Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4"

Transcript

1 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να σχεδιάσετε ένα μιτοχόνδριο επισημαίνοντας με σχετικές ενδείξεις 4 χαρακτηριστικά της κατασκευής του. (3μ+4μ) β) Σε ποιο από τα χαρακτηριστικά που επισημάνατε στο α. ερώτημα υπάρχει ο απαραίτητος εξοπλισμός, ώστε το μιτοχόνδριο να έχει σχετική γενετική αυτοδυναμία; Ποια χημικά μόρια και ποιες δομές που συμπεριλαμβάνονται στον εξοπλισμό αυτόν, επιτρέπουν την σχετική γενετική αυτοδυναμία του μιτοχονδρίου; (4μ) γ) Για ποιες βιολογικές διαδικασίες είναι ικανό τα μιτοχόνδριο, χάρη στη σχετική γενετική αυτοδυναμία του; (2μ) ΓΗ_Β_ΒΙΟ_0_14370 Β9 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΙΙ. Μερικά από τα οργανίδια του ευκαρυωτικού κυττάρου έχουν διπλή στοιχειώδη μεμβράνη. Να απαντήσετε στις ερωτήσεις: α) Να ονομάσετε δύο οργανίδια του ευκαρυωτικού κυττάρου που έχουν διπλή στοιχειώδη μεμβράνη (εξαιρουμένου του πυρήνα). Ποιο/α από αυτό/α υπάρχει/ουν και στα φυτικά και στα ζωικά κύτταρα, ποιο υπάρχει αποκλειστικά στα φυτικά; (6μ) β) Τα οργανίδια που αναφέρατε στο α. ερώτημα είναι ικανά να παράγουν μερικές από τις πρωτεΐνες που συμμετέχουν στη λειτουργία τους. Να αναφέρετε το σύνολο του εξοπλισμού που τα κάνει ικανά να παράγουν τις πρωτεΐνες αυτές. Ποιο άλλο χαρακτηριστικό των οργανιδίων αυτών οφείλεται στο εξοπλισμό που αναφέρατε; (7μ) ΓΗ_Β_ΒΙΟ_0_14386 Β18 (ΚΕΦ. 1, 4) ΘΕΜΑ Β: ΙΙ. Το μόριο του DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες και διατάσσεται στο χώρο, σύμφωνα με το μοντέλο της διπλής έλικας. α) Πώς συγκρατούνται μεταξύ τους οι δύο κλώνοι του DNA; (2μ) β) Ποια είναι η σημασία της συμπληρωματικότητας των βάσεων για το βιολογικό ρόλο του μορίου του DNA; (5μ) γ) Σε ποια οργανίδια του ευκαρυωτικού κυττάρου βρίσκεται το μόριο του DNA; (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 1

2 ΓΗ_Β_ΒΙΟ_0_14420 Β23 (ΚΕΦ. 1, 2, 4) ΘΕΜΑ Δ: Σε ένα πείραμα χορηγήθηκε ραδιενεργός ουρακίλη, προκειμένου να ανιχνευθούν τα μακρομόρια στα οποία ενσωματώνεται καθώς και οι περιοχές του κυττάρου στις οποίες εντοπίζονται τα μακρομόρια. Να απαντήσετε στις ερωτήσεις: I. Σε ποια κατηγορία μακρομορίων θα εντοπιστεί η ραδιενεργός ουρακίλη και σε ποια ιδιαίτερα είδη του; Σε ποιες από τις ακόλουθες κυτταρικές δομές, οργανίδια και τμήματα του κυττάρου: Κυτταρική μεμβράνη Υπεροξειδιοσώματα Πυρηνίσκος Κυτταρόπλασμα Μιτοχόνδρια είναι αναμενόμενο να εντοπιστεί η ραδιενεργός ουρακίλη, ενταγμένη στην κατηγορία των μακρομορίων που αναφέρατε στο προηγούμενο υποερώτημα; Να αιτιολογήσετε τις απαντήσεις σας. (12μ) II. Το μακρομόριο στο οποίο ενσωματώνεται η ουρακίλη, συνήθως παρουσιάζεται ως ένα μη αναδιπλωμένο στο χώρο, μόριο. Ωστόσο σε μερικές περιπτώσεις το μόριο αναδιπλώνεται στο χώρο. Ποιοι χημικοί δεσμοί ευθύνονται γι αυτό; Μεταξύ ποιων χημικών ομάδων αναπτύσσονται; Ένα τέτοιο μόριο με ποιες κυτταρικές δομές συνεργάζεται; Που εντοπίζονται οι δομές αυτές σε ένα φυτικό κύτταρο και ποιος είναι ο βιολογικός ρόλος τους; (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 2

3 ΘΕΜΑ Β: ΓΗ_Β_ΒΙΟ_0_14421 Β24 (ΚΕΦ. 1, 4) Ι. Σε μερικά από τα μακρομόρια συναντώνται δεσμοί υδρογόνου. Να απαντήσετε στις ερωτήσεις: α) Να αναφέρετε δύο κατηγορίες μακρομορίων στις οποίες αναπτύσσονται δεσμοί υδρογόνου. Μεταξύ ποιων χημικών ομάδων των μορίων αυτών αναπτύσσονται οι δεσμοί υδρογόνου; (4μ) β) Ποια είναι η βιολογική σημασία των δεσμών υδρογόνου στα μακρομόρια που αναφέρατε στο προηγούμενο ερώτημα; (4μ) γ) Σε δύο τουλάχιστον από τα στάδια της ροής της Γενετικής πληροφορίας που αποδίδεται με το Κεντρικό Δόγμα της Βιολογίας σπάνε δεσμοί υδρογόνου. Να ονομάσετε το ένα από τα στάδια αυτά και να εξηγήσετε γιατί είναι αναγκαίο το σπάσιμο των δεσμών υδρογόνου προκειμένου να ολοκληρωθεί η διαδικασία που συμβαίνει κατά τη διάρκειά του. (4μ) ΘΕΜΑ Δ: Μια από τις κύριες διαφορές μεταξύ DNA και RNA είναι ότι το RNA είναι συνήθως μονόκλωνο, αντίθετα από το DNA, το οποίο στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς είναι πάντα δίκλωνο. Να απαντήσετε στις ερωτήσεις: Ι. α) Πώς ονομάζεται το μακρομόριο που εικονίζεται στο σχήμα; Να ονομάσετε ένα οργανίδιο του ζωικού κυττάρου στο οποίο εντοπίζεται αυτό το μακρομόριο. (4μ) β) Να εξηγήσετε τι συμβαίνει μεταξύ ορισμένων μονομερών του μακρομορίου, ώστε αυτό να αποκτά τη διαμόρφωση με την οποία παρουσιάζεται στην εικόνα.(4μ) γ) Αν το μόριο υδρολυθεί ποιο είναι το είδος των μονομερών που θα προκύψουν; Από ποιες επιμέρους χημικές ομάδες αποτελείται το καθένα από τα μονομερή αυτά; (4μ) ΙΙ. α) Σε ποια βασική διαδικασία του Κεντρικού Δόγματος της Βιολογίας παίζει σημαντικό ρόλο το εικονιζόμενο μόριο; Ποιος ακριβώς είναι ο ρόλος αυτός; (5μ) β) Το εικονιζόμενο μόριο στο πλαίσιο της διαδικασίας που αναφέρατε στο προηγούμενο ερώτημα, συνδέεται παροδικά με μια αλληλουχία ενός άλλου μορίου, η οποία ονομάζεται κωδικόνιο. Πώς ονομάζεται το μόριο στο οποίο υπάρχει το κωδικόνιο; Ποια είναι η αλληλουχία των βάσεων του κωδικονίου που συνδέεται με το εικονιζόμενο μόριο; Να αιτιολογήσετε την απάντησή σας. (8μ) ΓΗ_Β_ΒΙΟ_0_14425 Β28 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: Ι. Το ριβόσωμα αποτελεί μια βασική κυτταρική δομή, στην οποία γίνεται η παραγωγή των πρωτεϊνών. Να απαντήσετε στις ακόλουθες ερωτήσεις: α) Ποια μακρομόρια συνιστούν το ριβόσωμα;(4μ) β) Σε ποια μέρη ενός ευκαρυωτικού κυττάρου συναντάμε ριβοσώματα; (4μ) γ) Είναι δυνατό πολλά ριβοσώματα να συνδέονται ταυτόχρονα με το ίδιο μόριο mrna. Σε τι αποσκοπεί αυτή η δυνατότητα; (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 3

4 ΓΗ_Β_ΒΙΟ_0_14426 Β29 (ΚΕΦ. 1, 3, 4) ΘΕΜΑ Β: Ι. Σε ένα ανθρώπινο κύτταρο, μεταξύ άλλων υπάρχουν τα μόρια που αναγράφονται στον πίνακα: RNA DNA mrna ΑΤΡ rrna χοληστερόλη trna Καταλάση πολυμεράση Νουκλεοτίδια Αμινοξέα Να τοποθετήσετε το σύμβολο + σε όποια σειρά υπάρχει αντιστοιχία ανάμεσα στο είδος του μονομερούς της κατακόρυφης στήλης και στα μακρομόρια της οριζόντιας σειράς. (12μ) ΙΙ. Να επιλέξετε τέσσερα από τα μόρια του πίνακα και να περιγράψετε συνοπτικά το ρόλο που παίζουν μέσα στο κύτταρο. (13μ) ΓΗ_Β_ΒΙΟ_0_14427 Β30 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: Ι. Σε ένα φυτικό κύτταρο, μεταξύ άλλων, υπάρχουν τα μόρια: DNA, mrna, ΑΤΡ, πρωτεΐνες, rrna, λιπίδια, trna, κυτταρίνη. α) Ποια από τα παραπάνω μόρια παράγονται με τη διαδικασία της μεταγραφής; Να αιτιολογήσετε την απάντησή σας. (6μ) β) Σε ποια κυτταρικά οργανίδια ενός φωτοσυνθετικού φυτικού κυττάρου συντίθεται το mrna; Να αιτιολογήσετε την απάντησή σας. (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 4

5 ΓΗ_Β_ΒΙΟ_0_14432 Β34 (ΚΕΦ. 1, 4) ΘΕΜΑ Β: ΙΙ. Το μόριο του DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες, τους κλώνους, που σχηματίζουν διπλή έλικα. α) Πώς συγκρατούνται μεταξύ τους οι δύο κλώνοι του DNA; (2μ) β) Ποια είναι η σημασία της συμπληρωματικότητας των βάσεων στο DNA; (5μ) γ) Ποιος είναι ο βιολογικός ρόλος του DNA; Πώς το DNA είναι ικανό να ελέγχει κάθε κυτταρική δραστηριότητα, χωρίς ποτέ, στο μη διαιρούμενο κύτταρο, να εγκαταλείπει τον πυρήνα; (6μ) ΘΕΜΑ Δ: Στον πίνακα παρουσιάζεται ο αριθμός των αζωτούχων βάσεων που έχουν βρεθεί σε 4 δείγματα νουκλεϊκών οξέων. Λαμβάνοντας υπόψη ότι εκτός του δίκλωνου DNA υπάρχει και μονόκλωνο, όπως και ότι εκτός του μονόκλωνου RNA, υπάρχει και δίκλωνο: Βάσεις 1ο δείγμα 2ο δείγμα 3ο δείγμα 4ο δείγμα T G A C U Ι. Να προσδιορίσετε το είδος του νουκλεϊκού οξέος που υπάρχει σε κάθε δείγμα, αιτιολογώντας την απάντησή σας. Από πόσους κλώνους, πιθανότατα, αποτελείται το νουκλεϊκό οξύ κάθε δείγματος; (12μ) ΙΙ. Σε ποιες περιοχές του κυττάρου μπορεί να βρίσκεται το είδος του νουκλεϊκού οξέος του 2ου δείγματος, σε ποιες περιοχές του κυττάρου μπορεί να βρίσκεται το είδος του νουκλεϊκού οξέος του 3ου δείγματος; (13μ) ΓΗ_Β_ΒΙΟ_0_14435 Β37 (ΚΕΦ. 2, 4) ΘΕΜΑ Δ: Mια πρωτεΐνη μήκους 90 αμινοξέων, αφού συντέθηκε, εισήλθε στους αγωγούς του Αδρού Ενδοπλασματικού Δικτύου και μετά εξάχθηκε από το κύτταρο. Να απαντήσετε στις ερωτήσεις: Ι. Από τους απειράριθμους συνδυασμούς των 20 αμινοξέων από τα οποία συντίθεται μια πρωτεΐνη 90 αμινοξέων, πώς το κύτταρο «γνωρίζει» με ποιον ακριβώς συνδυασμό αμινοξέων θα συνθέσει αυτή την πρωτεΐνη; (12μ) ΙΙ. Να προτείνετε και να περιγράψετε έναν τρόπο μεταφοράς της πρωτεΐνης αυτής έξω από το κύτταρο, ο οποίος να χρειάζεται ενέργεια και στον οποίο η ίδια η πρωτεΐνη, να μην έρχεται σε επαφή με τα φωσφολιπίδια της πλασματικής μεμβράνης. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 5

6 ΓΗ_Β_ΒΙΟ_0_14437 Β39 (ΚΕΦ. 1, 4) ΘΕΜΑ Β: ΙΙ. Το DNA αποτελεί το γενετικό υλικό των οργανισμών. α) Να ονομάσετε τα είδη των χημικών στοιχείων που μετέχουν στην χημική σύσταση του μορίου του DNA. (4μ) β) Από ποιες επιμέρους χημικές ομάδες αποτελούνται τα μονομερή του DNA; (3μ) γ) Να ονομάσετε 3 περιοχές ενός φυτικού κυττάρου που βρίσκεται στη μεσόφαση, στις οποίες υπάρχει DNA. (6μ) ΓΗ_Β_ΒΙΟ_0_16214 Β47 ΘΕΜΑ Β: ΙΙ. Να προτείνετε έναν τουλάχιστον ρόλο που έχει καθένα από τα ακόλουθα μόρια νουκλεϊκών οξέων: DNA mrna rrna trna προκείμενου να συντεθεί μια πρωτεΐνη. (13μ) ΓΗ_Β_ΒΙΟ_0_16215 Β48 (ΚΕΦ. 1, 2, 4) ΘΕΜΑ Β: ΙΙ. Τα ριβοσώματα αποτελούν τις κυτταρικές δομές στις οποίες γίνεται η σύνθεση των πολυπεπτιδικών αλυσίδων. Να απαντήσετε στις ερωτήσεις: α) Από ποιες χημικές ενώσεις αποτελούνται τα ριβοσώματα; Σε ποια κυτταρική δομή παράγεται κάθε μια από αυτές; (4μ) β) Πού υπάρχουν ριβοσώματα στο ευκαρυωτικό κύτταρο; (6μ) γ) Οι πολυπεπτιδικές αλυσίδες που παράγονται από τα ριβοσώματα συχνά χρειάζεται να υποστούν επιμέρους τροποποιήσεις, προκειμένου να γίνουν λειτουργικές πρωτεΐνες. Να παραθέσετε ένα τέτοιο παράδειγμα τροποποίησης και να ονομάσετε τα οργανίδια του κυττάρου που συμμετέχουν σε αυτές. (3μ) Πιτσιλαδής Βασίλης - Βιολόγος 6

7 ΓΗ_Β_ΒΙΟ_0_ Β52 ΘΕΜΑ Β: Ι. Μεταξύ της μίτωσης και της μείωσης υπάρχουν πολλές ομοιότητες, αλλά και αρκετές διαφορές που αφορούν την συμπεριφορά των χρωμοσωμάτων, αλλά και τον αριθμό τους στα τελικά προϊόντα κάθε είδους διαίρεσης. Να απαντήσετε στις ερωτήσεις: α) Πόσα χρωμοσώματα περιέχει ένα σωματικό κύτταρο του ανθρώπου, και πόσα χρωμοσώματα περιέχει ένα ανθρώπινο κύτταρο που είναι γαμέτης; (4μ) β) Τι είναι το φαινόμενο της σύναψης, σε ποια κυτταρική διαίρεση, και σε ποιο στάδιό της συμβαίνει; (4μ) γ) Κατά τη διάρκεια της μίτωσης οι αδελφές χρωματίδες διαχωρίζονται και κατευθύνονται προς τους αντίθετους πόλους του κυττάρου. Γιατί δεν συμβαίνει το αντίστοιχο κατά την 1η μειωτική διαίρεση; (4μ) ΙΙ. Το μόριο του RNA συναντάται στους ευκαρυωτικούς οργανισμούς, με διαφορετικούς τύπους. Να απαντήσετε στις ερωτήσεις: α) Σε ποιες κυτταρικές δομές ενός φυτικού κυττάρου γίνεται σύνθεση του RNA; (6μ) β) Ποιοι είναι οι διαφορετικοί τύποι του RNA; Ποιος είναι ο βιολογικός ρόλος καθενός από αυτούς; (7μ) ΘΕΜΑ Δ: Ι. Δίνεται ο κλώνος του DNA: CAGTATGCCCTGGATGTTTAAATAGCCAG Να απαντήσετε στις ερωτήσεις: α) Αν ο κλώνος αυτός χρησιμοποιηθεί ως πρότυπο για να παραχθεί ένας θυγατρικός, ποια θα είναι η αλληλουχία του θυγατρικού κλώνου που θα προκύψει; Να αιτιολογήσετε την απάντησή σας. (3μ) β) Αν ο θυγατρικός κλώνος του ερωτήματος που προέκυψε στο ερώτημα α) μεταγραφεί ώστε να παραχθεί ένα μόριο mrna ποια θα είναι η αλληλουχία των νουκλεοτιδίων του mrna που θα προκύψει; Να αιτιολογήσετε την απάντησή σας.(3μ) γ) Το μόριο του mrna που προέκυψε χρησιμοποιήθηκε ως πρότυπο για τη σύνθεση ενός ολιγοπεπτιδίου. Να βρείτε την αλληλουχία των αμινοξέων στο ολιγοπεπτίδιο, συμβουλευόμενοι το απόσπασμα του Γενετικού Κώδικα. (6μ) UUU ΑΑΑ UGG CCC Φαινυλαλανίνη Λυσίνη Τρυπτοφάνη Προλίνη ΙΙ. Ένα κύτταρο που υφίσταται μείωση έχει 3 ζευγάρια ομόλογων χρωμοσωμάτων, τα (Α,α), (Β,β) και (Γ,γ) όπου τα κεφαλαία γράμματα αντιπροσωπεύουν χρωμοσώματα πατρικής προέλευσης και τα μικρά, χρωμοσώματα μητρικής προέλευσης. Να απαντήσετε στις ερωτήσεις: α) Πόσοι είναι οι πιθανοί συνδυασμοί χρωμοσωμάτων που μπορούν να προκύψουν στους γαμέτες που θα παραχθούν, και ποιοι είναι οι συνδυασμοί αυτοί; Να αιτιολογήσετε την απάντησή σας. (5μ) β) Πόσοι από τους συνδυασμούς αυτούς περιέχουν μόνο πατρικά, μόνο μητρικά ή μείγμα πατρικών και μητρικών χρωμοσωμάτων; Να αιτιολογήσετε την απάντησή σας.(5μ) γ) Έστω ότι η μειωτική διαίρεση στο κύτταρο γίνεται λανθασμένα και προκύπτει ένας γαμέτης με ένα (1) περισσότερο χρωμόσωμα από το κανονικό. Ο γαμέτης αυτός γονιμοποιείται από έναν άλλο γαμέτη, που έχει κανονικό αριθμό χρωμοσωμάτων. Ποιος θα είναι ο αριθμός των χρωμοσωμάτων στο ζυγωτό που θα προκύψει; Να αιτιολογήσετε την απάντησή σας. (3μ) Πιτσιλαδής Βασίλης - Βιολόγος 7

8 ΓΗ_Β_ΒΙΟ_0_ Β53 Ι. Tα χρωμοσώματα στα σωματικά κύτταρα των διπλοειδών οργανισμών εμφανίζονται σε ζευγάρια. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζονται τα μέλη του ίδιου ζευγαριού χρωμοσωμάτων; (2μ) β) Ποιες είναι οι ομοιότητες των μελών του ίδιου ζευγαριού χρωμοσωμάτων; (5μ) γ) Πώς διατάσσονται τα μέλη των ζευγαριών των χρωμοσωμάτων κατά τη μετάφαση της μίτωσης και κατά τη μετάφαση της 1 ης μειωτικής διαίρεσης; (5μ) II. Πολλές πρωτεΐνες αποκτούν τη λειτουργική μορφή τους μετά το τέλος της μετάφρασης, ενώ άλλες απαιτούν τη μεταγραφή και τη μετάφραση, περισσοτέρων του ενός γονιδίων, προκειμένου να παραχθούν. α) Να εξηγήσετε γιατί για την παραγωγή μερικών πρωτεϊνών απαιτείται η μεταγραφή και η μετάφραση περισσότερων του ενός γονιδίων και να αναφέρετε ένα συγκεκριμένο σχετικό παράδειγμα. (7μ) β) Να αναφέρετε τροποποιήσεις που υφίστανται μετά την παραγωγή τους οι πρωτεΐνες και να προσδιορίσετε σε ποια τμήματα του ευκαρυωτικού κυττάρου συμβαίνουν. (6μ) Ι. Στο ακόλουθο σχήμα εικονίζονται ευκαρυωτικά κύτταρα του ίδιου οργανισμού σε κάποιο στάδιο, μιας από τις κυτταρικές διαιρέσεις. Με βάση τις πληροφορίες που σας δίνει το σχήμα, να απαντήσετε στις ερωτήσεις: α) Ποιος είναι ο διπλοειδής αριθμός χρωμοσωμάτων του είδους του οργανισμού στον οποίο ανήκουν τα εικονιζόμενα κύτταρα; Να αιτιολογηθεί η απάντησή σας. (3μ) β) Σε ποια φάση της μίτωσης ή/και της μείωσης βρίσκεται καθένα από τα κύτταρα Α, Β, Γ, Δ; Να αιτιολογηθούν οι απαντήσεις σας.(9μ) ΙΙ. Αν γνωρίζουμε την αλληλουχία των νουκλεοτιδίων ενός γονιδίου που είναι υπεύθυνο για την σύνθεση ενός πολυπεπτιδίου, μπορούμε να γνωρίζουμε την αλληλουχία των αμινοξέων του πολυπεπτιδίου. Αντίθετα αν γνωρίζουμε την αλληλουχία των αμινοξέων ενός πολυπεπτιδίου δεν μπορούμε να είμαστε βέβαιοι για την αλληλουχία των νουκλεοτιδίων του γονιδίου που είναι υπεύθυνο για την παραγωγή του πολυπεπτιδίου αυτού. Για ποιο λόγο συμβαίνει αυτό; (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 8

9 ΓΗ_Β_ΒΙΟ_0_ Β54 Ι. Στην εικόνα παρουσιάζεται μια από τις μορφές με τις οποίες γίνεται αντιληπτή η χρωματίνη, κατά τη διάρκεια της μετάφασης της μίτωσης. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται η εικονιζόμενη δομή; (2μ) β) Πώς ονομάζoνται τα τμήματά της που επισημαίνονται με τα γράμματα Α και Β; (5μ) γ) Αν στη θέση 1 υπάρχει το αλληλόμορφο Α, στη θέση 2 ποιο αλληλόμορφο θα υπάρχει; Να αιτιολογηθεί η απάντησή σας. (5μ) Ι. Μια πρωτεΐνη έχει σχετική μοριακή μάζα Αν η μέση μοριακή μάζα των ομάδων των αμινοξέων που μετέχουν στο μόριό της είναι 100 να απαντήσετε στις ερωτήσεις: α) Από πόσα νουκλεοτίδια αποτελείται το δίκλωνο μόριο DNA που την κωδικοποιεί, αν συμπεριλάβετε και τα νουκλεοτίδια του που δεν μεταφράζονται; (8μ) β) Αν στο μόριο του DNA που την κωδικοποιεί υπάρχουν 50 Α, ποιος είναι ο αριθμός των υπολοίπων αζωτούχων βάσεών του; (4μ) II. Στο διάγραμμα εικονίζονται στιγμιότυπα από τη μειωτική διαίρεση ενός κυττάρου. Με βάση τις πληροφορίες και τη διάταξη των χρωμοσωμάτων στο κύτταρο 3 να σχεδιάσετε τα χρωμοσώματα που υπάρχουν στα κύτταρα 1, 2, 4, 5, 6, 7, λαμβάνοντας υπόψη ότι το αρχικό κύτταρο περιλαμβάνει χρωμοσώματα πατρικής προέλευσης (επισημαίνονται με μαύρο χρώμα) και χρωμοσώματα μητρικής προέλευσης (επισημαίνονται με λευκό χρώμα). Να εξηγήσετε τους λόγους για τους οποίους επιλέξατε τη διάταξη που σχεδιάσατε στα κύτταρα 1, 2, 5 και 7. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 9

10 ΓΗ_Β_ΒΙΟ_0_ Β55 Ι. Επειδή το στάδιο της κυτταρικής διαίρεσης, είναι περισσότερο κινητικό συγκρινόμενο με τη μεσόφαση, κατά το παρελθόν, η μεσόφαση θεωρείτο ως αδρανές στάδιο στον κύκλο της ζωής του κυττάρου. Να απαντήσετε στις ερωτήσεις: α) Γιατί στην πραγματικότητα η μεσόφαση δεν είναι ένα αδρανές στάδιο, αλλά ένα στάδιο έντονης κυτταρικής δραστηριότητας; (6μ) β) Να αναφέρετε και να περιγράψετε δύο φαινόμενα κίνησης κατά την κυτταρική διαίρεση, ένα που αφορά στα χρωμοσώματα και ένα που αφορά στο κυτταρόπλασμα. Να εξηγήσετε τη σημασία των κινήσεων αυτών για τη διαίρεση του κυττάρου. (6μ) ΙΙ. Το DNA καθορίζει, με τον ένα ή τον άλλο τρόπο, τα δομικά και λειτουργικά γνωρίσματα των κυττάρων και κατ επέκταση των οργανισμών. Χρησιμοποιώντας τις γνώσεις σας από το Κεντρικό Δόγμα της Βιολογίας και τη βιολογική σημασία των πρωτεϊνών, να εξηγήσετε συνοπτικά: α) Τη σχέση των πρωτεϊνών με τα δομικά και λειτουργικά των κυττάρων (6μ) και β) Το πώς τελικά το DNA κατευθύνει την παραγωγή των πρωτεϊνών. (7μ) Ι. Στο σχήμα παρουσιάζεται ένα ζευγάρι ομόλογων χρωμοσωμάτων κατά τη διάρκεια μιας φάσης της μειωτικής διαίρεσης. Αντλώντας από τις πληροφορίες που σας παρέχει το σχήμα να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται το εικονιζόμενο φαινόμενο; Σε ποια φάση της μειωτικής διαίρεσης συμβαίνει; (4μ) β) Ποια είναι τα διαφορετικά είδη γαμετών που θα προκύψουν από την ολοκλήρωση της μείωσης, σύμφωνα με το σχήμα; Ποια από αυτά θα έχουν τον αρχικό συνδυασμό αλληλομόρφων, ποια, το νέο συνδυασμό αλληλομόρφων εξαιτίας του εικονιζόμενου φαινομένου; (8μ) ΙΙ. Στο σχήμα παρουσιάζεται ένα μικρό μόριο DNA που πρόκειται να αντιγραφεί σε ένα περιβάλλον στο οποίο υπάρχει επαρκής αριθμός ραδιενεργά επισημασμένων νουκλεοτιδίων (Α, Τ, G, C ). Το μόριο υφίσταται δύο συνεχείς αυτοδιπλασιασμούς. Να απαντήσετε στις ερωτήσεις: α) Μετά τον δεύτερο αυτοδιπλασιασμό, τι ποσοστό των θυγατρικών μορίων θα έχει μόνο ραδιενεργά νουκλεοτίδια; (3μ) β) Μετά τον δεύτερο αυτοδιπλασιασμό, τι ποσοστό των θυγατρικών μορίων θα έχει μόνο μη ραδιενεργά νουκλεοτίδια (A, T, G, C); (3μ) γ) Μετά τον δεύτερο αυτοδιπλασιασμό, τι ποσοστό των θυγατρικών μορίων θα αποτελείται από μείγμα ραδιενεργών και μη ραδιενεργών νουκλεοτιδίων; (3μ) δ) Είναι πιθανό, μετά τον δεύτερο αυτοδιπλασιασμό να προκύψει μια μονόκλωνη αλυσίδα του DNA που να έχει και ραδιενεργά και μη ραδιενεργά νουκλεοτίδια; Να αιτιολογηθεί η απάντησή σας. (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 10

11 ΓΗ_Β_ΒΙΟ_0_ Β56 Ι. Σε ένα γονίδιο που κωδικοποιεί την παραγωγή ενός πολυπεπτιδίου, υπάρχει τουλάχιστον μια αλληλουχία νουκλεοτιδίων που ενώ μεταγράφεται δεν μεταφράζεται. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται η αλληλουχία αυτή; Ποια είναι η σημασία της στη διαδικασία της μετάφρασης; (3μ) β) Να γράψετε όλους τους συνδυασμούς νουκλεοτιδίων που μπορεί να περιλαμβάνει μια τέτοια αλληλουχία, χρησιμοποιώντας ως σύμβολα, τα νουκλεοτίδια του RNA στα οποία μεταγράφεται. (3μ) γ) Αν σε ένα κύτταρο συμβεί μια γονιδιακή μετάλλαξη αντικατάστασης στην αλληλουχία αυτή, ποια μπορεί να είναι η συνέπεια στον αριθμό των αμινοξέων που κωδικοποιεί το γονίδιο. Να αιτιολογηθεί η απάντησή σας. (6μ) ΙΙ. Αφού η γενετική πληροφορία είναι καταγραμμένη στο DNA των ευκαρυωτικών κυττάρων, γιατί χρειάζεται το DNA να μεταγραφεί σε mrna, προκειμένου να συντεθούν οι πρωτεΐνες; (13μ) Ι. Στο διπλανό σχήμα, εικονίζεται ο καρυότυπος ενός υποθετικού είδους που παράγεται αμφιγονικά. Με βάση τις πληροφορίες που σας παρέχει το σχήμα, να απαντήσετε στις ερωτήσεις: α) Ποιος είναι ο απλοειδής και ποιος ο διπλοειδής αριθμός χρωμοσωμάτων του συγκεκριμένου είδους; (3μ) β) Πόσες αδελφές χρωματίδες και πόσα μόρια DNA υπάρχουν στον εικονιζόμενο καρυότυπο; (4μ) γ) Αν ένα κύτταρο οργανισμού που ανήκει στο συγκεκριμένο υποθετικό είδος, είναι προϊόν της 1 ης μειωτικής διαίρεσης, πόσα χρωμοσώματα θα περιέχει; (5μ) ΙΙ. Για τη μετάφραση ενός γονιδίου ευκαρυωτικού κυττάρου χρησιμοποιούνται 89 μόρια trna. Να απαντήσετε στις ερωτήσεις: α) Από πόσα αμινοξέα αποτελείται το πολυπεπτίδιο που κωδικοποιεί το γονίδια αυτό; (4μ) β) Πόσα νουκλεοτίδια συνολικά περιέχει το μόριο του mrna, συμπεριλαμβανομένων και των νουκλεοτιδίων, που ενώ μεταγράφονται δεν μεταφράζονται; (4μ) γ) Κατά την αντιγραφή του γονιδίου αυτού συνέβη μια μετάλλαξη που οδήγησε στην παραγωγή ενός πολυπεπτιδίου με 61 αμινοξέα. Να παραθέσετε μια πιθανή εξήγηση για το είδος της μετάλλαξης που συνέβη. (5μ) Πιτσιλαδής Βασίλης - Βιολόγος 11

12 ΓΗ_Β_ΒΙΟ_0_ Β57 Ι. Μια χαρακτηριστική αρχή που διέπει την σύνδεση των νουκλεοτιδίων τα οποία δεν ανήκουν στον ίδιο κλώνο των μορίων των νουκλεϊκών οξέων, είναι η αρχή της συμπληρωματικότητας. α) Να εξηγήσετε τη σημασία της συμπληρωματικότητας στη δόμηση του μορίου του DNA. (4μ) β) Να αναφέρετε τα στάδια του Κεντρικού Δόγματος της Βιολογίας στα οποία γίνεται εφαρμογή της αρχής της συμπληρωματικότητας. (4μ) γ) Σε ένα από τα στάδια που αναφέρατε στο β. ερώτημα, αν και σπάνια, είναι δυνατή η παραβίαση της αρχής αυτής. Να περιγράψετε το μηχανισμό που διαθέτουν τα κύτταρα, ώστε να διορθώνουν τα λάθη που μπορεί να προκύψουν από μια τέτοια παραβίαση. (4μ) ΙΙ. Να συγκρίνετε τη μίτωση και τη μείωση αναφορικά με: α) Το είδος των κυττάρων στα οποία συμβαίνουν. (4μ) β) Τον αριθμό των κυττάρων που παράγει, ανά κύτταρο που την υφίσταται, η κάθε μια. (4μ) γ) Το ποια από τις δύο κυτταρικές διαιρέσεις ευνοεί περισσότερο από την άλλη την γενετική σταθερότητα, αιτιολογώντας την απάντησή σας. (5μ) Ι. Στο διπλανό σχήμα, εικονίζονται τα χρωμοσώματα ενός κυττάρου κατά τη διάρκεια της μειωτικής διαίρεσης, όπου τα «λευκά» χρωμοσώματα είναι μητρικής προέλευσης και τα «μαύρα» πατρικής προέλευσης. α) Σε ποια φάση της μειωτικής διαίρεσης βρίσκεται το κύτταρο; Να αιτιολογηθεί η απάντησή σας. (4μ) β) Με την πρόοδο της μειωτικής διαίρεσης παράχθηκε ένα κύτταρο που είχε τα χρωμοσώματα που εικονίζονται στο διπλανό σχήμα: Ποιο φαινόμενο που γίνεται κατά τη διάρκεια της μειωτικής διαίρεσης είναι υπεύθυνο για την δημιουργία αυτού του συνδυασμού χρωμοσωμάτων στο κύτταρο; Να αιτιολογηθεί η απάντησή σας. (4μ) γ) Αν κατά την πρόοδο της μειωτικής διαίρεσης παραγόταν ένα κύτταρο που είχε τα χρωμοσώματα που εικονίζονται στο διπλανό σχήμα, ποιο είναι το φαινόμενο που είναι υπεύθυνο για τη δημιουργία τους, εκτός από αυτό που αναφέρατε στο β. ερώτημα; Σε ποιο φάση της μείωσης συμβαίνει; (4μ) ΙΙ. Πολλές φορές τα κύτταρα χρειάζονται να παράγουν την ίδια χρονική περίοδο πολυάριθμα μόρια της ίδιας πρωτεΐνης. Να αναφέρετε δύο εναλλακτικούς τρόπους με τους οποίους το κατορθώνουν. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 12

13 ΓΗ_Β_ΒΙΟ_0_ Β58 Ι. H Κυτταρική διαίρεση στους προκαρυωτικούς οργανισμούς διαφέρει από την κυτταρική διαίρεση στους ευκαρυωτικούς οργανισμούς, ωστόσο και στις δύο κατηγορίες οργανισμών, είναι απαραίτητο να έχει προηγηθεί ο αυτοδιπλασιασμός του DNA. α) Να περιγράψετε την κυτταρική διαίρεση στους προκαρυωτικούς οργανισμούς και να εξηγήσετε ποιες είναι σε γενικές γραμμές οι διαφορές της από την κυτταρική διαίρεση των ευκαρυωτικών οργανισμών. (6μ) β) Να εξηγήσετε γιατί είναι απαραίτητο πριν τη διεξαγωγή τους, να έχει προηγηθεί ο αυτοδιπλασιασμός του DNA. (6μ) ΙΙ. Στα διάφορα στάδια της σύγχρονης έκφρασης του Κεντρικού Δόγματος της Βιολογίας μετέχουν διαφορετικά είδη ενζύμων. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται το κύριο ένζυμο της Αντιγραφής, πώς δρα κατά τη διεξαγωγή της; (5μ) β) Πώς ονομάζεται το ένζυμο που παίρνει μέρος στη Μεταγραφή, πώς δρα κατά τη διεξαγωγή της; (3μ) γ) Να αναφέρετε δύο διαφορές ανάμεσα στη δράση του κύριου ενζύμου της Αντιγραφής και στη δράση του ενζύμου της Μεταγραφής. (5μ) Πιτσιλαδής Βασίλης - Βιολόγος 13

14 ΓΗ_Β_ΒΙΟ_0_ Β58, ΓΗ_Β_ΒΙΟ_0_ Β71 Ι. Σε έναν φανταστικό οργανισμό βρέθηκαν τέσσερα διαφορετικά είδη αζωτούχων βάσεων στο mrna του οι: Χ, Υ, Ζ, W, όπου το ζευγάρι X και Y, και το ζευγάρι W και Z είναι συμπληρωματικά. Όταν οι μοριακοί βιολόγοι απέσπασαν ένα μόριο mrna του οργανισμού αυτού, (1η οριζόντια σειρά), και το άφησαν να προσδεθεί σε ριβοσώματα, τότε παρήχθη ένα ολιγοπεπτίδιο, του οποίου η αλληλουχία των αμινοξέων του υπάρχει στη 2η οριζόντια σειρά. Να απαντήσετε στις ερωτήσεις: Αλληλουχία X X Z W X Z X X W W W W Z Z W Y Z Z mrna Αλληλουχία Κανένα Υποθετίνη Φανταστίνη Υποθετίνη Παραμύθινη Ανυπαρκτίνη αμινοξέων αμινοξύ α) Είναι ο γενετικός κώδικάς του εκφυλισμένος ή όχι; (3μ) β) Είναι συνεχής ή επικαλυπτόμενος ο γενετικός κώδικάς του; (3μ) γ) Ποιο είναι το πιθανό κωδικόνιο λήξης του υποθετικού οργανισμού; (2μ) δ) Ποιο είναι το αντικωδικόνιο του μορίου trna του φανταστικού οργανισμού που μεταφέρει το αμινοξύ παραμυθίνη; Να αιτιολογηθούν οι απαντήσεις σας. (4μ) II. Στο ακόλουθο διάγραμμα απεικονίζεται η μεταβολή της ποσότητας του DNA σε ένα κύτταρο κατά τη διάρκεια του κυτταρικού κύκλου του. Αφού μελετήσετε τις πληροφορίες που σας παρέχει, να απαντήσετε στις ερωτήσεις: α) Στη διάρκεια ποιας από τις εικονιζόμενες φάσεις (Α, Β, κ.τ.λ.) γίνεται αντιγραφή του DNA; Πώς ονομάζεται η φάση αυτή; (2μ) β) Στη διάρκεια ποιας φάσης από τις εικονιζόμενες γίνεται η μετάφραση; (3μ) γ) Σε ποιες από τις εικονιζόμενες φάσεις τα χρωμοσώματα αποτελούνται από δύο αδελφές χρωματίδες, ενωμένες στο κεντρομερίδιο; Πώς ονομάζεται η κάθε μία φάση; (4μ) δ) Σε ποια από τις εικονιζόμενες φάσεις είναι περισσότερο συμπυκνωμένη η χρωματίνη; Πώς ονομάζεται η φάση αυτή; (2μ) ε) Σε ποια από τις εικονιζόμενες φάσεις γίνεται η απομάκρυνση των αδελφών χρωματίδων; Πώς ονομάζεται η φάση αυτή; (2μ) Να αιτιολογηθούν οι απαντήσεις σας. Πιτσιλαδής Βασίλης - Βιολόγος 14

15 ΓΗ_Β_ΒΙΟ_0_ Β59 Ι. Ο ακόλουθος, μερικώς συμπληρωμένος πίνακας, περιλαμβάνει τους δύο κλώνους του DNA ενός μικρού γονιδίου, τον κλώνο του mrna που προκύπτει από τη μεταγραφή του γονιδίου, καθώς και μια σειρά που αντιστοιχεί στην αλληλουχία του ολιγοπεπτιδίου που κωδικοποιεί το γονίδιο αυτό. Κλώνος Ι Α G C C T T T Κλώνος ΙΙ Α G Α T C T T Κλώνος ΙΙΙ Α U G G Αμινοξέα α) Ποιος από τους κλώνους είναι ο μεταγραφόμενος, ποιος ο κλώνος του mrna; Να αιτιολογηθούν οι απαντήσεις σας. (5μ) β) Να συμπληρώσετε τον πίνακα χρησιμοποιώντας το ακόλουθο απόσπασμα του γενετικού κώδικα: (5μ) ΚΩΔΙΚΟΝΙΑ CCA GUU UGG CCU CAU CAG AUU UAU ΑΜΙΝΟΞΕΑ Προλίνη Βαλίνη Τρυπτοφάνη Προλίνη Ιστιδίνη Γλουταμίνη Ισολευκίνη Τυροσίνη γ) Υπάρχει κάποιο κενό στον πίνακα που να μπορεί να συμπληρωθεί από περισσότερα του ενός διαφορετικά νουκλεοτίδια; Να αιτιολογηθεί η απάντησή σας. (2μ) Πιτσιλαδής Βασίλης - Βιολόγος 15

16 ΓΗ_Β_ΒΙΟ_0_ Β60 Ι. Στο εργαστήριο συντέθηκε ένα δίκλωνο μόριο DNA που περιέχει εξ ολοκλήρου ραδιενεργό Φωσφόρο στα νουκλεοτίδιά του. Η μέτρηση της ποσότητας των ραδιενεργών ισοτόπων Φωσφόρου που υπάρχουν στα νουκλεοτίδια, βρέθηκε να είναι για όλο το μόριο 0,4 ng. To ραδιενεργό αυτό μόριο αφέθηκε να διπλασιαστεί δύο φορές, σε περιβάλλον που είχε νουκλεοτίδια με το κανονικό, μη ραδιενεργό ισότοπο του Φωσφόρου. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι η συνολική ποσότητα ραδιενεργού Φωσφόρου που θα υπάρχει στα θυγατρικά μόρια, μετά τον δεύτερο κύκλο αντιγραφής; (6μ) β) Ποια θα είναι η αναλογία ραδιενεργών προς μη ραδιενεργά νουκλεοτίδια στα θυγατρικά μόρια του DNA, μετά τον δεύτερο κύκλο αντιγραφής; Να αιτιολογηθούν οι απαντήσεις σας. (6μ) ΙΙ. Ο αριθμός χρωμοσωμάτων στο Α είδος οργανισμού είναι 25, ο αριθμός χρωμοσωμάτων στο Β είδος οργανισμού είναι 48, ενώ στο κυτταρόπλασμα του Γ είδους οργανισμού υπάρχει κυκλικό μόριο DNA. Να απαντήσετε στις ερωτήσεις: α) Ποιος από τους οργανισμούς Α και Β είναι διπλοειδής, ποιος είναι ο απλοειδής; Να αιτιολογήσετε την απάντησή σας. (5μ) β) Να περιγράψετε συνοπτικά, τον τρόπο με τον οποίο αναπαράγεται ο οργανισμός Γ. (3μ) γ) Στον οργανισμό που είναι διπλοειδής, η μείωση γίνεται στα σωματικά κύτταρά του, με σκοπό τη δημιουργία γαμετών. Να βρείτε τον αριθμό των χρωμοσωμάτων και τον αριθμό των αδελφών χρωματίδων, κατά τη Μετάφαση της 2 ης Μειωτικής διαίρεσης. (5μ) Πιτσιλαδής Βασίλης - Βιολόγος 16

17 ΓΗ_Β_ΒΙΟ_0_ Β61 ΙΙ. Σύμφωνα με το κεντρικό δόγμα της βιολογίας, η γενετική πληροφορία «ρέει» προς τις πρωτεΐνες, με τις διαδικασίες της αντιγραφής, της μεταγραφής και της μετάφρασης. α) Ποιο είναι το πρότυπο μόριο που χρησιμοποιείται στη διαδικασία της μετάφρασης, ποιο το μόριο που παράγεται; Σε ποιες κυτταρικές δομές διεξάγεται η μετάφραση; Πού βρίσκονται οι δομές αυτές; (6μ) β) Να συγκρίνετε τη μεταγραφή με την αντιγραφή του DNA ως προς: Τον αριθμό των κλώνων που χρησιμοποιεί ως πρότυπο η κάθε μια, για τη σύνθεση του θυγατρικού μορίου. (2μ) Το είδος των ενζύμων που παίρνουν μέρος στη διεξαγωγή τους.(1μ) Το αν γίνονται σε ένα τμήμα ή σε όλο το γενετικό υλικό. (2μ) Τη δυνατότητα επιδιόρθωσης των λαθών που γίνονται κατά τη διεξαγωγή τους. (2μ) Ι. Τα σπερματοζωάρια του χιμπατζή περιέχουν 24 χρωμοσώματα. Να απαντήσετε στις ερωτήσεις: α) Πόσα χρωμοσώματα, (4μ) β) πόσες χρωματίδες και (4μ) γ) πόσα κεντρομερίδια υπάρχουν σε ένα σωματικό κύτταρο χιμπαντζή που βρίσκεται στη μετάφαση της μίτωσης; Να αιτιολογήσετε τις απαντήσεις σας. (4μ) ΙΙ. Η μείωση είναι ένα είδος διαίρεσης του κυττάρου που εμφανίστηκε μεταγενέστερα από τη μίτωση και είναι προϊόν εξέλιξής της. Να συντάξετε ένα κείμενο στο οποίο θα εξηγείτε συνοπτικά γιατί η διαίρεση αυτή είναι απαραίτητη στους οργανισμούς που αναπαράγονται αμφιγονικά, καθώς και τα πλεονεκτήματα που απεκόμισαν από την υιοθέτησή της. (13μ) Πιτσιλαδής Βασίλης - Βιολόγος 17

18 ΓΗ_Β_ΒΙΟ_0_ Β62 ΙΙ. Παρά την πιστότητα της αντιγραφής και την ακρίβεια με την οποία γίνονται οι κυτταρικές διαιρέσεις, το γενετικό υλικό μπορεί να υποστεί διάφορες αλλαγές που χαρακτηρίζονται μεταλλάξεις. Να απαντήσετε στις ακόλουθες ερωτήσεις: α) Ποιες μεταλλάξεις ονομάζονται γονιδιακές; Κάτω από ποιες προϋποθέσεις κληρονομούνται; (3μ) β) Να συντάξετε μια δική σας αλληλουχία 12 ζευγών νουκλεοτιδίων του DNA και θεωρώντας τον ένα κλώνο ως μεταγραφόμενο, να συντάξετε την αλληλουχία του mrna που θα προκύψει. (3μ) γ) Στην αλληλουχία νουκλεοτιδίων του DNA που συντάξατε στο προηγούμενο ερώτημα, να δείξετε τι συμβαίνει στην περίπτωση μιας γονιδιακής μετάλλαξης αντικατάστασης, τόσο στο ίδιο το μόριο, όσο και στο μόριο του mrna που προκύπτει από αυτό. (4μ) δ) Ποιες μεταλλάξεις ονομάζονται χρωμοσωμικές και σε ποιες κατηγορίες διακρίνονται; Να αναφέρετε ένα παράδειγμα χρωμοσωμικής μετάλλαξης στον άνθρωπο. (3μ) Ι. Στις ακόλουθες εικόνες απεικονίζονται στιγμιότυπα από διάφορες φάσεις της μιτωτικής διαίρεσης ενός διπλοειδούς κυττάρου που έχουν τοποθετηθεί σε τυχαία σειρά. Να απαντήσετε στις ερωτήσεις: α) Ποιος είναι ο αριθμός ζευγών των ομόλογων χρωμοσωμάτων του κυττάρου; Πόσες είναι οι αδελφές χρωματίδες στη φάση της μίτωσης που υπάρχουν; (2μ) β) Ποια φάση της μίτωσης αντιστοιχεί σε καθένα από τα γράμματα Α, Β, Γ, και Δ; (6μ) γ) Να τοποθετήσετε τα γράμματα Α, Β, Γ, και στη χρονολογική σειρά που αντιπροσωπεύει τη διαδοχή των φάσεων της μίτωσης. (4μ) ΙΙ. Ένα δίκλωνο μόριο DNA αποτελείται από 408 νουκλεοτίδια και κωδικοποιεί τη σύνθεση μιας πρωτεΐνης. Λαμβάνοντας υπόψη ότι στα νουκλεοτίδια αυτά συμπεριλαμβάνονται και όσα αντιστοιχούν σε κωδικόνιο λήξης, να απαντήσετε στις ερωτήσεις: α) Από πόσα νουκλεοτίδια αποτελείται το μόριο mrna που παράγεται με πρότυπο το μόριο αυτό; (2μ) β) Ποιος είναι ο αριθμός των αμινοξέων από τα οποία αποτελείται η πρωτεΐνη που κωδικοποιείται από το μόριο αυτό; (6μ) γ) Εξαιτίας μιας μετάλλαξης στο μόριο παράχθηκε ένα ολιγοπεπτίδιο με 35 αμινοξέα. Να παραθέσετε μια εξήγηση για τον τρόπο που δημιουργήθηκε η μετάλλαξη αυτή και στον τρόπο που έδρασε ώστε να παραχθεί ολιγοπεπτίδιο με τον συγκεκριμένο αριθμό αμινοξέων. (5μ) Να αιτιολογήσετε τις απαντήσεις σας. Πιτσιλαδής Βασίλης - Βιολόγος 18

19 ΓΗ_Β_ΒΙΟ_0_ Β63, ΓΗ_Β_ΒΙΟ_0_ Β72 Ι. Στην εικόνα παρουσιάζεται ένα κύτταρο κατά τη διάρκεια της Μετάφασης της Μιτωτικής διαίρεσης. Να απαντήσετε στις ερωτήσεις: α) Ποια από τις εικονιζόμενες δομές (1, 2, 3, 4) αντιπροσωπεύει ένα χρωμόσωμα; Ποια αντιπροσωπεύει μια χρωματίδα; (4μ) β) Ποια από τις εικονιζόμενες δομές αντιπροσωπεύει το κεντρομερίδιο; Σε ποιο στάδιο της κυτταρικής διαίρεσης αρχίζει η διαίρεση του κεντρομεριδίου; (4μ) γ) Ποια από τις εικονιζόμενες δομές μας αποκαλύπτει αν το κύτταρο είναι φυτικό ή ζωικό; Πώς ονομάζεται; Να αιτιολογήσετε την απάντησή σας. (4μ) ΙΙ. Τα ένζυμα αποτελούν πρωτεΐνες που είναι ικανές να επιταχύνουν τις βιοχημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Σε ποια κυτταρική δομή γίνεται η παραγωγή των ενζύμων; Ποιο είναι το είδος του χημικού μορίου, που συνδεόμενο με τη δομή αυτή, την κατευθύνει, ώστε να παραγάγει ένα συγκεκριμένο ένζυμο; (2μ) β) Πώς εξηγείται η εξειδίκευση των ενζύμων; Γιατί τα ένζυμα μετά τη θέρμανσή τους σε υψηλή θερμοκρασία, χάνουν την καταλυτική ικανότητά τους; (6μ) γ) Να αναφέρετε δύο ένζυμα που συμμετέχουν στα στάδια του Κεντρικού Δόγματος της Βιολογίας, περιγράφοντας συνοπτικά το βιολογικό ρόλο τους. (5μ) ΙΙ. Εργαζόμενοι στο εργαστήριο Μοριακής Βιολογίας της NASA, διαπιστώσατε ότι ένα υποθετικό είδος οργανισμού από τον πλανήτη Kepler 438b, είχε νουκλεϊκά οξέα που αποτελούνταν από δύο διαφορετικά είδη νουκλεοτιδίων, την Χιψίνη (Χ) και την Ζετίνη (Ζ), ενώ τα αμινοξέα, με βάση τα οποία συνθέτει τις πρωτεΐνες του είναι 12. Αν ο γενετικός κώδικας του οργανισμού αυτού είναι συνεχής και μη επικαλυπτόμενος, όπως και ο δικός μας, να απαντήσετε στις ερωτήσεις: α) Από πόσα νουκλεοτίδια πρέπει να αποτελείται, τουλάχιστον, κάθε κωδικόνιό του, ώστε να μπορεί να κωδικοποιήσει και τα 12 διαφορετικά αμινοξέα, και να έχει ένα κωδικόνιο λήξης; (9μ) β) Κάποιος συνάδελφός σας, στο εργαστήριο σας ενημέρωσε ότι από την έρευνά του, διαπιστώθηκε πως ο υποθετικός οργανισμός έχει 5 κωδικόνια λήξης. Μετά την πληροφορία αυτή, μήπως πρέπει να επανεξετάσετε την απάντηση που δώσατε στο ερώτημα α; (4μ) Πιτσιλαδής Βασίλης - Βιολόγος 19

20 ΓΗ_Β_ΒΙΟ_0_ Β64 Ι. Η ακόλουθη αλληλουχία νουκλεοτιδίων αποτελεί το μη μεταγραφόμενο κλώνο ενός γονιδίου που κωδικοποιεί τη σύνθεση ενός ολιγοπεπτιδίου. A T G T G G C C A G C T G G T A G T C C C T A A Το ολιγοπεπτίδιο έχει πρωτοταγή δομή: Μεθειονίνη Τρυπτοφάνη Προλίνη Αλανίνη Γλυκίνη Σερίνη Προλίνη Να απαντήσετε στις ερωτήσεις: α) Ποια είναι τα κωδικόνια του mrna που είναι υπεύθυνα για την ένταξη καθενός από τα αμινοξέα του ολιγοπεπτιδίου; Να αιτιολογήσετε την απάντησή σας. (2μ) β) Ποιο από τα συμπεράσματα στα οποία καταλήξατε στο προηγούμενο ερώτημα, αποτελεί απόδειξη ότι ο Γενετικός Κώδικας είναι εκφυλισμένος; (2μ) γ) Ποια είναι τα αντικωδικόνια των μορίων trna που αναμίχθηκαν κατά σειρά στην παραγωγή του ολιγοπεπτιδίου; (2μ) δ) Να υποδείξετε μια πιθανή γονιδιακή μετάλλαξη στο γονίδιο που θα έχει ως αποτέλεσμα την σύνθεση ενός ολιγοπεπτιδίου με 5 αμινοξέα, αντί για 7 αμινοξέα. (6μ) ΙΙ. Στο γαμέτη ενός υποθετικού διπλοειδούς οργανισμού που παράγεται αμφιγονικά υπάρχουν 0,4 pg DNA και 4 χρωμοσώματα. Να απαντήσετε στις ερωτήσεις: α) Ποια είναι η ποσότητα του DNA στο ζυγωτό του οργανισμού και ποιος είναι ο αριθμός των χρωμοσωμάτων του. (4μ) β) Ποια είναι η ποσότητα του DNA σε ένα μεταφασικό σωματικό κύτταρό του οργανισμού αυτού; Ποιος είναι ο αριθμός των χρωμοσωμάτων και των αδελφών χρωματίδων στο κύτταρο αυτό; (6μ) γ) Σε κάποιον από τους οργανισμούς αυτού του είδους διαπιστώθηκε ότι το 4 ο χρωμόσωμα των σωματικών κυττάρων του υπάρχει τρεις, αντί για δύο φορές. Σε αυτόν τον οργανισμό, που προφανώς φέρει μια αριθμητική χρωμοσωμική μετάλλαξη, ποιος είναι ο αριθμός των χρωμοσωμάτων στα σωματικά κύτταρά του; (3μ) Να αιτιολογήσετε τις απαντήσεις σας. Πιτσιλαδής Βασίλης - Βιολόγος 20

21 ΓΗ_Β_ΒΙΟ_0_ Β65 ΙΙ. Στο ακόλουθο διάγραμμα παρουσιάζεται το Κεντρικό Δόγμα της Βιολογίας. α) Πώς ονομάζονται τα στάδιά του 1, 2 και 3; (3μ) β) Να ονομάσετε 3 τμήματα του ευκαρυωτικού κυττάρου που συμβαίνει το στάδιο 1 και 3 τμήματα του ευκαρυωτικού κυττάρου που συμβαίνει το στάδιο 2. (6μ) γ) Με ποιο τρόπο οι πρωτεΐνες συμμετέχουν στο στάδιο 1 και στο στάδιο 2; Να αναφέρετε τα ονόματα δύο συγκεκριμένων πρωτεϊνών που παίζουν κρίσιμο ρόλο στα στάδια αυτά. (4μ) ΙΙ. Ένας διπλοειδής οργανισμός που αναπαράγεται αμφιγονικά έχει στα σωματικά κύτταρά του 6 χρωμοσώματα, ενώ η μάζα του DNA του κατά τη διάρκεια της πρόφασης της μιτωτικής διαίρεσης είναι 20 pg. Να απαντήσετε στις ερωτήσεις: α) Πόσα ζευγάρια ομόλογων χρωμοσωμάτων έχει ο οργανισμός αυτός; (3μ) β) Πόσοι είναι οι διαφορετικοί συνδυασμοί χρωμοσωμάτων πατρικής και μητρικής προελεύσεως που υπάρχουν στους γαμέτες του; (5μ) γ) Ποια είναι η μάζα του DNA του σε ένα προϊόν της 1 η ς μειωτικής διαίρεσης και σε έναν γαμέτη; (5μ) ΓΗ_Β_ΒΙΟ_0_ Β66 Ι. Ανάμεσα στις φάσεις της μιτωτικής διαίρεσης περιλαμβάνονται η πρόφαση και η τελόφαση. Να απαντήσετε στις ερωτήσεις: α) Ποιες είναι οι αλλαγές που γίνονται κατά το στάδιο της πρόφασης και σχετίζονται με τη μορφή της χρωματίνης και τον πυρήνα; (6μ) β) Για ποιο λόγο η τελόφαση θεωρείται ως μια αντίστροφη πρόφαση, σε σχέση με τις αλλαγές που αναφέρατε στο α. ερώτημα; (6μ) Πιτσιλαδής Βασίλης - Βιολόγος 21

22 ΓΗ_Β_ΒΙΟ_0_ Β67 (Κεφ. 2, 4) Ι. Ένας λόγος για τον οποίο κάθε οργανίδιο του κυττάρου είναι ικανό να φέρει σε πέρας τον συγκεκριμένο βιολογικό ρόλο του, είναι τα συγκεκριμένα ένζυμα που περιέχει. Έχοντας ως γνώμονα την πρόταση αυτή: α) Να ονομάσετε δύο ένζυμα του πυρήνα που είναι απαραίτητα στη λειτουργία του γενετικού υλικού και να προσδιορίσετε τη δράση τους.(6μ) β) Να ονομάσετε την κατηγορία των ενζύμων που δρουν στα λυσοσώματα και να προσδιορίσετε τη δράση τους. (2μ) γ) Να ονομάσετε ένα ένζυμο των υπεροξειδιοσωμάτων και να προσδιορίσετε τη δράση του. (4μ) ΙΙ. Στα δομικά στοιχεία του κυτταρικού σκελετού περιλαμβάνονται οι μικροσωληνίσκοι. Να απαντήσετε στις ερωτήσεις: α) Ποιες είναι οι δομές που σχηματίζουν οι μικροσωληνίσκοι στα ζωικά κύτταρα και παίζουν σημαντικό ρόλο κατά την πυρηνική διαίρεση; (3μ) β) Σε ποιο στάδιο του κυτταρικού κύκλου ή της πυρηνικής διαίρεσης δημιουργείται κάθε μια από τις δομές που αναφέρατε στο ερώτημα α; (4μ) γ) Να εξηγήσετε τη σημασία των μικροσωληνίσκων ώστε να εξασφαλίζεται ότι καθένα από τα προϊόντα της μιτωτικής διαίρεσης θα έχει πάρει τον σωστό αριθμό και είδος χρωμοσωμάτων του είδους του. (6μ) Ι. Ο ένας από τους δύο κλώνους του DNA αποτελείται από αζωτούχες βάσεις που το % ποσοστό τους αναγράφεται στον πίνακα: Αζωτούχες βάσεις A T G C % ποσοστό Να απαντήσετε στις ερωτήσεις: α) Ποιο είναι το % ποσοστό των αζωτούχων βάσεων στον συμπληρωματικό κλώνο; (2μ) β) Ποιο είναι το % ποσοστό του συνόλου των Αδενινών και Θυμινών στο δίκλωνο μόριο; (5μ) γ) Αν ο κλώνος του ερωτήματος α, χρησιμοποιηθεί ως πρότυπο για τη σύνθεση ενός μορίου RNA, ποιο θα είναι το % ποσοστό των αζωτούχων βάσεων στο RNA που θα παραχθεί; (5μ) Να αιτιολογήσετε τις απαντήσεις σας. Πιτσιλαδής Βασίλης - Βιολόγος 22

23 ΓΗ_Β_ΒΙΟ_0_ Β69 Ι. Μια από τις ιδιότητες, χάρη στις οποίες το DNA είναι κατάλληλο για γενετικό υλικό είναι ότι μπορεί να αντιγράφεται και μάλιστα με ακρίβεια, ώστε να μεταβιβάζει με πιστότητα τις γενετικές πληροφορίες από κύτταρο σε κύτταρο και από γενιά σε γενιά. α) Σε ποιο στάδιο της ζωής του ευκαρυωτικού κυττάρου γίνεται η αντιγραφή του DNA στον πυρήνα; Πώς χαρακτηρίζεται ο τρόπος αντιγραφής του και γιατί; (3μ) β) Να αναφέρετε την αρχή που διέπει την αντιγραφή και να περιγράψετε τον ιδιαίτερο μηχανισμό που εξασφαλίζει την πιστότητά της. (3μ) γ) Αν κατά τη διάρκεια της αντιγραφής ενός γονιδίου που μεταγράφεται σε mrna συμβεί μια γονιδιακή μετάλλαξη αντικατάστασης, είναι βέβαιο πως θα μεταβληθεί και η αλληλουχία των αμινοξέων της πρωτεΐνης, που αυτό το γονίδιο καθορίζει; Να αιτιολογήσετε την απάντησή σας. (6μ) ΙΙ. Το ριβόσωμα αποτελεί την κυτταρική δομή στην οποία διεξάγεται η μετάφραση. Να απαντήσετε στις ερωτήσεις: α) Από ποια είδη χημικών μορίων αποτελείται ένα ριβόσωμα; Σε ποιό τμήμα, ή δομή του κυττάρου παράγεται καθένα από τα μόρια αυτά; (5μ) β) Με ποια είδη χημικών μορίων αλληλεπιδρά το ριβόσωμα, ώστε να γίνει δυνατή η διαδικασία της μετάφρασης; Ποια είναι η σημασία των μορίων αυτών στη διεξαγωγή της μετάφρασης; (5μ) γ) Σε ποια τμήματα και δομές του κυττάρου βρίσκονται ριβοσώματα; (3μ) Ι. Στο διάγραμμα εικονίζεται η μεταβολή της ποσότητας του DNA ενός κυττάρου που υφίσταται μίτωση. α) Να τοποθετήσετε στον πίνακα που ακολουθεί, κάτω από τις φάσεις (Μεσόφαση, Μετάφαση, Ανάφαση κ.τ.λ.) το διάστημα (π.χ. ΔΕ, ΟΑ, ΑΒ, ΒΓ κ.τ.λ.) που αντιστοιχεί κάθε μια από τις φάσεις αυτές, και να αιτιολογήσετε τις επιλογές σας: (8μ) Φάση Μεσόφαση Πρόφαση Μετάφαση Ανάφαση Τελόφαση Χρονικό Διάστημα β) Αν ο οργανισμός στον οποίο ανήκει το κύτταρο αυτό είναι διπλοειδής και αμφιγονικά αναπαραγόμενος, να προσδιορίσετε την ποσότητα του DNA που έχουν οι γαμέτες του. Να αιτιολογήσετε την απάντησή σας. (4μ) II. Στο σχήμα εικονίζεται ένα κύτταρο που υφίσταται κυτταρική διαίρεση. Με βάση τις πληροφορίες που σας παρέχει το σχήμα να απαντήσετε στις ερωτήσεις: α) Ποιος είναι ο αριθμός των εικονιζόμενων χρωμοσωμάτων και ο αριθμός των αδελφών χρωματίδων του κυττάρου; (4μ) β) Ποιο/α είδος/η κυτταρικής διαίρεσης εικονίζει το σχήμα; Σε ποια φάση βρίσκεται η διαίρεση/σεις αυτή/ές; Nα αιτιολογηθούν οι απαντήσεις σας. (9μ) Πιτσιλαδής Βασίλης - Βιολόγος 23

24 ΓΗ_Β_ΒΙΟ_0_ Β70 Ι. Η ουσία από την οποία αποτελούνται τα χρωμοσώματα, λόγω του ότι βάφεται με τη χρήση κατάλληλων χρωστικών, χαρακτηρίζεται χρωματίνη. Να απαντήσετε στις ερωτήσεις: α) Από τι αποτελείται από χημική άποψη, η χρωματίνη; (3μ) β) Πώς γίνεται αντιληπτή η χρωματίνη στο κύτταρο που βρίσκεται στη μεσόφαση; (3μ) γ) Σε ποια φάση της μίτωσης η χρωματίνης παρουσιάζει το μέγιστο βαθμό συμπύκνωσης. Ποια είναι η μορφή των χρωμοσωμάτων κατά τη διάρκεια της φάσης αυτής; (6μ) ΙΙ. Η μείωση, εκτός από ένα είδος διαίρεσης που εξασφαλίζει την παραγωγή απλοειδών γαμετών, ώστε το ζυγωτό να έχει τον κανονικό διπλοειδή αριθμό χρωμοσωμάτων, ταυτόχρονα συμβάλλει και στην αύξηση της γενετικής ποικιλομορφίας. α) Να ονομάσετε 2 μηχανισμούς που δρουν κατά τη διάρκεια της μείωσης συμβάλλοντας στην αύξηση της γενετικής ποικιλομορφίας. (3μ) β) Σε ποιο στάδιο της μείωσης δρα ο μηχανισμός που δημιουργεί νέους συνδυασμούς γονιδίων που βρίσκονται στο ίδιο ζευγάρι ομόλογων χρωμοσωμάτων; Να αιτιολογήσετε την απάντησή σας. (5μ) γ) Ποιο στάδιο της μείωσης είναι το αποφασιστικό για τη δημιουργία νέων συνδυασμών γονιδίων που βρίσκονται σε διαφορετικά ζευγάρια ομόλογων χρωμοσωμάτων; Να αιτιολογήσετε την απάντησή σας. (5μ) Ι. Ένα μικρό γονίδιο που κωδικοποιεί την παραγωγή ενός ολιγοπεπτιδίου έχει την ακόλουθη διαδοχή νουκλεοτιδίων: C T A T G C C C A A A T C G T A A C C T G A C G A T A C G G G T T T A G C A T T G G A C T G Να απαντήσετε στις ερωτήσεις: α) Από πόσα αμινοξέα αποτελείται το ολιγοπεπτίδιο που θα συντεθεί; Να αιτιολογηθεί η απάντησή σας. (4μ) β) Το τρίτο κατά σειρά μόριο trna που θα αξιοποιηθεί στη σύνθεση του ολιγοπεπτιδίου τι αντικωδικόνιο θα έχει; Να αιτιολογηθεί η απάντησή σας. (3μ) γ) Αν κατά την αντιγραφή του μορίου του DNA γίνει μια μετάλλαξη στην οποία, μεταξύ του 16 ου και 17 ου ζευγαριού νουκλεοτιδίων προστέθηκε το ζευγάρι C (στον πάνω κλώνο) και G (στον κάτω κλώνο), το ολιγοπεπτίδιο που θα συντεθεί, πόσα αμινοξέα θα έχει; Να αιτιολογηθεί η απάντησή σας. (5μ) ΙΙ. Στο ακόλουθο διάγραμμα παρουσιάζεται η μεταβολή στην ποσότητα του DNA των κυττάρων ενός είδους οργανισμού κατά τη διάρκεια της μειωτικής διαίρεσης. Να απαντήσετε στις ερωτήσεις: Πιτσιλαδής Βασίλης - Βιολόγος 24

25 α) Ποιο από τα διαστήματα (ΟΑ, ΑΒ, ΒΓ κ.τ.λ.) αντιστοιχεί: Στη μεσόφαση, πριν την έναρξη της μειωτικής διαίρεσης; Στη μετάφαση της 1 ης μειωτικής διαίρεσης; Στην πρόφαση της 2 ης μειωτικής διαίρεσης; (6μ) β) Σε ποιο από τα χρονικά διαστήματα του διαγράμματος γίνεται ο αποχωρισμός των ομόλογων χρωμοσωμάτων; Σε ποια φάση της μειωτικής διαίρεσης αντιστοιχεί το στάδιο αυτό; (3μ) γ) Ποια είναι η ποσότητα του DNA του ζυγωτού που δημιουργείται σε αυτό το είδος οργανισμού; Να αιτιολογηθούν οι απαντήσεις σας. (4μ) ΓΗ_Β_ΒΙΟ_0_ Β71 Ι. H Κυτταρική διαίρεση στους προκαρυωτικούς οργανισμούς διαφέρει από την κυτταρική διαίρεση στους ευκαρυωτικούς οργανισμούς, ωστόσο και στις δύο κατηγορίες οργανισμών, είναι απαραίτητο να έχει προηγηθεί ο αυτοδιπλασιασμός του DNA. α) Να περιγράψετε την κυτταρική διαίρεση στους προκαρυωτικούς οργανισμούς και να εξηγήσετε ποιες είναι σε γενικές γραμμές οι διαφορές της από την κυτταρική διαίρεση των ευκαρυωτικών οργανισμών. (6μ) β) Να εξηγήσετε γιατί είναι απαραίτητο πριν τη διεξαγωγή τους, να έχει προηγηθεί ο αυτοδιπλασιασμός του DNA. (6μ) ΙΙ. Στα διάφορα στάδια της σύγχρονης έκφρασης του Κεντρικού Δόγματος της Βιολογίας μετέχουν διαφορετικά είδη ενζύμων. Να απαντήσετε στις ερωτήσεις: α) Πώς ονομάζεται το κύριο ένζυμο της Αντιγραφής, πώς δρα κατά τη διεξαγωγή της; (5μ) β) Πώς ονομάζεται το ένζυμο που παίρνει μέρος στη Μεταγραφή, πώς δρα κατά τη διεξαγωγή της; (3μ) γ) Να αναφέρετε δύο διαφορές ανάμεσα στη δράση του κύριου ενζύμου της Αντιγραφής και στη δράση του ενζύμου της Μεταγραφής. (5μ) Πιτσιλαδής Βασίλης - Βιολόγος 25

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Κύτταρα πολυκύτταρων οργανισμών

Κύτταρα πολυκύτταρων οργανισμών Μίτωση - Μείωση Τα ευκαρυωτικά κύτταρα διαιρούνται με δύο τρόπους: τη μίτωση και τη μείωση. Η Μίτωση είναι ο τύπος της κυτταρικής διαίρεσης που από ένα πατρικό κύτταρο καταλήγει σε δύο γενετικά πανομοιότυπα

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου

Τράπεζα Θεμάτων. Βιολογίας Β Γενικού Ημερήσιου Λυκείου 1 Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Χανιά 2014-2015 2 ΠΕΡΙΕΧΟΜΕΝΑ Κεφάλαιο 1ο 4-21 σελ. Θέμα Β 22-33 σελ. Θέμα Δ Κεφάλαιο 2ο 35-55 σελ. Θέμα Β 56-72 σελ. Θέμα Δ Κεφάλαιο 3ο 74 76 σελ.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015)

Τράπεζα Θεμάτων Βιολογίας Β Γενικού. Ημερήσιου Λυκείου. Ομαδοποιημένα ανά κεφάλαιο. (σχολικό έτος 2014-2015) Τράπεζα Θεμάτων Βιολογίας Β Γενικού Ημερήσιου Λυκείου Ομαδοποιημένα ανά κεφάλαιο (σχολικό έτος 2014-2015) Ιωαννίδης Θωμάς Βιολόγος 11 ου ΓΕΛ Ηρακλείου 1 ΠΕΡΙΕΧΟΜΕΝΑ Εξεταστέα Ύλη 2014-15.. σελ.3 1 ο Κεφάλαιο..σελ.

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ Τι σχέση έχουν η μονογονική αναπαραγωγή Κυτταρική διαίρεση η ανάπτυξη η αμφιγονική αναπαραγωγή η αντικατάσταση των κυττάρων Η σημασία της μίτωσης Η μίτωση ευνοεί την κυτταρική

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ ΑΝΑΠΑΡΑΓΩΓΗ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ 2016 2 Το συνώνυμο της αναπαραγωγής είναι ο πολλαπλασιασμός, η δημιουργία νέων ατόμων που έχουν παρόμοια χαρακτηριστικά με τους γονείς τους. Όλοι οι οργανισμοί κάποια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2015 2 0 1 5 ΗΜΕΡΗΣΙΑ ΛΥΚΕΙΑ ΕΣΠΕΡΙΝΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει: Να διακρίνει τη σχέση του γενετικού υλικού με τα ι- διαίτερα χαρακτηριστικά των οργανισμών. Να αναγνωρίζει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις:

Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: ΘΕΜΑ Β: Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται η χημική αντίδραση Γ και

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2013 2 0 1 3 ΛΥΚΕΙΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ 5 Γ Ε Λ Χ Α Λ Α Ν Δ Ρ Ι Ο Υ Περιεχόμενα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα