A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18"

Transcript

1 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ A Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως και Α5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. A1. Μέσα σ ένα φυτικό ευκαρυωτικό κύτταρο, DNA υπάρχει μόνο α. στα ριβοσώματα και στους χλωροπλάστες. β. στον πυρήνα και στα μιτοχόνδρια. γ. στον πυρήνα. δ. στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. A2. Οι περιοριστικές ενδονουκλεάσες α. συμμετέχουν στη μετάφραση του RNA. β. συμμετέχουν στη μεταγραφή του DNA. γ. είναι απαραίτητες για την έναρξη της αντιγραφής. δ. κόβουν το DNA σε καθορισμένες θέσεις. A3. Το πλασμίδιο Ti α. υπάρχει στο Bacillus thuringiensis. β. χρησιμοποιείται στη μικροέγχυση. γ. χρησιμοποιείται για τη γενετική τροποποίηση φυτών. δ. χρησιμοποιείται για τη γενετική τροποποίηση ζώων. A4. Τα άτομα στον καρυότυπo των οποίων περιέχονται τα φυλετικά χρωμοσώματα ΧΧΥ α. πάσχουν από σύνδρομο Turner. β. πάσχουν από σύνδρομο Klinefelter. γ. πάσχουν από σύνδρομο Down. δ. έχουν φυσιολογικό καρυότυπο. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ A5. Κατά την αντιγραφή του DNΑ, στην κατασκευή των πρωταρχικών τμημάτων συμμετέχει το α. ριβόσωμα. β. πολύσωμα. γ. νουκλεόσωμα. δ. πριμόσωμα. ΘΕΜΑ B B1. Nα περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο. Μονάδες 8 B2. Να εξηγήσετε πώς συνδέονται μεταξύ τους οι δύο αλυσίδες ενός δίκλωνου μορίου DNΑ. Μονάδες 6 B3. Να εξηγήσετε τι συμβαίνει στον πληθυσμό των μικροοργανισμών μιας κλειστής καλλιέργειας κατά την εκθετική φάση. Μονάδες 6 B4. Τι μας επιτρέπει να κάνουμε η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR); ΘΕΜΑ Γ Μητέρα με φυσιολογική όραση και ομάδα αίματος Β αποκτά δύο παιδιά με έναν άνδρα με φυσιολογική όραση. Το κορίτσι έχει ομάδα αίματος ΑΒ, ενώ το αγόρι ομάδα αίματος Ο. Το ένα από τα δύο παιδιά πάσχει από μερική αχρωματοψία στο πράσινο κόκκινο. Γ1. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών ως προς τους δύο χαρακτήρες (μονάδες 8). Να αιτιολογήσετε την απάντησή σας (μονάδες 10). Μονάδες 18 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

3 ΑΡΧΗ 3ΗΣ ΣΕΛΙ ΑΣ Γ2. Ποιο από τα δύο παιδιά δεν έχει φυσιολογική όραση; Να αιτιολογήσετε την απάντησή σας. Μονάδες 7 ΘΕΜΑ ίνεται το παρακάτω τμήμα δίκλωνου μορίου DNA (Ι) GACTAATAAAAGAAGTAGTTAGGATCATAGG (ΙΙ) CTGATTATTTTCTTCATCAATCCTAGTATCC που κωδικοποιεί το πεπτίδιο H 2 N-Μεθειονίνη-Τυροσίνη- Φαινυλαλανίνη-Φαινυλαλανίνη-Τυροσίνη-COOH. 1. Να εξηγήσετε ποια από τις δύο αλυσίδες του παραπάνω τμήματος DNA είναι η κωδική και ποια είναι η μη κωδική αλυσίδα. (μονάδες 4) Να γράψετε τον προσανατολισμό των αλυσίδων (μονάδες 2) και να αιτιολογήσετε την απάντησή σας. (μονάδες 2) Μονάδες 8 2. Να γράψετε την αλληλουχία του πρόδρομου mrna που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA (μονάδες 2) καθώς και την αλληλουχία του ώριμου mrna (μονάδες 2). Να αιτιολογήσετε πού οφείλεται η διαφορά μεταξύ των δύο αυτών μορίων. (μονάδες 3) Μονάδες 7 3. Να εξηγήσετε ποιο θα είναι το αποτέλεσμα στη δομή του παραπάνω πεπτιδίου, εάν μια γονιδιακή μετάλλαξη που θα συμβεί στο κωδικόνιο της τυροσίνης οδηγήσει σε αντικατάσταση της κυτοσίνης από θυμίνη. 4. Εάν η παραπάνω γονιδιακή μετάλλαξη οδηγήσει σε αντικατάσταση της κυτοσίνης από αδενίνη, να εξηγήσετε ποιο θα είναι το αποτέλεσμα στη δομή του πεπτιδίου. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙ ΑΣ ίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα: Μεθειονίνη: Τυροσίνη: Φαινυλαλανίνη: AUG UAC, UAU UUU, UUC Ο ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία, εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο τετράδιο. 2. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα, τα οποία και θα καταστραφούν μετά το πέρας της εξέτασης. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό ανεξίτηλης μελάνης. 5. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 6. ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 7. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων και όχι πριν τις 17:00. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

5 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΩΝ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ 2011 ΘΕΜΑ Α1 Α1. το δ Α2. το δ Α3. το γ Α4. το β Α5. το δ ΘΕΜΑ Β1 Ένα επιλεγμένο αντιγόνο, χορηγείται με ένεση σε ποντίκι και προκαλεί ανοσολογική αντίδραση σε αυτό, με αποτέλεσμα να αρχίσει η παραγωγή αντισωμάτων από εξειδικευμένα Β-λεμφοκύτταρα. Ύστερα από δύο εβδομάδες αφαιρείται ο σπλήνας και απομονώνονται τα Β-λεμφοκύτταρα. Τα κύτταρα αυτά συντήκονται με καρκινικά κύτταρα και παράγονται τα υβριδώματα. Τα υβριδώματα μπορούν να φυλάσσονται για μεγάλα χρονικά διαστήματα στην κατάψυξη (-80 ºC) και να παράγουν οποιαδήποτε στιγμή το συγκεκριμένο μονοκλωνικό αντίσωμα σε μεγάλες ποσότητες. ΘΕΜΑ Β2 Παρ ότι η χημική σύσταση και οι ιδιότητες του DNA, με τα πειράματα που αναφέρθηκαν πιο πάνω, είχαν γίνει γνωστά, δεν υπήρχε κοινά αποδεκτή πρόταση για τη δομή του DNA στο χώρο. Δεδομένα από την ανάλυση του ποσοστού των βάσεων σε μόρια DNA από διαφορετικούς οργανισμούς, έδειχναν ότι σε κάθε μόριο DNA ο αριθμός των νουκλεοτιδίων που έχουν ως βάση την αδενίνη, είναι ίσος με τον αριθμό των νουκλεοτιδίων που έχουν τη θυμίνη, και ο αριθμός των νουκλεοτιδίων που έχουν ως βάση τη γουανίνη είναι ίσος με τον αριθμό αυτών που έχουν κυτοσίνη. Δηλαδή ισχύει Α = Τ και G = C. Επίσης, βρέθηκε ότι η αναλογία των βάσεων [(Α+Τ) /

6 (G+C)] διαφέρει από είδος σε είδος και σχετίζεται με το είδος του οργανισμού. Τα αποτελέσματα αυτά σε συνδυασμό με αποτελέσματα που αφορούσαν την απεικόνιση του μορίου DNA με χρήση ακτίνων Χ βοήθησαν στην ανακάλυψη της διπλής έλικας του DNA και απέδειξαν τις μοναδικές ιδιότητές του που το καθιστούν μόριο ιδανικό ως γενετικό υλικό. Η ανακάλυψη της διπλής έλικας του DNA είναι η μεγαλύτερη βιολογική ανακάλυψη του 20 ου αιώνα. Έγινε το 1953 και ήταν το αποτέλεσμα της ερευνητικής εργασίας δύο ομάδων επιστημόνων: των Wilkins και Franklin καθώς και των Watson και Crick. Στηριζόμενοι στο σύνολο των αποτελεσμάτων των δύο ομάδων οι Watson και Crick διατύπωσαν το μοντέλο της διπλής έλικας του DNA, που αναφέρεται στη δομή του DNA στο χώρο. Σύμφωνα με το μοντέλο αυτό: Το DNA αποτελείται από δύο πολυνουκλεοτιδικές αλυσίδες που σχηματίζουν στο χώρο μία δεξιόστροφη διπλή έλικα. Η διπλή έλικα έχει ένα σταθερό σκελετό, που αποτελείται από επαναλαμβανόμενα μόρια φωσφορικής ομάδας-δεοξυριβόζης ενωμένων με φωσφοδιεστερικό δεσμό. Ο σκελετός αυτός είναι υδρόφιλος και βρίσκεται στο εξωτερικό του μορίου. Προς το εσωτερικό του σταθερού αυτού σκελετού βρίσκονται οι αζωτούχες βάσεις που είναι υδρόφοβες. Οι αζωτούχες βάσεις της μίας αλυσίδας συνδέονται με δεσμούς υδρογόνου με τις αζωτούχες βάσεις της απέναντι αλυσίδας με βάση τον κανόνα της συμπληρωματικότητας. Η αδενίνη συνδέεται μόνο με θυμίνη και αντίστροφα, ενώ η κυτοσίνη μόνο με γουανίνη και αντίστροφα. Οι δεσμοί υδρογόνου που αναπτύσσονται μεταξύ των βάσεων σταθεροποιούν τη δευτεροταγή δομή του μορίου. Ανάμεσα στην αδενίνη και τη θυμίνη σχηματίζονται δύο δεσμοί υδρογόνου, ενώ ανάμεσα στη γουανίνη και την κυτοσίνη σχηματίζονται τρεις δεσμοί υδρογόνου. Οι δύο αλυσίδες ενός μορίου DNA είναι συμπληρωματικές, και αυτό υποδηλώνει ότι η αλληλουχία της μιας καθορίζει την αλληλουχία της άλλης. Η συμπληρωματικότητα έχει τεράστια σημασία για τον αυτοδιπλασιασμό του DNA, μία ιδιότητα που το καθιστά το καταλληλότερο μόριο για τη διατήρηση και τη μεταβίβαση της γενετικής πληροφορίας. Κάθε αλυσίδα DNA μπορεί να χρησιμεύει ως καλούπι για τη σύνθεση μιας συμπληρωματικής αλυσίδας, ώστε τελικά να σχηματίζονται δύο δίκλωνα μόρια DNA πανομοιότυπα με το μητρικό μόριο. Οι δύο αλυσίδες είναι αντιπαράλληλες, δηλαδή το 3 άκρο της μίας είναι απέναντι από το 5 άκρο της άλλης. ΘΕΜΑ Β3 Σε αυτή τη φάση, οι μικροοργανισμοί διαιρούνται με ταχύ ρυθμό, επειδή η καλλιέργεια πραγματοποιείται κάτω από άριστες συνθήκες θερμοκρασίας, ph, συγκέντρωσης Ο 2 και στο υλικό καλλιέργειας υπάρχουν άφθονα θρεπτικά συστατικά. Αυτή η φάση ανάπτυξης ονομάζεται εκθετική, επειδή ο αριθμός των μικροοργανισμών αυξάνεται εκθετικά.

7 ΘΕΜΑ Β4 Η αλυσιδωτή αντίδραση πολυμεράσης (PCR : Polymerase Chain Reaction) μας επιτρέπει να αντιγράψουμε επιλεκτικά, εκατομμύρια φορές, ειδικές αλληλουχίες DNA, χωρίς τη μεσολάβηση ζωντανού κυττάρου. Η τεχνική αυτή που άρχισε να εφαρμόζεται ευρέως από το 1985, έχει αυξήσει την ευαισθησία των γενετικών αναλύσεων και έχει πολλές πρακτικές εφαρμογές. Για παράδειγμα, χρησιμοποιείται στην Ιατρική για τη διάγνωση ασθενειών, όπως του AIDS, στην εγκληματολογία για τη διαλεύκανση υποθέσεων και στη μελέτη DNA από απολιθώματα. ΘΕΜΑ Γ1 ΓΙΑ ΤΗΝ ΟΜΑΔΑ ΑΙΜΑΤΟΣ: Ι Α αλληλόμορφο γονίδιο που κωδικοποιεί τη σύνθεση ενός ενζύμου το οποίο συνθέτει στην επιφάνεια των ερυθρών αιμοσφαιρίων το αντιγόνο Α. Ι Β αλληλόμορφο γονίδιο που κωδικοποιεί τη σύνθεση ενός ενζύμου το οποίο συνθέτει στην επιφάνεια των ερυθρών αιμοσφαιρίων το αντιγόνο Β. i αλληλόμορφο γονίδιο που δεν κωδικοποιεί τη σύνθεση κάποιου ενζύμου, το οποίο να συνθέτει στην επιφάνεια των ερυθρών αιμοσφαιρίων κάποιο αντιγόνο. Ι Α = Ι Β [συνεπικρατή μεταξύ τους] [και επικρατή έναντι του i] > i I A I A και Ι Α i άτομο με ομάδα αίματος Α I B I B και Ι Β i άτομο με ομάδα αίματος Β I A I B άτομο με ομάδα αίματος ΑΒ ii άτομο με ομάδα αίματος Ο ΓΙΑ ΤΗΝ ΟΡΑΣΗ-ΑΝΤΙΛΗΨΗ ΤΩΝ ΑΠΟΧΡΩΣΕΩΝ ΤΟΥ ΠΡΑΣΙΝΟΥ ΚΑΙ ΤΟΥ ΚΟΚΚΙΝΟΥ ΧΡΩΜΑΤΟΣ: Χ Δ αλληλόμορφο γονίδιο για φυσιολογική όραση Χ δ αλληλόμορφο γονίδιο για μερική αχρωματοψία στο κόκκινο και πράσινο Χ Δ > Χ δ Στις γυναίκες: Στους άνδρες: Χ Δ Χ Δ με κανονική όραση Χ Δ Υ με κανονική όραση Χ Δ Χ δ με κανονική όραση-φορέας Χ δ Υ με αχρωματοψία Χ δ Χ δ με αχρωματοψία στο κόκκινο-πράσινο 1 ον ) Για ασθένειες ή γνωρίσματα (όπως η μερική αχρωματοψία στο κόκκινο και στο πράσινο) που κληρονομούνται με φυλοσύνδετο υπολειπόμενο τύπο, ισχύει ότι: από δύο φαινοτυπικά υγιείς γονείς η ασθένεια-το γνώρισμα (δηλ. η μερική αχρωματοψία), μπορεί να εμφανιστεί μόνο σε αρσενικούς απογόνους. Ρ: Χ Δ Χ δ (Χ) Χ Δ Υ Γαμ: Χ Δ Χ Δ Χ δ Υ F: Χ Δ Χ Δ : Χ Δ Χ δ : Χ Δ Υ : Χ δ Υ Επομένως το αγοράκι αυτής της οικογένειας πάσχει από μερική αχρωματοψία στο κόκκινο και στο πράσινο και όχι η αδελφή του.

8 2 ον ) Η μητέρα είναι ομάδας αίματος Β, ενώ ο γιος της είναι ομάδας αίματος Ο (δηλαδή γονοτυπικής σύστασης ii), γεγονός που σημαίνει ότι το αγόρι αυτό πήρε ένα i-αλληλόμορφο γονίδιο υποχρεωτικά από τη μητέρα του, η οποία βεβαίως θα έχει οπωσδήποτε γονότυπο Ι Β i για την ομάδα αίματος. 3 ον ) Το κορίτσι με ομάδα αίματος ΑΒ έχει γονότυπο για αυτό το γνώρισμα I A I B, γεγονός που σημαίνει ότι ο πατέρας της, της έδωσε υποχρεωτικά το Ι Α -αλληλόμορφο γονίδιο (αφού η μητέρα της δεν το έχει στο γονότυπό της), ο οποίος μπορεί να έχει γονότυπο για την ομάδα αίματος: Είτε I A I A και Ι Α i και να ανήκει στην ομάδα αίματος Α Είτε I A I B και να ανήκει στην ομάδα αίματος ΑΒ 4 ον ) Η κόρη αφού δεν πάσχει από μερική αχρωματοψία (στα δεδομένα της άσκησης αναφέρεται ότι μόνο το ένα από τα δύο παιδιά της οικογένειας πάσχει από μερική αχρωματοψία και εμείς αποδείξαμε στο 1 ο μας βήμα, ότι πάσχει το αγοράκι), θα έχει γονοτυπική σύσταση Χ Δ Χ Δ ή Χ Δ Χ δ. Σύμφωνα λοιπόν με όλα τα παραπάνω, οι πιθανοί γονότυποι των μελών αυτής της οικογένειας είναι οι εξής: Μητέρα = Ι Β i Χ Δ Χ δ Πατέρας = I A I A Χ Δ Υ ή I A I α Χ Δ Υ ή I A I Β Χ Δ Υ Κόρη = I A I B Χ Δ Χ Δ ή I A I B Χ Δ Χ δ Γιος = iiχ δ Υ ΘΕΜΑ Γ2 Όπως ήδη εξηγήσαμε στο Γ1-Ερώτημα, ο πατέρας με τη φυσιολογική όραση έχει γονότυπο Χ Δ Υ και αφού σε κάθε κόρη που θα αποκτά, θα έχει δώσει το Χ Δ - φυσιολογικό αλληλόμορφο, δεν υπάρχει περίπτωση να αποκτήσει κόρη που να πάσχει από μερική αχρωματοψία. Στους γιους που θα αποκτήσει ο πατέρας, δίνει το Υ-φυλετικό χρωμόσωμα. Αντίθετα, η σύζυγός του, πρέπει να είναι υγιής-φορέας Χ Δ Χ δ αφού το ένα της παιδί πάσχει από μερική αχρωματοψία. Έτσι βλέπουμε ότι δίνοντας το παθολογικό αλληλόμορφο σε αρσενικό απόγονό της, αυτός θα πάσχει (Χ δ Υ). ΘΕΜΑ Δ1 (Ι) 5 GACTAATAAAAGAAGTAGTTAGGATCATAGG3 (ΙΙ) 3 CTGATTAT T T TGT TCATCAATCC TAGTATCC5 Η κωδική αλυσίδα του γονιδίου είναι η (ΙΙ) και ο προσανατολισμός της αυτός που φαίνεται στο παραπάνω σχήμα, ενώ η μη κωδική αλυσίδα του γονιδίου είναι η (Ι) και ο προσανατολισμός της δείχνεται επίσης στο ίδιο σχήμα. Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια, τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια μίας αλυσίδας του DNA, σύμφωνα με τον κανόνα της συμπληρωματικότητας των

9 βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνδέει τα ριβονουκλεοτίδια, που προστίθενται το ένα μετά το άλλο, με 3-5 φωσφοδιεστερικό δεσμό. Η μεταγραφή έχει προσανατολισμό 5 3. Το μόριο RNA που συντίθεται είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Το RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mrna με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες, με βάση έναν κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Γι αυτό η πρωτεϊνοσύνθεση είναι πραγματικά μία διαδικασία «μετάφρασης» από τη γλώσσα των βάσεων στη γλώσσα των αμινοξέων. Ένα από τα βασικά χαρακτηριστικά του γενετικού κώδικα είναι ότι είναι κώδικας τριπλέτας, δηλαδή μία τριάδα νουκλεοτιδίων, το κωδικόνιο, κωδικοποιεί ένα αμινοξύ. Ο όρος κωδικόνιο δεν αφορά μόνο το mrna αλλά και το γονίδιο από το οποίο παράγεται. Έτσι, για παράδειγμα, το κωδικόνιο έναρξης AUG αντιστοιχεί στο κωδικόνιο έναρξης της κωδικής αλυσίδας του γονιδίου ΑΤG, κ.ο.κ. Το τμήμα ενός γονιδίου, και του mrna του, που κωδικοποιεί μία πολυπεπτιδική αλυσίδα, αρχίζει με το κωδικόνιο έναρξης και τελειώνει με το κωδικόνιο λήξης. ΘΕΜΑ Δ2 Πρόδρομο mrna: 5 CCUAUGAUCCUAACUACUUCUUUUAUUAGUC3 Εξώνιο-1 Εσώνιο-1 Εξώνιο-2 Ώριμο mrna: 5 CCU, AUG, UAC, UUC, UUU, UAU,UAG,UC3 5 -αμετάφραστη 3 -αμετάφραστη περιοχή περιοχή Στους ευκαρυωτικούς οργανισμούς, το mrna που παράγεται κατά τη μεταγραφή ενός γονιδίου, συνήθως δεν είναι έτοιμο να μεταφραστεί, αλλά υφίσταται μία πολύπλοκη διαδικασία ωρίμανσης. Η διαδικασία αυτή αποτελεί ένα από τα πιο ενδιαφέροντα ευρήματα της Μοριακής Βιολογίας, γιατί οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Δηλαδή, η αλληλουχία που μεταφράζεται σε αμινοξέα, διακόπτεται από ενδιάμεσες αλληλουχίες οι οποίες δε μεταφράζονται σε αμινοξέα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες αλληλουχίες ονομάζονται εσώνια. Όταν ένα γονίδιο που περιέχει εσώνια μεταγράφεται, δημιουργείται το πρόδρομο mrna που περιέχει και εξώνια και εσώνια. Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της ωρίμανσης, κατά την οποία τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snrna και από πρωτεΐνες και λειτουργούν ως ένζυμα: κόβουν τα εσώνια και συρράπτουν τα εξώνια μεταξύ τους. Έτσι σχηματίζεται το «ώριμο» mrna. Αυτό παρ ότι αποτελείται αποκλειστικά από εξώνια, έχει δύο περιοχές που δε μεταφράζονται σε αμινοξέα. Η μία βρίσκεται στο 5

10 άκρο και η άλλη στο 3 άκρο. Οι αλληλουχίες αυτές ονομάζονται 5 και 3 αμετάφραστες περιοχές, αντίστοιχα. Το mrna μεταφέρεται από τον πυρήνα στο κυτταρόπλασμα και ειδικότερα στα ριβοσώματα όπου είναι η θέση της πρωτεϊνοσύνθεσης. ΘΕΜΑ Δ3 Όπως βλέπουμε από την κωδική αλυσίδα του γονιδίου (αλλά και από το ώριμο mrna), το μόνο από τα δύο κωδικόνια της τυροσίνης που περιέχει την κυτοσίνη, είναι το κωδικόνιο 5 TAC3. Εάν αυτό, εξαιτίας μίας γονιδιακής μετάλλαξης αντικατάστασης, της κυτοσίνης από θυμίνη, γίνει τελικά 5 ΤΑΤ3 (δηλαδή στο ώριμο mrna 5 UΑU3 ) βλέπουμε ότι θα κωδικοποιείται και πάλι το αμινοξύ της τυροσίνης. Ένα από τα έξι βασικά χαρακτηριστικά του Γενετικού Κώδικα άλλωστε είναι ότι χαρακτηρίζεται ως εκφυλισμένος. Με εξαίρεση δύο αμινοξέα (μεθειονίνη και τρυπτοφάνη), τα υπόλοιπα δεκαοκτώ κωδικοποιούνται από δύο μέχρι και έξι διαφορετικά κωδικόνια. Τα κωδικόνια που κωδικοποιούν το ίδιο αμινοξύ, ονομάζονται συνώνυμα κωδικόνια. ΘΕΜΑ Δ4 Εάν το ίδιο αυτό κωδικόνιο της τυροσίνης (5 TAC3 ), της κωδικής αλυσίδας του γονιδίου, εξαιτίας μίας γονιδιακής μετάλλαξης αντικατάστασης, της κυτοσίνης από αδενίνη, γίνει τελικά 5 ΤΑΑ3 (δηλαδή στο ώριμο mrna 5 UΑΑ3 ) βλέπουμε ότι θα προκύψει κωδικόνιο λήξης της μετάφρασης και άρα το πεπτίδιο δε θα συντίθεται, αφού θα υπάρχει μόνο το αμινοξύ της μεθειονίνης στη μία από τις θέσεις εισδοχής των trnas μορίων της μεγάλης ριβοσωμικής υπομονάδας. Στο Γενετικό Κώδικα υπάρχουν τρία κωδικόνια λήξης, τα 5 UAG3, 5 UGA3 και 5 UAA3. Η παρουσία των κωδικονίων αυτών στο μόριο του mrna οδηγεί στον τερματισμό της σύνθεσης της πολυπεπτιδικής αλυσίδας, επειδή δεν υπάρχουν trna που να αντιστοιχούν σε αυτά. Επιμέλεια Καθηγητών Φροντιστηρίων Βακάλη

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ν γράψετε στο τετράδιό σς τον ριθμό κθεμιάς πό τις πρκάτω ημιτελείς προτάσεις Α1 έως Α5 κι δίπλ το γράμμ που

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ Λουκάς Νικολάου ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ 2014 2 Γενετική είναι ο κλάδος της Βιολογίας που ασχολείται με την μελέτη της κληρονομικότητας. Κληρονομικότητα είναι η προγόνους στους απογόνους. μεταβίβαση χαρακτήρων

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου;

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου; ΒΙΟΛΟΓΙΑ 1,Να αντιστοιχίσετε της όρους της αριστερής στήλης με τις προτάσεις της δεξιάς στήλης: α. κυτταρική μεμβράνη 1. πολλαπλασιάζονται με εκβλάστηση β. αμοιβάδα 2.κέντρα παραγωγής ενέργειας γ. μιτοχόνδρια

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Stylianos Kalaitzis A1-1

Stylianos Kalaitzis A1-1 A1-το γενετικό υλικό Stylianos Kalaitzis A1-1 Περιεχόμενα Σημειώσεις Θεωρίας Το γενετικό υλικό Μεθοδολογία ασκήσεων έκφρασης Μεταλλάξεις και οι σχέση τους με τη μενδελική κληρονομικότητα Μενδελική κληρονομικότητα

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ Α.1.

Διαβάστε περισσότερα

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ. Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας

ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ. Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας 2001 1 ΠΕΡΙΕΧΟΜΕΝΑ 1. Δομή του γενετικού υλικού 3 2. Κληρονομικότητα..

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: ευτέρα, 23 Μαΐου 2011 07:30-10:30

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ Α. Εισαγωγικά Στοιχεία Βιολογίας 1. DNA (Δεοξυριβονουκλεϊκό Οξύ) Φορέας γενετικής πληροφορίας Το DNA είναι ένα επίμηκες μόριο

Διαβάστε περισσότερα