ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:"

Transcript

1 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: Όλες τις πρωτεΐνες τους Όλες τις λειτουργίες τους Τη φωτοσύνθεση Την οξειδωτική φωσφορυλίωση 2. Από τον καρυότυπο ενός ανθρώπου δεν είναι δυνατό να συμπεράνουμε: Τον αριθμό των χρωμοσωμάτων του Τη μορφολογία των χρωμοσωμάτων του Τον αριθμό των αζωτούχων βάσεων Α (αδενίνη) στο DNA του Το φύλο του 3. Η γονιδιακή έκφραση περιλαμβάνει τις διαδικασίες της: Αντιγραφής, μεταγραφής και μετάφρασης Αντιγραφής και μεταγραφής Αντιγραφής και μετάφρασης Μεταγραφής και μετάφρασης Σελίδα 1 από 5

2 4. Το φύλο στους ποντικούς καθορίζεται όπως στον άνθρωπο. Σε σωματικό κύτταρο φυσιολογικού ποντικού στην αρχή της μεσόφασης το πυρηνικό DNA αποτελείται από ζεύγη βάσεων. Στον πυρήνα σπερματοζωαρίου ποντικού υπάρχουν: ζεύγη βάσεων ή λιγότερα από ζεύγη βάσεων 109 ζεύγη βάσεων ζεύγη βάσεων 5. Δίκλωνο κυκλικό DNA δεν είναι δυνατό να υπάρχει σε ένα(ν): Μιτοχόνδριο Χλωροπλάστη Πυρήνα ευκαρυωτικού κυττάρου Ιό ΜΟΝΑΔΕΣ 25 ΘΕΜΑ Β Β1. Να κατατάξετε κατά σειρά αυξανόμενου μεγέθους τα ακόλουθα: 1. Νουκλεοτίδιο 2. Γουανίνη 3. Μεταφασικό χρωμόσωμα 4. Καρυότυπος 5. Αδελφή χρωματίδα 6. Βραχίονας 7. Νουκλεόσωμα ΜΟΝΑΔΕΣ 7 Σελίδα 2 από 5

3 Β2. Να χαρακτηρίστε κάθε μία από τις ακόλουθες προτάσεις ως σωστή (Σ) ή λανθασμένη (Λ). i. Τα μόρια trna μεταφέρουν τη γενετική πληροφορία στα ριβοσώματα. ii. Το ριβόσωμα αποτελείται από RNA και πρωτεΐνες. iii. Το RNA των ιών είναι δυνατό να αυτοδιπλασιάζεται. iv. Κατά την αντίστροφη μεταγραφή συντίθεται RNA. v. Η μετάφραση χρησιμοποιεί τη γενετική πληροφορία για τη σύνθεση ενός νουκλεϊκού οξέος. vi. Η μεταγραφή καθορίζει ποια γονίδια θα εκφραστούν σε κάθε κύτταρο. ΜΟΝΑΔΕΣ 6 Β3. Να γράψετε τον ορισμό του γονιδίου και τις κατηγορίες των γονιδίων. ΜΟΝΑΔΕΣ 6 (2+4) Β4. Να γράψετε ποιες οδηγίες είναι αποθηκευμένες στο DNA των διαφόρων οργανισμών. ΜΟΝΑΔΕΣ 6 ΘΕΜΑ Γ Γ1. Στο σχήμα απεικονίζεται τμήμα DNA που αποτελείται από μη ραδιενεργά νουκλεοτίδια. 5 GAGAAGATGGAGCTCTTACGCT 3 3 CTCTTCTACCTCGAGAATGCGA 5 Το τμήμα μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια Α και C και μη ραδιενεργά νουκλεοτίδια G και Τ, όπου και αντιγράφεται 2 φορές. i. ii. iii. Πόσα ραδιενεργά νουκλεοτίδια Α θα υπάρχουν σε κάθε ένα νέο μόριο μετά την πρώτη αντιγραφή; Πόσα ραδιενεργά νουκλεοτίδια C και πόσα μη ραδιενεργά νουκλεοτίδια G θα υπάρχουν σε κάθε νέο μόριο μετά τη δεύτερη αντιγραφή; Να αιτιολογήσετε τις απαντήσεις σας. ΜΟΝΑΔΕΣ 12 (4+4+4) Σελίδα 3 από 5

4 Γ2. Να συμπληρώσετε τον ακόλουθο πίνακα για το πυρηνικό DNA των κυττάρων του ανθρώπου. Μόρια Συνολικό μήκος Κύτταρο Ζεύγη βάσεων Χρωμοσώματα Χρωματίδες DNA DNA σε m Σωματικό αρχή μεσόφασης Σωματικό στη μετάφαση Γαμέτης ΜΟΝΑΔΕΣ 8 Γ3. Να εξηγήσετε τους λόγους για τους οποίους τα αγόρια κληρονομούν περισσότερο γενετικό υλικό από τη μητέρα συγκριτικά με τον πατέρα. ΜΟΝΑΔΕΣ 5 ΘΕΜΑ Δ Η αλληλουχία αποτελεί μισή θηλιά αντιγραφής και τα βέλη υποδεικνύουν τη θέση έναρξης αντιγραφής (Θ.Ε.). Θ.Ε. (Ι) 5 ATTCCCATGTACGGGAAATGAACTGATC 3 (ΙΙ) 3 TAAGGGTACATGCCCTTTACTTGACTAG 5 Θ.Ε. Δ1. Ποια αλυσίδα (Ι ή ΙΙ) αντιγράφεται με τρόπο συνεχή; Να αιτιολογήσετε την απάντησή σας. ΜΟΝΑΔΕΣ 8 (2+6) Δ2. Να εξηγήσετε τι είναι το πρωταρχικό τμήμα και για ποιο λόγο δημιουργείται. Σελίδα 4 από 5

5 Δ3. Δεδομένου ότι το πρωταρχικό τμήμα αποτελείται από 5 νουκλεοτίδια, να γράψετε την αλληλουχία βάσεων του πρωταρχικού τμήματος που συντίθεται στη θέση έναρξης αντιγραφής της αλληλουχίας αυτής. ΜΟΝΑΔΕΣ 5 Δ4. Να εξηγήσετε τον ρόλο της DNA δεσμάσης στην αντιγραφή του DNA. Δ5. Ποιοι μηχανισμοί εξασφαλίζουν την ακρίβεια με την οποία γίνεται η αντιγραφή του DNA; ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ!!! Σελίδα 5 από 5

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΜΑΘΗΜΑ / ΣΑΞΗ : ΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΜΑΣΟ: ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΣΙΚΩΝ ΠΟΤΔΩΝ ΘΕΜΑ 1 Ο 1. Η γενετική πληροφορία μεταφέρεται στα ριβοσώματα με α. RNA β. DNA γ. πρωτεΐνες δ. λιπίδια 2. Κατά την σύνθεση

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΛΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση:

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Να σημειώσετε το γράμμα που συμπληρώνει κατάλληλα τη φράση: Α1. Ο Griffith απέδειξε: Α. ότι

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ. 3. Τι γενετικές πληροφορίες μπορεί να φέρει ένα πλασμίδιο;

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ. 3. Τι γενετικές πληροφορίες μπορεί να φέρει ένα πλασμίδιο; ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΕΝΟΤΗΤΑ 1.4. Οργάνωση του γενετικού υλικού προκαρυωτικών και ευκαρυωτικών κυττάρων. 1. Ποια είναι η μορφή του DNA των προκαρυωτικών κυττάρων και ποιο είναι το μήκος τους; 2. Ποια είναι

Διαβάστε περισσότερα

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017

ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΑΡΧΗ lησ ΣΕΛΙΔΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΘΕΜΑ Α ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6)

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6) ΑΡΧΗ lησ ΣΕΛΙΔΑΣ Γ' ΗΜΕΡΉΣΙΩΝ & Δ' ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη Ριζηνίας 69 & Λασαίας 21 τηλ.2810313170 www.kmathisi.com ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:..

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. α. Το

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Το

Διαβάστε περισσότερα