Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ"


1 Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Οι μεταβολικές οδοί στον άνθρωπο ακολουθούν ορισμένα στάδια, καθένα από τα οποία ελέγχεται από κάποιο ένζυμο. Η δημιουργία μεταλλάξεων σε γονίδια που κωδικοποιούν κάποια από αυτά τα ένζυμα προκαλεί διάφορες κληρονομικές ασθένειες, όπως η φαινυλκετονουρία και ο αλφισμός, οι οποίες κληρονομούνται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Η φαινυλκετονουρία είναι μία ασθένεια η οποία προκαλείται από την έλλειψη του ενζύμου που στα φυσιολογικά άτομα μετατρέπει το αμινοξύ φαινυλαλανίνη σε τυροσίνη με αποτέλεσμα τη συσσώρευση φαινυλαλανίνης. Στα άτομα που είναι ομόζυγα για το υπολειπόμενο μεταλλαγμένο γονίδιο παρεμποδίζεται η φυσιολογική ανάπτυξη και λειτουργία των κυττάρων του εγκέφαλου, με συνέπεια τη διανοητική καθυστέρηση. Ο αλφισμός οφείλεται στην έλλειψη ενός ενζύμου, το οποίο είναι απαραίτητο για το σχηματισμό της χρωστικής μελανίνης. Στα άτομα που πάσχουν από αλφισμό υπάρχει έλλειψη της χρωστικής στο δέρμα,

2 στα μαλλιά και στην ίριδα του οφθαλμού. Ο αλφισμός εμφανίζει ετερογένεια, δηλαδή άλλα άτομα εμφανίζουν παντελή έλλειψη ενεργότητας του ενζύμου, ενώ άλλα εμφανίζουν μειωμένη ενεργότητα. B3. Τα γονίδια που καθορίζουν την ομάδα αίματος του ανθρώπου, σύμφωνα με το σύστημα ΑΒΟ, είναι πολλαπλά αλληλόμορφα. Δύο από τα αλληλόμορφα του γονιδίου, το Ι Α και το Ι Β είναι συνεπικρατή ενώ το i είναι υπολειπόμενο. Άτομα ομάδας αίματος Α έχουν γονότυπο Ι Α Ι Α ή Ι Α i, άτομα ομάδας αίματος Β έχουν γονότυπο Ι Β Ι Β ή Ι Β i, άτομα ομάδας αίματος ΑΒ έχουν γονότυπο Ι Α Ι Β και άτομα ομάδας αίματος Ο έχουν γονότυπο ii. P: Ι Α Ι Β (ομάδα αίματος ΑΒ) x ii (ομάδα αίματος Ο) Γαμέτες: Ι Α, Ι Β i Απόγονοι: Ι Α i (ομάδα αίματος Α) Ι B i (ομάδα αίματος Β) P: Ι Α i (ομάδα αίματος Α) x Ι B i (ομάδα αίματος B) Γαμέτες: Ι Α, i Ι Β, i Απόγονοι: Ι Α i (ομάδα αίματος Α) Ι B i (ομάδα αίματος Β) Ι Α Ι Β (ομάδα αίματος ΑΒ) ii (ομάδα αίματος Ο) Ο τρόπος με τον οποίο κληρονομούνται οι ομάδες αίματος είναι αποτέλεσμα των γεγονότων που συμβαίνουν στη μείωση. Κατά την παραγωγή των γαμετών διαχωρίζονται τα δύο ομόλογα χρωμοσώματα και συνεπώς και τα δύο αλληλόμορφα γονίδια. Σε ένα ετερόζυγο γονότυπο σχηματίζονται δύο ειδών γαμέτες σε ίση αναλογία. Οι απόγονοι προκύπτουν από τον τυχαίο συνδυασμό των γαμετών. Η κατανομή των αλληλόμορφων στους γαμέτες και ο τυχαίος συνδυασμός τους αποτελεί τον πρώτο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων. Τα πολλαπλά αλληλόμορφα μπορεί να αλλάζουν τη φαινοτυπική αναλογία 3:1 στους απογόνους σύμφωνα με τον 1ο νόμο του Mendel, επειδή δημιουργούν πολλά είδη φαινοτύπων λόγω των διαφορετικών συνδυασμών που γίνονται. ΘΕΜΑ Γ Γ1. 6 ο κωδικόνιο αλληλόμορφου: 5 GAG 3

3 6 ο αμινοξύ β-πολυπεπτιδικής αλυσίδας: γλουταμινικό οξύ Στην κωδική αλυσίδα του DNA αλλάζει μία βάση και το φυσιολογικό κωδικόνιο GAG, που κωδικοποιεί το γλουταμινικό οξύ, αντικαθίσταται από το GTG, που κωδικοποιεί τη βαλίνη. Αυτή η μετάλλαξη οδηγεί σε αλλαγή της στερεοδιάταξης της αιμοσφαιρίνης, η οποία έχει ως αποτέλεσμα την αλλαγή της μορφής των ερυθροκυττάρων σε δρεπανοκύτταρα σε συνθήκες έλλειψης οξυγόνου. Γ2. 5 GTGCATCTGAATTCTCCTGAGGAA 3 3 CACGTAGACTTAAG AGGACTCCTT 5 Έχουμε γονιδιακή μετάλλαξη, προσθήκη τριών διαδοχικών βάσεων: 5 ΑΤΤ 3. Προκύπτει η αλληλουχία την οποία αναγνωρίζει η περιοριστική ενδονουκλέαση EcoRI, οπότε κόβει το DNA μεταξύ G και Α με προσανατολισμό 5 3. Δεδομένου ότι έχουμε συμπτώματα ήπιας αναιμίας, πρόκειται για ουδέτερη μετάλλαξη. Η ασθένεια που προκύπτει λόγω μεταλλαγμένου αλληλόμορφου είναι η β-θαλασσαιμία. Γ3. Από τους απογόνους του θηλυκού ατόμου Ι προκύπτει ότι το χαρακτηριστικό ελέγχεται από φυλοσύνδετο υπολειπόμενο αλληλόμορφο. Α: κανονικό σχήμα οφθαλμών α: ανώμαλο σχήμα των οφθαλμών τότε ο γονότυπος του θηλυκού ατόμου Ι είναι Χ α Χ α και ο γονότυπος του αρσενικού ατόμου είναι Χ Α Υ. Από τους απογόνους του θηλυκού ατόμου ΙΙ, αναλογία 1:1 τόσο ως προς το φύλο των απογόνων (αρσενικό: θηλυκό) όσο και ως προς το χαρακτηριστικό (κανονικό σχήμα : ανώμαλο σχήμα) προκύπτει ότι το χαρακτηριστικό μπορεί να ελέγχεται είτε από αυτοσωμικό επικρατές αλληλόμορφο είτε από αυτοσωμικό υπολειπόμενο αλληλόμορφο. Στην περίπτωση του αυτοσωμικού επικρατούς αλληλόμορφου: Β: ανώμαλο σχήμα οφθαλμών β: κανονικό σχήμα οφθαλμών

4 οπότε το θηλυκό άτομο είναι Ββ με ανώμαλο σχήμα οφθαλμών και το αρσενικό άτομο είναι ββ με κανονικό σχήμα. Στην περίπτωση του αυτοσωμικού υπολειπόμενου αλληλόμορφου: Β: κανονικό σχήμα οφθαλμών β: ανώμαλο σχήμα οφθαλμών οπότε το θηλυκό άτομο είναι ββ με ανώμαλο σχήμα οφθαλμών και το αρσενικό άτομο είναι Ββ με κανονικό σχήμα. ΘΕΜΑ Δ Δ1. Το χαρακτηριστικό οφείλεται σε φυλοσύνδετο γονίδιο που έχει πολλαπλά αλληλόμορφα. σ: στρογγυλό σχήμα δ: δρεπανοειδές σχήμα ω: ωοειδές σχήμα Από τη διασταύρωση 1 και 2 προκύπτει ότι δ > σ και από τη διασταύρωση 3 προκύπτει ότι ω > δ. Έτσι η σχέση μεταξύ των τριών αλληλόμορφων είναι: ω > δ > σ. Σύμφωνα με τα παραπάνω, οι γονότυποι των ατόμων της Ρ και F 1 γενιάς είναι: Ρ γενιά F 1 γενιά θηλυκά αρσενικά θηλυκά αρσενικά 1. δρεπανοειδές X στρογγυλό δρεπανοειδές δρεπανοειδές Χ δ Χ δ Χ σ Υ Χ δ Χ σ Χ δ Υ 2. στρογγυλό X δρεπανοειδές δρεπανοειδές στρογγυλό Χ σ Χ σ Χ δ Υ Χ δ Χ σ Χ σ Υ 3. δρεπανοειδές X ωοειδές ωοειδές δρεπανοειδές Χ δ Χ δ Χ ω Υ Χ ω Χ δ Χ δ Υ Δ2. Μελετούμε κάθε χαρακτηριστικό ξεχωριστά. Με βάση την αναλογία 3:1 στους απογόνους για κάθε χαρακτηριστικό προκύπτει: Α: πορφυρός καρπός α: πράσινος καρπός Β: φύλλα με εγκοπές β: φύλλα στρογγυλά Οι γονότυποι των ατόμων που διασταυρώθηκαν:

5 Διασταυρώσεις 1. ΑαΒβ Χ ααββ 2. ΑαΒβ X Ααββ 3. ΑΑΒβ X ααββ 4. ΑαΒΒ X ααββ 5. Ααββ X ααββ Σύμφωνα με το δεύτερο νόμο του Mendel, της ανεξάρτητης μεταβίβασης των γονιδίων, που αναφέρει ότι το γονίδιο που ελέγχει ένα χαρακτήρα δεν επηρεάζει τη μεταβίβαση του γονιδίου που ελέγχει έναν άλλο χαρακτήρα. Σήμερα είναι γνωστό ότι αυτό ισχύει μόνο για γονίδια που βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Ο ανεξάρτητος διαχωρισμός των γονιδίων γίνεται, επειδή τα χρωμοσώματα κάθε γονέα συνδυάζονται με τυχαίο τρόπο κατά τη δημιουργία των γαμετών. Οι διασταυρώσεις αυτού του τύπου, που μελετάται ο τρόπος κληρονόμησης δύο χαρακτήρων, ονομάζονται διασταυρώσεις διυβριδισμού. Στις διασταυρώσεις αυτές κάθε γονέας μπορεί να παράγει τέσσερα είδη γαμετών με ίση πιθανότητα για τον καθένα. Δ3. Στην αυτοσωμική υπολειπόμενη κληρονομικότητα, τα ετερόζυγα άτομα χαρακτηρίζονται ως φορείς του υπολειπόμενου αλληλόμορφου. Σ ένα γενεαλογικό δένδρο τα θηλυκά άτομα φορείς συμβολίζονται ως ενώ τα αρσενικά άτομα φορείς συμβολίζονται ως. Παράδειγμα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα μόνο τα θηλυκά άτομα στην ετερόζυγη κατάσταση χαρακτηρίζονται ως φορείς του υπολειπόμενου αλληλόμορφου. Σ ένα γενεαλογικό δέντρο τα θηλυκά άτομα φορείς συμβολίζονται ως. Παράδειγμα: αιμορροφιλία Α Σε κάθε περίπτωση οι φορείς έχουν φυσιολογικό φαινότυπο. ΔΗΜΗΤΡΗΣ ΚΟΤΡΟΠΟΥΛΟΣ ΒΙΟΛΟΓΟΣ

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΕΚΤΟ ΚΕΦΑΛΑΙΟ ΜΕΤΑΛΛΑΞΕΙΣ ΜΕΤΑΛΛΑΞΕΙΣ Γίνονται μόνο στο γενετικό υλικό των κυττάρων, δηλαδή στο DNA και έχουν μόνιμο χαρακτήρα. Δεν θεωρούνται μεταλλάξεις, μεταβολές των προϊόντων της έκφρασης του γενετικού

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κεφάλαιο 6: Μεταλλάξεις

Κεφάλαιο 6: Μεταλλάξεις Κεφάλαιο 6: Μεταλλάξεις ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Τι ονομάζονται μεταλλάξεις και ποια τα κυριότερα είδη τους; 2. Ποιες οι διαφορές μεταξύ γονιδιακών και χρωμοσωμικών μεταλλάξεων; 3. Οι μεταλλάξεις στα σωματικά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ // Γ γ ΙΑΤΡ λυκείου Γ ΘΕΤ2 ΗΜΕΡΟΜΗΝΙΑ: 29/12/2015 29 12 2016 ΘΕΜΑ 1 ο Επιλέξτε τη σωστή απάντηση που συμπληρώνει τις παρακάτω προτάσεις: 1. Η περιοριστική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 30 Μαΐου 2012 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα


ÈÅÌÅËÉÏ ÅËÅÕÓÉÍÁ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 ο. ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο 1 - γ 2 - α 3 - α 4 - β 5 - δ ΘΕΜΑ 2 ο 1. Ένας τρόπος βελτίωσης της φυτικής και ζωικής παραγωγής είναι οι ελεγχόµενες από τον άνθρωπο διασταυρώσεις φυτών και ζώων. Για το σκοπό αυτό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα