rrna και snrna. Ο χειριστής (μόνο για προκαρυωτικό κύτταρο) 12. Να αναφέρετε γονίδια τα οποία: α. Εκφράζονται συνεχώς σε όλους τους κυτταρικούς τύπους ενός ευκαρυωτικού οργανισμού. β. Εκφράζονται σε συγκεκριμένους κυτταρικούς τύπους ενός ευκαρυωτικού οργανισμού. α. Γονίδια που κωδικοποιούν: ιστόνες, μη ιστόνες, πρωτεΐνες του ριβοσώματος, ένζυμα της αντιγραφής και μεταγραφής (DNA πολυμεράση, DNA ελικάση, DNA δεσμάση, πριμόσωμα, επιδιορθωτικά ένζυμα, RNA πολυμεράση, μεταγραφικοί παράγοντες, πρωτεΐνες των ριβονουκλεοπρωτεϊνικών σωματιδίων, παράγοντας απελευθέρωσης), πρωτεΐνες που σχετίζονται με την οξειδωτική φωσφορυλίωση των μιτοχονδρίων. β. Γονίδια που κωδικοποιούν: αιμοσφαιρίνη (ερυθροκύτταρα), ένζυμα που σχηματίζουν τα Α και Β αντιγόνα (ερυθροκύτταρα), αντισώματα (Β-λεμφοκύτταρα), ινσουλίνη (πάγκρεας), ΑDA (κύτταρα μυελού των οστών), μια πρωτεΐνη των επιθηλιακών κυττάρων των πνευμόνων (έλλειψη της οδηγεί σε κυστική ίνωση), α1-αντιθρυψίνη (ήπαρ), παράγοντες VIII και IX (παράγοντες πήξης αίματος), ένζυμο στα κύτταρα του δέρματος, των μαλλιών και του οφθαλμού που είναι απαραίτητο για το σχηματισμό της μελανίνης, ένζυμο στα κύτταρα του εγκεφάλου που μετατρέπει το αμινοξύ φαινυλαλανίνη σε τυροσίνη, αυξητική ορμόνη (εκκρίνεται από την υπόφυση), ιντερφερόνες (εκκρίνονται μόνο από τα κύτταρα που έχουν προσβληθεί από ιούς). 13. Γιατί η αυξητική ορμόνη μπορεί να παραχθεί από βακτήρια; Η αυξητική ορμόνη μπορεί να παραχθεί από βακτήρια γιατί ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα, ενώ τα ριβοσώματα είναι σε θέση να μεταφράζουν οποιοδήποτε μόριο mrna. 14. Ποιες οι διαφορές στη γονιδιακή ρύθμιση μεταξύ ευκαρυωτικών και προκαρυωτικών οργανισμών; Ευκαρυωτικό κύτταρο Προκαρυωτικό κύτταρο 1. Είναι πιο πολύπλοκη 1. Είναι πιο απλή 2. Η ρύθμιση επιτελείται σε 4 στάδια 2. Η ρύθμιση επιτελείται σε 1 στάδιο 3. Κάθε γονίδιο έχει το δικό του υποκινητή 3. Η έκφραση των γονιδίων γίνεται ανά και μεταγραφικούς παράγοντες 4. Από κάθε γονίδιο προκύπτει 1 mrna η μετάφραση του οποίου δίνει 1 πρωτεϊνικό προϊόν 5. Η μετάφραση του mrna αρχίζει μετά την ολοκλήρωση της μεταγραφής του DNA ομάδες 4. Από κάθε οπερόνιο προκύπτου 2 mrna. Το ένα mrna δίνει την πρωτεΐνη του ρυθμιστικού γονιδίου, ενώ η μετάφραση του άλλου mrna δίνει πρωτεϊνικά προϊόντα ανάλογα του αριθμού των δομικών γονιδίων 5. Η μετάφραση του mrna μπορεί να αρχίσει πριν την ολοκλήρωση της μεταγραφής του DNA 6. Δεν υπάρχει χειριστής, αναστολέας και 6. Υπάρχει χειριστής, αναστολέας και επαγωγέας της γονιδιακής έκφρασης επαγωγέας της γονιδιακής έκφρασης 7. Οδηγεί σε κυτταρική διαφοροποίηση 7. Αποσκοπεί στην προσαρμογή του οργανισμού στις εναλλαγές του περιβάλλοντος 8. Το πρωτεϊνικό προϊόν συνήθως υφίσταται μετα-μεταφραστική τροποποίηση 9. Αρχίζει στον πυρήνα και ολοκληρώνεται στο κυτταρόπλασμα 8. Το πρωτεϊνικό προϊόν συνήθως δεν υφίσταται μετα-μεταφραστική τροποποίηση 9. Αρχίζει και ολοκληρώνεται στο κυτταρόπλασμα

5 15. Ποιες είναι οι διαφορές στη μεταγραφή μεταξύ ευκαρυωτικού και προκαρυωτικού κυττάρου; Ευκαρυωτικό κύτταρο Προκαρυωτικό κύτταρο 1. Γίνεται στον πυρήνα 1. Γίνεται στο κυτταρόπλασμα 2. Συμμετέχουν 3 είδη RNA πολυμεράσης 2. Συμμετέχουν 1 είδος RNA πολυμεράσης 3. Μεταγράφεται 1 γονίδιο 3. Μεταγράφεται 1 οπερόνιο (ομάδα γονιδίων) 4. Το mrna δε μεταφράζεται πριν την 4. Το mrna μεταφράζεται πριν την ολοκλήρωση της μεταγραφής 5. Το mrna υφίσταται τη διαδικασία της ωρίμανσης από τα ριβονουκλεοπρωτεϊνικά σωματίδια ολοκλήρωση της μεταγραφής 5. Το mrna δεν υφίσταται την διαδικασία της ωρίμανσης από τα ριβονουκλεοπρωτεϊνικά σωματίδια 6. Δημιουργούνται 4 είδη RNA (mrna, trna, rrna και snrna) 6. Δημιουργούνται 3 είδη RNA (mrna, trna και rrna) 7. Κάθε mrna που παράγεται 7. Το mrna των δομικών γονιδίων που μεταφράζεται σε 1 πρωτεΐνη παράγεται μεταφράζεται σε πρωτεϊνικά προϊόντα ανάλογα του αριθμού των δομικών γονιδίων 8. Περισσότεροι μεταγραφικοί παράγοντες 8. Λιγότεροι μεταγραφικοί παράγοντες 16. Ποια μόρια RNA γνωρίζετε και με ποια διαδικασία παράγεται το καθένα; Με τη διαδικασία της αντιγραφής παράγονται τα πρωταρχικά τμήματα και το RNA των ιών. Με τη διαδικασία της μεταγραφής παράγεται το mrna, trna, rrna, snrna. 17. Ποιες πρωτεΐνες βρίσκονται στον πυρήνα; Πρωτεΐνες του πυρήνα είναι: DNA πολυμεράση, DNA δεσμάση, DNA ελικάση, πριμόσωμα, επιδιορθωτικά ένζυμα, RNA πολυμεράση, μεταγραφικοί παράγοντες, παράγοντας απελευθέρωσης, ιστόνες, μη ιστόνες, πρωτεΐνες των ριβονουκλεοπρωτεϊνικών σωματιδίων. 18. Σε ποιες περιπτώσεις κατά την αντιγραφή και έκφραση του γενετικού υλικού ισχύει ο κανόνας της συμπληρωματικότητας των βάσεων; Κατά την αντιγραφή: Στη δημιουργία των πρωταρχικών τμημάτων. Στην επιμήκυνση της πολυνουκλεοτιδικής αλυσίδας. Στην επιδιόρθωση των λαθών από την DNA πολυμεράση και τα επιδιορθωτικά ένζυμα. Στη δράση της DNA δεσμάσης. Στην αντιγραφή RNA ιών. Κατά την μεταγραφή: Στη δημιουργία mrna από τη μη κωδική αλυσίδα του DNA. Στην αντίστροφη μεταγραφή, δηλαδή στη δημιουργία DNA με καλούπι RNA. Κατά την μετάφραση: Στη σύνδεση της μικρής υπομονάδας του ριβοσώματος με την 5 αμετάφραστη περιοχή του mrna. Στη σύνδεση των αντικωδικονίων των trna με τα κωδικόνια του mrna κατά την επιμήκυνση της πολυπεπτιδικής αλυσίδας. 19. Ποια είναι τα πιθανά προβλήματα κατά την έκφραση του γονιδίου της ανθρώπινης ινσουλίνης σε βακτηριακό κύτταρα; Τα πιθανά προβλήματα είναι τα εξής: Το βακτηριακό κύτταρο δεν έχει μηχανισμούς ωρίμανσης με αποτέλεσμα η ινσουλίνη που παράγεται από αυτό να διαφέρει από αυτή του ανθρώπου. Το βακτηριακό κύτταρο δεν έχει μηχανισμούς τροποποίησης (μετα-μεταφραστική τροποποίηση) αντίστοιχους με αυτούς ενός ευκαρυωτικού κυττάρου. Η ινσουλίνη που παράγεται μπορεί να διαφέρει από την ανθρώπινη.

6 Ο υποκινητής μπορεί να μην αναγνωρίζεται από την RNA πολυμεράση του βακτηρίου. Μπορεί το βακτήριο να μη διαθέτει τους κατάλληλους μεταγραφικούς παράγοντες. 20. Ποιες οι διαφορές στο γενετικό υλικό μεταξύ ευκαρυωτικών και προκαρυωτικών οργανισμών; ΕΥΚΑΡΥΩΤΙΚΑ ΠΡΟΚΑΡΥΩΤΙΚΑ Το γενετικό τους υλικό είναι συγκεντρωμένο Δεν έχουν πυρήνα. Το γενετικό τους υλικό κυρίως στον πυρήνα. Γενετικό υλικό βρίσκεται στο κυτταρόπλασμα. υπάρχει επίσης στα μιτοχόνδρια και στους χλωροπλάστες. Αποτελείται από πολλά ευθύγραμμα μόρια DNΑ. Δεν έχουν πλασμίδια Ο αριθμός και τα μήκη των μορίων DΝΑ είναι χαρακτηριστικά για κάθε είδος οργανισμού Περιέχουν περισσότερη ποσότητα DΝΑ Αποτελείται από ένα κύριο δίκλωνο κυκλικό μόριο DΝΑ και πλασμίδια (μόρια κυκλικά και μικρού μεγέθους) Έχει μήκος περίπου 1 mm και είναι μικρότερο από το γενετικό υλικό του ευκαρυωτικού Περιέχουν λιγότερη ποσότητα DΝΑ Στο πακετάρισμα του DΝΑ του πυρήνα Πακετάρεται και αναδιπλώνεται με τη συμμετέχουν οι ιστόνες και μη ιστόνες βοήθεια διαφορετικών πρωτεϊνών Ο βαθμός συσπείρωσης του DΝΑ μεταβάλλεται και γίνεται έντονος στη Ο βαθμός συσπείρωσης δεν μεταβάλλεται μετάφαση Η βασική μονάδα οργάνωσης της Δεν υπάρχουν νουκλεοσώματα χρωματίνης είναι το νουκλεόσωμα Το κάθε χρωμόσωμα μετά την αντιγραφή και μέχρι το τέλος της μετάφασης Δεν υπάρχει αντίστοιχη μορφοποίηση αποτελείται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο Στους ανώτερους ευκαρυωτικούς οργανισμούς τα χρωμοσώματα διακρίνονται σε αυτοσωμικά και φυλετικά Στους ανώτερους ευκαρυωτικούς οργανισμούς τα σωματικά κύτταρα και το ζυγωτό είναι διπλοειδή και οι γαμέτες απλοειδής Δεν γίνεται διάκριση σε αυτοσωμικά και φυλετικά χρωμοσώματα Είναι απλοειδή, δηλαδή φέρουν ένα αντίγραφο του γονιδιώματος Διαιρούνται με μίτωση. Οι γαμέτες Διαιρούνται μονογονικά με διχοτόμηση σχηματίζονται με μείωση Κάθε χρωμόσωμα έχει πολυάριθμες θέσεις Έχουν μία θέση έναρξη αντιγραφής έναρξης αντιγραφής Δεν υπάρχουν οπερόνια Υπάρχουν οπερόνια Τα περισσότερα γονίδιά τους είναι ασυνεχή Είναι συνεχή τα γονίδιά τους. Δε γίνεται ωρίμανση ή διακεκομμένα με εσώνια και εξώνια. Γίνεται ωρίμανση Υπάρχει κυτταρική διαφοροποίηση Δεν υπάρχει κυτταρική διαφοροποίηση Η ρύθμιση της γονιδιακής έκφρασης γίνεται Έχουν ένα επίπεδο ρύθμισης της έκφρασης σε 4 επίπεδα Δεν παράγουν περιοριστικές Οι περιοριστικές ενδονουκλεάσες ενδονουκλεάσες παράγονται από βακτήρια Συμβαίνουν γονιδιακές και χρωμοσωμικές Συμβαίνουν μόνο γονιδιακές μεταλλάξεις μεταλλάξεις 21. Να αναφέρετε ποια τμήματα του γονιδιώματος ενός ανθρώπινου σωματικού κυττάρου: α. Δεν μεταγράφονται. β. Μεταγράφονται αλλά δεν μεταφράζονται.

7 α. Τμήματα του γενετικού υλικού των διάφορων οργανισμών που δεν μεταγράφονται και συνεπώς δεν μεταφράζονται είναι: Περιοχές του DNA που δεν αποτελούν γονίδια και συχνά καταλαμβάνουν μεγάλο μέρος του συνολικού μήκους του γονιδιώματος. Οι υποκινητές. Τα γονίδια που λόγω γονιδιακής ρύθμισης δεν εκφράζονται στο συγκεκριμένο κύτταρο. β. Τμήματα που μεταγράφονται αλλά δεν μεταφράζονται είναι: Τα εσώνια των γονιδίων. Τα γονίδια που κδικοποιούν τα μόρια trna, rrna και snrna. Τα τμήματα γονιδίων που μεταγράφονται στις αμετάφραστες 3' και 5' περιοχές μορίων mrna. 22. Σε ποιες περιπτώσεις είναι δυνατό να συνδέεται: α. Αλυσίδα DNA με αλυσίδα DNA. β. Αλυσίδα DNA με RNA. γ. Αλυσίδα RNA με RNA. α. Σύνδεση αλυσίδας DNA αλυσίδα DNA μπορεί να έχουμε: Στο γενετικό υλικό των ευκαρυωτικών οργανισμών. Στο κύριο βακτηριακό DNA. Στα πλασμίδια. Στα μιτοχόνδρια. Στους χλωροπλάστες. Στο γενετικό υλικό μερικών ιών. Στην περίπτωση υβριδοποίησης με τη χρήση ανιχνευτών. β. Σύνδεση αλυσίδας DNA με RNA μπορεί να έχουμε στην: Αντιγραφή, κατά το σχηματισμό των πρωταρχικών τμημάτων. Μεταγραφή. Αντίστροφη μεταγραφή RNA ιών. Υβριδοποίηση με τη χρήση ανιχνευτών. γ. Σύνδεση αλυσίδας RNA με RNA μπορεί να έχουμε: Στη μετάφραση, κατά την ένωση του rrna με την 5' αμετάφραστη περιοχή του mrna. Στη μετάφραση, κατά την ένωση του mrna και του trna με τα κωδικόνια και τα αντικωδικόνια αντίστοιχα. Στην αντιγραφή του RNA μερικών RNA ιών. 23. Δύο φυσιολογικά κύτταρα, ένα ηπατικό και ένα λεμφοκύτταρο, απομονώθηκαν από τον ίδιο οργανισμό και πραγματοποιήθηκε βιοχημική ανάλυση των πρωτεϊνών τους. Η ανάλυση έδειξε ότι τα κύτταρα περιείχαν έναν αριθμό όμοιων πρωτεϊνών αλλά και πολλές διαφορετικές πρωτεΐνες. Με βάση όσα γνωρίζετε από το γενετικό υλικό των οργανισμών και τη γονιδιακή έκφραση, να δικαιολογήσετε αυτά τα αποτελέσματα. Να αναφέρετε τις πρωτεΐνες, δομικές ή λειτουργικές, που είναι δυνατό να υπάρχουν όμοιες και στους δύο τύπους κυττάρων. Τα κύτταρα ενός οργανισμού έχουν όλα το ίδιο γενετικό υλικό και ως εκ τούτου τα ίδια γονίδια. Οι διαφορετικές πρωτεΐνες στους δύο κυτταρικούς τύπους είναι προϊόν της γονιδιακής ρύθμισης, της επιλεκτικής δηλαδή έκφρασης του γενετικού υλικού, που αποσκοπεί στην επιτέλεση διαφορετικών λειτουργιών από τους διάφορους κυτταρικούς τύπους. Ωστόσο κάποιες πρωτεΐνες παράγονται φυσιολογικά σε όλους τους κυτταρικούς τύπους, καθώς ο ρόλος τους, δομικός ή λειτουργικός, είναι ενιαίος για κάθε τύπο ευκαρυωτικού κυττάρου. Αυτές είναι οι εξής: Δομικές Ιστόνες και άλλες πρωτεΐνες (μη ιστόνες) που συμμετέχουν στο σχηματισμό της χρωματίνης. Πρωτεΐνες που συνδέονται με το rrna προς το σχηματισμό ριβοσώματος.

8 Πρωτεΐνες που συνδέονται με το snrna προς το σχηματισμό ριβονουκλεοπρωτεϊνικών σωματιδίων. Λειτουργικές Ένζυμα της αντιγραφής του DNA, όπως οι DNA ελικάσες, το πριμόσωμα, οι DNA πολυμεράσες, η DNA δεσμάση και τα επιδιορθωτικά ένζυμα. Ένζυμα της μεταγραφής, όπως τα τρία είδη RNA πολυμερασών που υπάρχουν στα ευκαρυωτικά κύτταρα. Πρωτεΐνες που συμμετέχουν στη μετάφραση του mrna. Πρωτεΐνες σχετικές με την οξειδωτική φωσφορυλίωση που επιτελείται στα μιτοχόνδρια. 24. Για ποιο λόγο ο αριθμός των αμινοξέων μιας πολυπεπτιδικής αλυσίδας ευκαρυωτικού κυττάρου είναι κατά πολύ μικρότερος του αριθμού των νουκλεοτιδίων στο γονίδιο που την κωδικοποιεί; Το πρόδρομο mrna περιέχει το μισό αριθμό των νουκλεοτιδίων του γονιδίου. Από το πρόδρομο mrna αφαιρείται αριθμός νουκλεοτιδίων ως εσώνια. Από το ώριμο mrna δεν μεταφράζονται τα νουκλεοτίδια των 5' και 3' αμετάφραστων περιοχών. Τρία νουκλεοτίδια κωδικοποιούν ένα αμινοξύ. Από την πολυπεπτιδική αλυσίδα είναι πιθανό να έχει αφαιρεθεί αριθμός αμινοξέων.


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής


Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 4 Μαρτίου 2012 Θέμα 1 ο : 1.β 2.γ 3.γ 4.δ 5.δ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Κυριακή 4 Μαρτίου 2012 Θέμα 1 ο : 1.β 2.γ 3.γ 4.δ 5.δ Θέμα 2 ο : 1. Σχολικό βιβλίο, σελ.119 «Οι ιντερφερόνες είναι αντιικές πρωτεΐνες.με

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1 ΚΕΦΑΛΑΙΟ 1 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι επιστήµονες αρχικά πίστευαν ότι το γενετικό υλικό ήταν οι πρωτεΐνες και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέμα 1 ο : Να επιλέξετε τη σωστή απάντηση: 1. Το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης δεν περιλαμβάνει α. το mrna β. τη μεγάλη ριβοσωμική υπομονάδα γ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα