Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση."


1 Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο; 3. Ποιο είναι το κεντρικό δόγμα της Βιολογίας; 4. Γιατί ο αυτοδιπλασιασμός του DNA χαρακτηρίζεται ως ημισυντηρητικός; 5. Τι είναι γενετικός κώδικας; 6. Τι είναι μεταγραφή του DNA; Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. Η σειρά των βάσεων σε ένα τμήμα του μορίου του DNA, που χρησιμοποιήθηκε ως καλούπι για τη σύνθεση ενός τμήματος m-rna είναι: αδενίνη, γουανίνη, θυμίνη. Η σειρά των βάσεων στο αντίστοιχο αντικωδικόνιο του t-rna θα είναι: α. αδενίνη, γουανίνη, ουρακίλη β. αδενίνη, κυτοσίνη, ουρακίλη γ. ουρακίλη, γουανίνη, αδενίνη δ. ουρακίλη, κυτοσίνη, αδενίνη *0. Το συνολικό μήκος του DNA που περιέχεται στο ευκαρυωτικό κύτταρο, είναι εξαιρετικά μεγάλο σε σχέση με τις διαστάσεις του. Η ολοκλήρωση της αντιγραφής του, σε σχετικά σύντομο χρονικό διάστημα, οφείλεται στο γεγονός ότι: α. η διπλή έλικα του DNA ανοίγει ταυτόχρονα σε πολλά σημεία β. η αντιγραφή πραγματοποιείται ταυτόχρονα και προς τις δύο κατευθύνσεις γ. όλες οι αντιδράσεις πραγματοποιούνται με τη βοήθεια ενζύμων δ. ισχύουν όλα τα παραπάνω *0. Η σύνθεση του RNA γίνεται πάνω σε «καλούπι» DNA και περιλαμβάνει: α. μεταγραφή και των δύο αλυσίδων του DNA β. μεταγραφή μόνο της μιας ή της άλλης αλυσίδας της διπλής έλικας γ. μεταγραφή τυχαίων τμημάτων της μιας και της άλλης αλυσίδας δ. μεταγραφή μόνο συγκεκριμένων τμημάτων της μιας αλυσίδας *0. Ο γενετικός κώδικας είναι συνεχής. Αυτό σημαίνει ότι: α. ο κώδικας χρησιμοποιείται από τους οργανισμούς κατά τη διάρκεια της εξέλιξης συνεχώς β. κατά την ανάγνωση των τριπλετών των βάσεων του DNA ενός γονιδίου, καμιά βάση δεν παραλείπεται γ. η μετάφραση του κωδικοποιημένου μηνύματος γίνεται αδιάκοπα σε όλη τη διάρκεια του κύκλου ζωής του κυττάρου δ. μεταξύ του τέλους ενός γονιδίου και της αρχής του επόμενου, δε μεσολαβεί καμία περιοχή που να μη μεταγράφεται

2 *0. Ο γενετικός κώδικας καθορίζει ότι κάθε τριπλέτα βάσεων κωδικοποιεί ένα συγκεκριμένο αμινοξύ (ή σήμα έναρξης ή λήξης). Έτσι, κάθε γονίδιο τελικά κωδικοποιεί τη σύνθεση μιας: α. πρωτεΐνης β. συγκεκριμένης πολυπεπτιδικής αλυσίδας γ. πρωτεΐνης ή ενός μορίου RNA (t ή r) δ. πολυπεπτιδικής αλυσίδας ή ενός μορίου RNA (t ή r) Να απαντήσετε στις παρακάτω ερωτήσεις με μια παράγραφο (20-50 λέξεις): ΟΜΑΔΑ Α 1. Ποιος είναι ο ρόλος της DNA-πολυμεράσης III στην αντιγραφή του DNA; 2. Ποιο είναι το χαρακτηριστικό στη δομή του DNA, που αποτελεί τον παράγοντα- κλειδί για την ικανότητα του να αντιγράφεται; 3. Γιατί είναι απαραίτητο ένα μόριο-μήνυμα, όπως είναι το m-rna, για τη σύνθεση των πρωτεϊνών; 4. Ποιες δραστηριότητες παρατηρούνται κατά τη διάρκεια της μεταγραφής του m-rna; 5. Ποιος είναι ο ρόλος του κωδικονίου και του αντικωδικονίου κατά τη μετάφραση; 6. Ποιος είναι ο ρόλος του t-rna; 7. Γράψτε τρεις διαφορές μεταξύ DNA και RNA. 8. Να γράψετε ένα μόριο m-rna, το οποίο να είναι συμπληρωματικό για την παρακάτω σειρά νουκλεοτιδίων του DNA: ATT, ACG, CGG, TCA, GTA. ΟΜΑΔΑ Β 1. Να συγκρίνετε και να γράψετε τις διαφορετικές λειτουργίες του m-rna, του t-rna και του r- RNA. 2. Να συγκρίνετε τις διαδικασίες της μεταγραφής και της μετάφρασης της γενετικής πληροφορίας. 3. Να περιγράψτε τα βασικά βήματα της πρωτεϊνοσύνθεσης πάνω στο ριβόσωμα. 4. Ένας βιολόγος αναγνωρίζει τη σειρά των νουκλεοτιδίων AAC σ ένα μόριο m-rna. Στο γενετικό κώδικα, η σειρά αυτή κωδικοποιεί το αμινοξύ ασπαραγίνη. Μετά τη μετάφραση, θα εμφανιστεί απαραίτητα η ασπαραγίνη στο πολυπεπτίδιο που θα συντεθεί; Να εξηγήσετε την απάντησή σας. Β. Η χρωματίνη και το χρωμόσωμα - Ο κύκλος της ζωής του κυττάρου - Μίτωση - Μείωση Να συμπληρώσετε με τους κατάλληλους όρους τα κενά στις παρακάτω προτάσεις: 1. Η χρωματίνη είναι μια.. που αποτελείται από DNA, RNA και από πρωτε?νες 2. Τα κύτταρα, που έχουν τα χρωμοσώματά τους σε ζευγάρια, χαρακτηρίζονται ως. 3. Κατά τη διάρκεια της. το κυτταρόπλασμα του μητρικού κυττάρου διαιρείται 2

3 4.. εμφανίζονται κατά τη διάρκεια της πρόφασης του ζωϊκού κυττάρου και καταλαμβάνουν τους δύο πόλους του 5. Η ανταλλαγή τμημάτων μεταξύ ζευγαριών ομολόγων χρωμοσωμάτων, που συμβαίνει κατά τη διάρκεια της μείωσης, λέγεται 6. Η μείωση γίνεται σε μια ειδική κατηγορία διπλοειδών κυττάρων που χαρακτηρίζονται ως κύτταρα 7. Το φαινόμενο της σύναψης πραγματοποιείται κατά. της 1ης μειωτικής διαίρεσης 8. Στους περισσότερους ευκαρυωτικούς οργανισμούς, τα χρωμοσώματα είναι ένας συνδυασμός από 60% περίπου και 40%. Το γενετικό υλικό των βακτηρίων είναι 100% Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι ο κύκλος ζωής του κυττάρου; 2. Τι είναι μεσόφαση; 3. Ποια είναι τα τρία στάδια της μεσόφασης; 4. Τι συμβαίνει κατά τη φάση S της μεσόφασης; 5. Τι είναι αδελφές χρωματίδες; 6. Τι είναι οι ιστόνες; 7. Ποιος είναι ο ρόλος του κεντροσωματίου κατά τη διαίρεση των ζωϊκών κυττάρων; 8. Τι είναι κυτοκίνηση; 9. Τι εξασφαλίζεται με τη μίτωση; 10. Τι είναι φραγμοπλάστης; Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά τη πρόταση. 1. Η γενετική πληροφορία που βρίσκεται κωδικοποιημένη σε δύο ομόλογα χρωμοσώματα: α. είναι εντελώς πανομοιότυπη, αφού αυτά προέρχονται από το διπλα-σιασμό του DNA β. είναι εντελώς διαφορετική, αφού το ένα έχει μητρική και το άλλο πατρική προέλευση γ. αν και ελέγχει τις ίδιες ιδιότητες, δεν τις ελέγχει αναγκαστικά με τρόπο πανομοιότυπο δ. δεν ελέγχει αναγκαστικά τις ίδιες ιδιότητες, αφού αυτό δε θα πρόσφερε κανένα πλεονέκτημα 2. Το παρακάτω σχήμα απεικονίζει ένα ζεύγος ομολόγων χρωμοσωμάτων. Ποια από τις παρακάτω προτάσεις είναι σωστή; α β γ δ α. αδελφές χρωματίδες είναι μεταξύ τους οι α, β και γ,δ. Ομόλογες χρωματίδες είναι μεταξύ τους οι α, γ και β, δ. Χιασματυπία μπορεί να συμβεί μεταξύ των α,γ και β,δ. β. αδελφές χρωματίδες είναι μεταξύ τους οι α, β και γ, δ. Ομόλογες χρωματίδες είναι μεταξύ τους οι αγ, αδ, βγ, βδ. Χιασματυπία μπορεί να συμβεί μεταξύ των αγ και βδ. 3

4 γ. αδελφές χρωματίδες είναι μεταξύ τους οι αγ και βδ. Ομόλογες χρωματίδες είναι μεταξύ τους οι αβ και γδ. Χιασματυπία μπορεί να συμβεί μεταξύ των α,γ και β,δ. δ. αδελφές χρωματίδες είναι μεταξύ τους οι αβ και γδ. Ομόλογες χρωματίδες είναι μεταξύ τους οι αγ, αδ, βγ, βδ. Χιασματυπία μπορεί να συμβεί μεταξύ των αγ,αδ, βγ, και βδ. 3. Ποιο από τα παρακάτω δεν αποτελεί τμήμα ενός χρωμοσώματος κατά την πρόφαση: α. κενρομερίδιο β. κεντροσωμάτιο γ. χρωματίδα δ. DNA 4.Τα σωματικά κύτταρα του ανθρώπου έχουν 46 χρωμοσώματα. Κατά το στάδιο της ανάφασης στη μίτωση, ένα κύτταρο θα έχει: α. 92 χρωμοσώματα β. 46 χρωμοσώματα γ. 23 χρωμοσώματα δ. 44 χρωμοσώματα 4. Τα άωρα γεννητικά κύτταρα παράγονται με: α. χιασματυπία β. μίτωση γ. μείωση δ. γονιμοποίηση 5. Ποια από τις παρακάτω απόψεις είναι σωστή; α. η σύναψη είναι τυχαίο γεγονός, που εξασφαλίζει τον ακριβή υποδιπλασιασμό του γενετικού υλικού β. η σύναψη είναι αναγκαίο γεγονός, που εξασφαλίζει την χιασματυπία γ. η σύναψη και η χιασματυπία είναι ανεξάρτητα γεγονότα, που το ένα είναι επακόλουθο του άλλου δ. η χιασματυπία και η σύναψη είναι δύο αναγκαία γεγονότα, που εξασφαλίζουν τον ακριβή υποδιπλασιασμό του γενετικού υλικού 6. Κατά το στάδιο της μεσόφασης πραγματοποιείται ένα πρόγραμμα διπλασιασμού, τόσο του γενετικού υλικού, όσο και των άλλων στοιχείων του κυττάρου που συμμετέχουν στην αύξηση. Για το λόγο αυτό η μεσόφαση είναι απαραίτητη: α. ανάμεσα σε δύο μιτώσεις β. ανάμεσα στη μείωση Ι και τη μείωση ΙΙ γ. μόνο σε οργανισμούς με έντονη μεταβολική δραστηριότητα δ. σε όλες τις παραπάνω περιπτώσεις 7. Στα κύτταρα που προκύπτουν από τη μείωση Ι: α. όλα τα χρωμοσώματα αντιπροσωπεύονται δύο φορές και αποτελούνται από δυο αδελφές χρωματίδες β. τα μισά μόνο χρωμοσώματα αντιπροσωπεύονται δύο φορές και αποτελούνται από δύο αδελφές χρωματίδες γ. όλα τα χρωμοσώματα αντιπροσωπεύονται μια φορά και αποτελούνται από δυο αδελφές χρωματίδες δ. όλα τα χρωμοσώματα αντιπροσωπεύονται μια φορά και αποτελούνται από ένα νήμα χρωματίνης 4

5 Να απαντήσετε στις παρακάτω ερωτήσεις με μια παράγραφο (20-50 λέξεις). ΟΜΑΔΑ Α 1. Να γράψετε τρεις σκοπούς που εξυπηρετεί η διαδικασία της μίτωσης. 2. Να περιγράψετε την οργάνωση των χρωμοσωμάτων κατά τη διάρκεια της μίτωσης. 3. Ποια κύτταρα του ανθρώπινου οργανισμού είναι διπλοειδή; Ποια είναι απλοειδή; 4. Να περιγράψετε τρία φαινόμενα που παρατηρούνται κατά τη διάρκεια της πρόφασης; 5. Πως γίνεται η απομάκρυνση των αδελφών χρωματίδων από το ισημερινό επίπεδο του κυττάρου; 6. Να εξηγήσετε τα φαινόμενα της σύναψης και της χιασματυπίας. 7. Σε τι διαφέρει η κυτταροπλασματική διαίρεση στα ζώα από τα φυτά; 8. Πώς διαιρούνται τα κύτταρα των βακτηρίων; 9. Να γράψετε τις βασικές διαφορές της πρόφασης Ι της 1ης μειωτικής διαίρεσης, από την πρόφαση της μίτωσης. 10. Να συγκρίνετε την πρόφαση με την τελόφαση. ΟΜΑΔΑ Β 1. Να εξηγήσετε γιατί χρειάζονται δύο διαιρέσεις, προκειμένου να ολοκληρωθεί η μείωση. 2. Να συγκρίνετε το σχηματισμό γαμετών στα ζώα και στα φυτά. 3. Ποια είναι η καλύτερη φάση για να παρατηρήσουμε τα χρωμοσώματα ενός συγκεκριμένου οργανισμού; Να εξηγήσετε την απάντησή σας. 4. Εάν ένα σωματικό κύτταρο έχει 23 ζευγάρια χρωμοσωμάτων, πόσα χρωμοσώματα θα παρατηρήσετε κατά τη διάρκεια της φάσης G 2 ; Πόσες χρωματίδες; Να εξηγήσετε την απάντησή σας. 5. Να γράψετε και να σχολιάσετε τις βασικές διαφορές μεταξύ χρωματίνης, χρωματίδων και χρωμοσωμάτων 6. Ποια είναι η σημασία του φαινομένου της σύναψης για τη χιασματυπία; 7. Να συγκρίνετε τη διαδικασία της μίτωσης και της μείωσης. 5

6 Γ. Μενδελική κληρονομικότητα-οι νόμοι του Μέντελ - Καθορισμός του φύλου Να χρησιμοποιήσετε σωστά τους παρακάτω όρους και να διατυπώσετε, για κάθε όρο, από μια πρόταση που να εκφράζει μια άποψη ή μια ιδέα, από το σχετικό κεφάλαιο που επεξεργαστήκατε. Μονοϋβριδισμός, αλληλόμορφα γονίδια, ομόζυγο άτομο, φυλετικά χρωμοσώματα, συνδεδεμένα γονίδια, συνυπεροχή, γονιδιακός φυλοκαθορισμός Να απαντήσετε στις παρακάτω ερωτήσεις με μια παράγραφο (20-50 λέξεις). ΟΜΑΔΑ Α 1. Ποια είναι η βασική διαφορά μεταξύ του τρόπου που εργάστηκε ο Μέντελ (Mendel) και του τρόπου εργασίας των βιολόγων πριν από αυτόν; 2. Τι ανακάλυψε ο Μέντελ με τα πειράματά του πάνω στα μπιζέλια; 3. Πώς ερμήνευσε ο Μέντελ τα αποτελέσματα των πειραμάτων του; 4. Σε ποιες περιπτώσεις δεν ισχύει ο δεύτερος νόμος του Μέντελ; 5. Ποια είναι η σημασία των αποτελεσμάτων της 1ης θυγατρικής γενιάς στα πειράματα του Μέντελ; 6. Ποια είναι η σημασία των αποτελεσμάτων της 2ης θυγατρικής γενιάς στα πειράματα του Μέντελ; 7. Γιατί τα χρωμοσώματα θεωρούνται «μεταφορείς» της κληρονομικότητας; 8. Πώς προσδιορίζεται το φύλο στους ανθρώπους, στα πουλιά και στις ακρίδες; ΟΜΑΔΑ Β 1. Ένα καφέ ποντίκι διασταυρώνεται με ένα ετερόζυγο μαύρο. Αν από τη διασταύρωση προκύψουν τέσσερις απόγονοι, ποια είναι η πιθανότητα να είναι όλα καφέ; 2. Στη Σουηδία, τα περισσότερα άτομα έχουν γαλάζια μάτια. Αυτό σημαίνει ότι το γονίδιο που ελέγχει το γαλάζιο χρώμα στα μάτια είναι κυρίαρχο στους Σουηδούς; 3. Πώς το περιβάλλον επηρεάζει την έκφραση των γονιδίων; Να γράψετε τρία παραδείγματα. 4. Εάν ένας συγγενής σας ξαφνικά παρουσίαζε μια επικίνδυνη για τη ζωή του ασθένεια, τι ενέργειες θα κάνατε προκειμένου να προσδιορίσετε αν η ασθένεια αυτή είναι κληρονομική ή οφείλεται σε περιβαλλοντικούς παράγοντες; 5. Πώς μπορούμε να προσδιορίσουμε εάν δύο γονίδια είναι συνδεδεμένα; 6. Πολλοί βιολόγοι σήμερα εργάζονται με στόχο την πλήρη χαρτογράφηση του ανθρώπινου γονιδιώματος. Σε ποιες περιπτώσεις αυτή η γνώση θα είναι χρήσιμη; Σε ποιες μπορεί να δημιουργήσει προβλήματα; 7. Πώς εξηγείται ο νόμος του ελεύθερου συνδυασμού του Μέντελ με βάση τη μείωση και τα χρωμοσώματα; 6

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ Τι σχέση έχουν η μονογονική αναπαραγωγή Κυτταρική διαίρεση η ανάπτυξη η αμφιγονική αναπαραγωγή η αντικατάσταση των κυττάρων Η σημασία της μίτωσης Η μίτωση ευνοεί την κυτταρική

Διαβάστε περισσότερα

Κύτταρα πολυκύτταρων οργανισμών

Κύτταρα πολυκύτταρων οργανισμών Μίτωση - Μείωση Τα ευκαρυωτικά κύτταρα διαιρούνται με δύο τρόπους: τη μίτωση και τη μείωση. Η Μίτωση είναι ο τύπος της κυτταρικής διαίρεσης που από ένα πατρικό κύτταρο καταλήγει σε δύο γενετικά πανομοιότυπα

Διαβάστε περισσότερα


Γ ΛΥΚΕΙΟΥ κεφ. 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 Γ ΛΥΚΕΙΟΥ κεφ. 5 ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 O Mendel στο Brno (Τσεχία) Τον αναγνωρίζετε; Το μοναστήρι σήμερα Οι κήποι σήμερα Το μοσχομπίζελο Η επιτυχία των πειραμάτων του Μέντελ 1. χωριστά η

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ ΑΝΑΠΑΡΑΓΩΓΗ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ 2016 2 Το συνώνυμο της αναπαραγωγής είναι ο πολλαπλασιασμός, η δημιουργία νέων ατόμων που έχουν παρόμοια χαρακτηριστικά με τους γονείς τους. Όλοι οι οργανισμοί κάποια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα



Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική)

ΗΜΥ 001 -Υγεία και Τεχνολογία. Σενάρια Ιατρικής Φαντασίας (Γενετική) ΗΜΥ 001 -Υγεία και Τεχνολογία Σενάρια Ιατρικής Φαντασίας (Γενετική) Γενετική ηµιουργήµατα της φύσης συνέπεια στα µορφολογικά χαρακτηριστικά τους αναπαραγωγική διαδικασία οι απόγονοι µοιάζουν σε µικρό ή

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


ΠΑΡΑΤΗΡΗΣΕΙΣ ΓΙΑ ΤΙΣ ΑΣΚΗΣΕΙΣ ΤΟΥ Παρατηρήσεις για την λύση ασκήσεων στο 1 ο κεφάλαιο. 1. Ένα νουκλεϊνικό οξύ είναι δίκλωνο όταν: A=T, (A=U) και G=C. 2. DNA κυττάρου είναι: κυκλικό όταν προέρχεται από προκαρυωτικό κύτταρο, από τα μιτοχόνδρια

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΑΠΟ 18/12/2016 ΕΩΣ 05/01/2017 2η ΕΞΕΤΑΣΤΙΚΗ ΠΕΡΙΟΔΟΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Πέμπτη 5 Ιανουαρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β

Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Κυτταρική Διαίρεση (Μίτωση και Μείωση) Μέρος Β Μοριακή Βιολογία και Γενετική BIOL 123 Άνοιξη 2015 Δρ. Χαρίτα Χρίστου Παρουσιάσεις Power Point με υλικό από: Campbell και Reece (2010) ΒΙΟΛΟΓΙΑ τόμος Ι, 1

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:


Διαβάστε περισσότερα

Χρωμοσώματα & κυτταροδιαιρέσεις

Χρωμοσώματα & κυτταροδιαιρέσεις Δασική Γενετική Χρωμοσώματα & κυτταροδιαιρέσεις Χειμερινό εξάμηνο 2014-2015 Σύνοψη Το DNA αναπαράγεται, εκφράζεται και μεταλλάσσεται Το DNA είναι οργανωμένα σε χρωμοσώματα Τα ευκαρυωτικά γενώματα έχουν

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1) Τμήμα μορίου βακτηριακού DNA έχει την ακόλουθη αλληλουχία βάσεων: 3 TACTGGAATGGTCGCCCCTGCATT 5 a. Ποια είναι η αλληλουχία του συμπληρωματικού κλώνου και ποιος είναι ο προσανατολισμός της. b. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Εργασία Στο Μάθημα Της Βιολογίας. Τάξη: Γ 3 Μαθήτρια: Στίνη Αΐντα Θέμα: Κυτταρική Διαίρεση: Μίτωση

Εργασία Στο Μάθημα Της Βιολογίας. Τάξη: Γ 3 Μαθήτρια: Στίνη Αΐντα Θέμα: Κυτταρική Διαίρεση: Μίτωση Εργασία Στο Μάθημα Της Βιολογίας Τάξη: Γ 3 Μαθήτρια: Στίνη Αΐντα Θέμα: Κυτταρική Διαίρεση: Μίτωση ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ: ΜΙΤΩΣΗ Τι είναι η κυτταρική διαίρεση; Η κυτταρική διαίρεση είναι η διαδικασία κατά

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα