νιαιου Λυκείου κή Κατευθυνση ΪΜΜΜί 4,- % ν ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΩΣ ΔΙΔΑΚΤΙΚΩΝ ΒΙΒΛΙΩΝ Α Ο Η Ν Α

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "νιαιου Λυκείου κή Κατευθυνση ΪΜΜΜί 4,- % ν ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΩΣ ΔΙΔΑΚΤΙΚΩΝ ΒΙΒΛΙΩΝ Α Ο Η Ν Α"

Transcript

1 ΥΠΟΥΡΓΕΙΟ ΕΘΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ νιαιου Λυκείου κή Κατευθυνση β ΪΜΜΜί Κ i I «ι ντί Η',, % ν ρ ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΩΣ ΔΙΔΑΚΤΙΚΩΝ ΒΙΒΛΙΩΝ Α Ο Η Ν Α 4,-

2 Βιοχημεία ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗ! Γ' ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΛΥΣΕΙΣ ΑΣΚΗΣΕΩΝ

3 ΟΜΑΔΑ ΣΥΓΓΡΑΦΗΣ ΓΙΑΛΟΥΡΗΣ ΠΑΡΑΣΚΕΥΑΣ, δρ. χημικός, εκπαιδευτικός Δ/θμιας Εκπαίδευσης ΜΠΟΣΙΝΑΚΟΥ ΚΑΤΕΡΙΝΑ, δρ. βιολόγος, εκπαιδευτικός Δ/θμιας Εκπαίδευσης ΣΙΔΕΡΗΣ ΔΙΑΜΑΝΤΗΣ, επ. καθηγητής Βιολογικού Τμήματος Πανεπιστημίου Αθηνών ΥΠΕΥΘΥΝΗ ΣΤΟ ΠΛΑΙΣΙΟ ΤΟΥ ΠΑΙΔΑΓΩΓΙΚΟΥ ΙΝΣΤΙΤΟΥΤΟΥ ΙΊΕΡΑΚΗ ΒΑΣΙΛΙΚΗ, δρ. βιολόγος, πάρεδρος Παιδαγωγικού Ινστιτούτου ΓΛΩΣΣΙΚΗ ΕΠΙΜΕΛΕΙΑ ΚΛΕ1ΔΩΝΑΡΗ ΜΑ1ΡΙΤΑ, φιλόλογος, εκπαιδευτικός Δ/θμιας Εκπαίδευσης ΟΜΑΔΑ ΚΡΙΣΗΣ ΑΒΡΑΜΙΩΤΗΣ ΣΠΥΡΟΣ, δρ. χημικός, εκπαιδευτικός Δ'θμιας Εκπαίδευσης ΚΡΕΜΑΣΤΟΣ ΘΑΝΑΣΗΣ, βιολόγος, εκπαιδευτικός Δ/θμιας Εκπαίδευσης ΣΕΚΕΡΗΣ ΚΩΝΣΤΑΝΤΙΝΟΣ, καθηγητής Ιατρικής Σχολής Πανεπιστημίου Αθηνών Καλλιτεχνική Επιμέλεια: Σπύρος I. Παπασπύρου Με απόφαση της ελληνικής κυβέρνησης τα διδακτικά βιβλία του Δημοτικού, του Γυμνασίου και του Λυκείου τυπώνονται από τον Οργανισμό Εκδόσεως Διδακτικών Βιβλίων και διανέμονται δωρεάν.

4 Πρόλογος Σκοπός του βιβλίου Βιοχημείας για την Τεχνολογική Κατεύθυνση της Γ' τάξης του Ενιαίου Λυκείου είναι να σας βοηθήσει να γνωρίσετε την επιστήμη της Βιοχημείας και να διαπιστώσετε τη σημασία της για την ανάπτυξη άλλων επιστημών, αλλά και τη συμβολή της στη βελτίωση της ζωής του ανθρώπου. Επιθυμία των συγγραφέων είναι να συμβάλει το βιβλίο της Βιοχημείας στην εξοικείωσή σας με τον επιστημονικό τρόπο σκέψης, καθώς και στην ανάπτυξη της ικανότητάς σας να συλλέγετε, να ανταλλάσσετε και να επεξεργάζεστε πληροφορίες. Οι ερωτήσεις, οι ασκήσεις και τα προβλήματα του βιβλίου του μαθητή επιλέχθηκαν με σκοπό να σας βοηθήσουν στην καλύτερη κατανόηση των επιμέρους θεμάτων που πραγματεύεται η Βιοχημεία και να σας δώσουν την ευκαιρία να ελέγξετε το επίπεδο των γνώσεών σας. Το βιβλίο που κρατάτε στα χέρια σας μπορεί να σας βοηθήσει να λύσετε απορίες που έχουν δημιουργηθεί και να αξιολογήσετε τις γνώσεις σας και το βαθμό στον οποίο έχετε κατανοήσει το θέμα που πραγματεύεται η διδακτική ενότητα ή το κεφάλαιο με το οποίο ασχολείστε. Δεν πρόκειται να σας «μάθει» Βιοχημεία ούτε να σας βοηθήσει να πάρετε μεγαλύτερο βαθμό σε εξετάσεις και διαγωνίσματα. Οι ερωτήσεις, οι ασκήσεις και τα προβλήματα του βιβλίου σας μπορούν να απαντηθούν χωρίς δυσκολία, εάν προηγουμένως έχετε φροντίσει να συμμετέχετε ενεργά κατά τη διδασκαλία του μαθήματος και εάν έχετε αφιερώσει λίγο χρόνο στη μελέτη της διδακτικής ενότητας που επεξεργαστήκατε στην τάξη. Εάν πληρούνται οι παραπάνω προϋποθέσεις, είμαστε βέβαιοι ότι το βιβλίο με τις λύσεις δε θα σας χρειαστεί. Ελπίζοντας σ' αυτό, σας ευχόμαστε καλή χρονιά. Οι συγγραφείς

5 ΚΕΦΑΛΑΊΟ Ί ΟΡΓΑΝΙΚΗ ΧΗΜΕΙΑ ΚΑΙ ΒΙΟΧΗΜΕΙΑ I. Ποια είναι χα στοιχεία που απαντούν συχνότερα σε ένα κύτταρο; Τ α στοιχεία αυτά είναι: το οξυγόνο, ο άνθρακας, το υδρογόνο και το άζωτο. 2. Τι είναι τα βιομόρια; Σε ποιους δεσμούς οφείλεται η σταθερότητα των βιομορίων; Τα βιομόρια είναι χημικές ουσίες που αποτελούν τα βασικά δομικά και λειτουργικά συστατικά των ζωντανών οργανισμών. Οι δεσμοί που σταθεροποιούν τα διάφορα βιομόρια είναι ο ομοιοπολικός και ο ετεροπολικός δεσμός αλλά και άλλοι δευτερεύοντες δεσμοί, όπως ο δεσμός υδρογόνου, οι δυνάμεις Van der Waals και οι υδρόφοβες αλληλεπιδράσεις. 3. Πώς ταξινομούνται τα βιομόρια; Τα βιομόρια κατατάσσονται σε πρόδρομα μόρια (π.χ. ΗιΟ, CO2, ΝΗ 3 ), τα οποία σχηματίζουν ενδιάμεσα συστατικά (π.χ. γλυκόζη, οξικό οξύ), που με τη σειρά τους συνθέτουν δομικά συστατικά (π.χ. αμινοξέα, νουκλεοτίδια, λιπαρά οξέα). Τα δομικά συστατικά σχηματίζουν μεγάλου μεγέθους μόρια, τα μακρομόρια (π.χ. πρωτεΐνες, πολυσακχαρίτες, νουκλεϊνικά οξέα, λιπίδια), από τα οποία αποτελούνται τα διάφορα υπερμοριακά συμπλέγματα (π.χ. ριβοσώματα). Τα υπερμοριακά συμπλέγματα δημιουργούν τα κυτταρικά οργανίδια, όπως ο πυρήνας, για να σχηματιστεί τελικά το κύτταρο. CD

6 4. Συμπληρώστε τον πίνακα θέτοντας για κάθε περίπτωση ένα παράδειγμα βιομορίου: Πρόδρομα μόρια Η 2 0 Ενδιάμεσα συστατικά Γλυκόζη Δομικά συστατικά Αμινοξέα Μακρομόρια Πρωτεΐνες Υπερμοριακά συμπλέγματα Ριβοσώματα Κυτταρικά οργανίδια Πυρήνας 5. Ποιες είναι οι κυριότερες κατηγορίες χημικών ενώσεων στις οποίες ανήκουν τα βιομόρια; Οι κυριότερες κατηγορίες χημικών ενώσεων στις οποίες ανήκουν τα διάφορα βιομόρια είναι: πρωτείνες, υδατάνθρακες, νουκλεϊνικά οξέα και λιπίδια. 6. Ποια από τις παρακάτω προτάσεις είναι σωστή; α. Τα βιομόρια είναι μόνο ανόργανες ενώσεις. β. Τα βιομόρια είναι μόνο οργανικές ενώσεις. γ. Άλλα βιομόρια είναι ανόργανες και άλλα οργανικές ενώσεις. Σωστή απάντηση είναι η (γ), αφού υπάρχουν ανόργανα βιομόρια, όπως το Η 2 0 ή το C0 2, αλλά και οργανικά μόρια, όπως οι υδατάνθρακες, τα αμινοξέα, οι πρωτεΐνες, τα λιπίδια κ.ά. 7. Αναφέρετε σπουδαίες φυσικοχημικές ιδιότητες του νερού που σχετίζονται με το δεσμό υδρογόνου. Σπουδαίες φυσικοχημικές ιδιότητες του νερού που σχετίζονται με το δεσμό υδρογόνου είναι: η άριστη διαλυτική του ικανότητα, η μεγάλη επιφανειακή τάση και η μεγάλη θερμοχωρητικότητα. 8. Με ποιους μηχανισμούς επιτυγχάνεται η ρύθμιση της ισορροπίας του νερού στον άνθρωπο; Οι μηχανισμοί με τους οποίους επιτυγχάνεται η ρύθμιση της ισορροπίας του νερού στον άνθρωπο είναι: το αίσθημα της δίψας, που οδηγεί στη λήψη (Ι)

7 νερού, η δράση των νεφρών, που οδηγεί στην αποβολή νερού με τη μορφή του υδατικού διαλύματος των ούρων, καθώς επίσης και η εφίδρωση. 9. Μέσα στο νερό υπάρχουν διαλυμένα διάφορα άλατα, όπως: NaHCOj, NaiHPOi, MgCI 2, KCI, NaCI κ.ά. Ποιος είναι γενικά ο ρόλος τους; Ο ρόλος των αλάτων, όπως τα NaHC0 3, Na4HP0 4, MgCli, KCI, NaCI κ.ά., είναι ότι συμμετέχουν στη ρύθμιση του ρη και της ωσμωτικής πίεσης και λαμβάνουν μέρος στη διαδικασία μεταβίβασης νευρικών ερεθισμάτων. ίο. Τι είναι τα ιχνοστοιχεία; Ποια ιχνοστοιχεία γνωρίζετε; Ιχνοστοιχεία είναι τα στοιχεία που βρίσκονται στον οργανισμό σε πολύ μικρές ποσότητες, έχουν όμως τεράστια σημασία γι' αυτόν, αφού έλλειψη ή υπερβολική συγκέντρωσή τους μπορεί να προκαλέσει βλάβες στην υγεία. Γνωστά ιχνοστοιχεία είναι: ο σίδηρος, ο χαλκός, ο ψευδάργυρος, το κοβάλτιο,, το φθόριο, και το ιώδιο. 11. Συμπληρώστε τον πίνακα που ακολουθεί: Ιχνοστοιχείο Σίδηρος Φθόριο Ιώδιο Κοβάλτιο Ιδιότητα Είναι συστατικό της αιμοσφαιρίνης Διευκολύνει χην εναπόθεση αλάτων στα οστά, σχηματίζοντας φθοριοαπατίτη Έλλειψη του προκαλεί βρογχοκήλη Είναι συστατικό της βιταμίνης Bu CD

8 ΚΕΦΑΛΑΊΟ 2, ΑΜΙΝΟΞΕΑ - ΠΕΠΤΙΑΙΑ I. Συμπληρώστε τα κενά στην παρακάτω πρόταση: Οι χαρακτηριστικές ομάδες που φέρουν τα αμινοξέα είναι αφ' ενός η αμινομάδα. αφ' ετέρου η καρβοξυλομάδα. 2. Μελετώντας τον πίνακα 2.1. γράψτε το συντακτικό τύπο δύο μονοαμινομονοκαρβονικών, δύο μονοαμινοδικαρβονικών και δύο διαμινομονοκαρβονικών αμινοξέων. Επίσης γράψτε το συντακτικό τύπο δύο αμινοξέων που περιέχουν αρωματικό δακτύλιο. Μονοαμινομονοκαρβονικά αμινοξέα: γλυκίνη, αλανίνη. Μονοαμινοδικαρβονικά αμινοξέα: ασπαραγινικό οξύ, γλουταμινικό οξύ. Διαμινομονοκαρβονικά αμινοξέα: λυσίνη, αργινίνη. Αμινοξέα με αρωματικό δακτύλιο: τυροσίνη, τρυπτοφάνη, φαινυλαλανίνη. 3. Πώς κατατάσσονται τα αμινοξέα με βάση την πολικότητα της πλευρικής ομάδας R; Με βάση την πολικότητα της πλευρικής ομάδας R τα αμινοξέα κατατάσσονται σε: α) αμινοξέα με μη πολικές ή υδρόφοβες ομάδες (π.χ. αλανίνη, βαλίνη), β) αμινοξέα με πολικές αλλά όχι ιονιζόμενες ομάδες (π.χ. σερίνη, κυστεΐνη) και γ) αμινοξέα με πολικές και ιονιζόμενες ομάδες. Στην τελευταία περίπτωση η ιονιζόμενη ομάδα μπορεί να είναι μία επιπλέον ομάδα -COOH ή -ΝΗ 2, οπότε μπορεί να έχουμε μονοαμινοδικαρβονικά αμινοξέα, όπως το ασπαραγινικό οξύ, ή διαμινομονοκαρβονικά αμινοξέα, όπως η λυσίνη. 4. Ποια αμινοξέα θεωρούνται απαραίτητα, ποια ημιαπαραίτητα και γιατί; Ο ανθρώπινος οργανισμός χρειάζεται τα αμινοξέα, για να συνθέσει τις διάφορες πρωτεΐνες και τα πεπτίδια που του είναι απαραίτητα. Δύο είναι οι CD

9 τρόποι με τους οποίους τα προμηθεύεται: α) από τις πρωτεΐνες της τροφής, οι οποίες υδρολύονται απελευθερώνοντας αμινοξέα, β) από άλλες πρώτες ύλες, από τις οποίες τα συνθέτει. Τα αμινοξέα που μπορούν να συντεθούν από τον οργανισμό ονομάζονται μη απαραίτητα, σε αντίθεση με εκείνα που δεν μπορεί ο οργανισμός να συνθέσει και τα οποία είναι αναγκασμένος να τα προμηθεύεται αποκλειστικά από πρωτεϊνούχα τρόφιμα. Αυτά τα αμινοξέα χαρακτηρίζονται ως απαραίτητα και είναι τα εξής: λυσίνη, λευκίνη, ισολευκίνη, βαλίνη, φαινυλαλανίνη, θρεονίνη, μεθειονίνη και τρυπτοφάνη. 5. Να συμπληρωθούν οι αντιδράσεις: ΝΗ 2 - CH - COOH + HCI ^ NH 3 C.I - CH - COOH I I CH 3 CH 3 ΝΗ 2 - CH - COOH + NaOH ^ NH 2 - CH - COONa + H 2 0 I I CH 3 CH 3 NH 2 - CH 2 - COOH + HCI ^ NH 3 CI - CH 2 - COOH NH 2 - CH 2 - COOH + NaOH > NH 2 - CH 2 - COONa + H Συμπληρώστε τα κενά στην παρακάτω πρόταση: Τα αμινοξέα μπορούν να εμφανίσουν τόσο τον όξινο όσο και το βασικό χαρακτήρα, έχουν δηλαδή αμφολυτικό χαρακτήρα. 7. Δώστε τον ορισμό του ισοηλεκτρικού σημείου. Ποια σχέση έχει η διαλυτότητα ενός αμινοξέος με το ισοηλεκτρικό σημείο; Η τιμή του ρη στην οποία το αμινοξύ δεν εμφανίζει συνολικό φορτίο ονομάζεται ισοηλεκτρικό σημείο (pi). Στην τιμή ρη=ρι το αμινοξύ παρουσιάζει την ελάχιστη διαλυτότητα. 8. Ποια σχέση έχει το φορτίο του αμινοξέος με το ρη του διαλύματος στο οποίο βρίσκεται; Σε διάλυμα με ρη=ρι το αμινοξύ δεν εμφανίζει συνολικό φορτίο. CD

10 Σε διάλυμα με ph<pl το αμινοξύ εμφανίζεται θετικά φορτισμένο. Σε διάλυμα με ρη>ρι το αμινοξύ εμφανίζεται αρνητικά φορτισμένο. 9. Σημειώστε τη σωστή απάντηση: Σε ρη = ρι το φορτίο ενός αμινοξέος είναι: α) θετικό, β) αρνητικό, γ) μηδέν. Σωστή απάντηση είναι η (γ). 10. Υδατικό διάλυμα περιέχει αλανίνη, γλουταμινικό οξύ και αργινίνη. Το διάλυμα έχει ρυθμιστεί σε τιμή ρη=6. Πώς θα κινηθούν τα αμινοξέα αυτά, αν στο διάλυμα διαβιβαστεί συνεχές ηλεκτρικό ρεύμα; Για την απάντησή σας χρησιμοποιήστε τον πίνακα 2.1. Από τον πίνακα 2.1. φαίνεται ότι τα ισοηλεκτρικό σημεία της αλανίνης, του γλουταμινικού οξέος και της αργινίνης είναι 6,0, 3,22 και 10,76 αντίστοιχα. Σε διάλυμα με ρη=6 η αλανίνη θα είναι ηλεκτρικά ουδέτερη, αφού βρίσκεται σε ρη=ρι, και συνεπώς θα παραμείνει ακίνητη. Αντίθετα το γλουταμινικό οξύ θα είναι αρνητικά φορτισμένο, αφού βρίσκεται σε ρη>ρι και θα κινηθεί προς την άνοδο (θετικό ηλεκτρόδιο). Η αργινίνη θα είναι θετικά φορτισμένη, αφού βρίσκεται σε ρη<ρι, και θα κινηθεί προς την κάθοδο (αρνητικό ηλεκτρόδιο). 11. Τι είναι το διπολικό ιόν; Γράψτε το συντακτικό τύπο της γλυκίνης και της αλανίνης με τη μορφή διπολικού ιόντος. Για την απάντησή σας χρησιμοποιήστε τον πίνακα 2.1. Σε ρη=ρι το πρωτόνιο της καρβοξυλομάδας μεταπηδά στην αμινομάδα και το αμινοξύ βρίσκεται σε μία μορφή όπου συνυπάρχουν ένα θετικό και ένα αρνητικό φορτίο. Η μορφή αυτή αποτελεί ένα είδος διπολικού ιόντος. Γλυκίνη με τη μορφή διπολικού ιόντος: ΝΗ CH 2 - COO Αλανίνη με τη μορφή διπολικού ιόντος: ΝΗ CH - COO CH; Qd) 12. Τι είναι ο πεπτιδικός δεσμός και τι το πεπτίδιο; Γράψτε την αντίδραση μεταξύ γλυκίνης και αλανίνης. Πόσα και ποια διπεπτίδια μπορούν να προκύψουν από την αντίδραση ενός μορίου γλυκίνης και ενός μορίου αλανίνης;

11 Η αμινομάδα ενός αμινοξέος μπορεί να αντιδράσει με την καρβοξυλομάδα του ίδιου ή άλλου αμινοξέος, με ταυτόχρονη αποβολή ενός μορίου νερού. Ο δεσμός που δημιουργείται λέγεται πεπτιδικός δεσμός (-C-N-). Ο Η Το πεπτίδιο προκύπτει από την ένωση αμινοξέων με πεπτιδικούς δεσμούς. NH 2 CH C-OH + H-N-CH C-OH >~ NH 2 CH C-N-CH C-OH + Η 2 0 I II I I II R, Ο Η R 2 Ο R, Ο Η RI Ο NH 2 -CH-COOH + NH 2 -CH 2 -COOH I CH 3 - NH 2 -CH-CO-NH-CH 2 -COOH I CH 3 Ala + Gly *- Ala-Gly NH 2 -CH 2 -COOH +. NH 2 -CH-COOH NH 2 -CH 2 -CO-NH-CH-COOH CH 3 CH 3 Gly Ala Gly-Ala Όπως φαίνεται από τις δύο παραπάνω αντιδράσεις, από την αντίδραση ενός μορίου γλυκίνης και ενός μορίου αλανίνης είναι δυνατό να προκύψουν δύο διαφορετικά διπεπτίδια. 13. Σημειώστε σωστό (Σ) ή λάθος (Λ) σε καθεμιά από τις προτάσεις που ακολουθούν. Ένα πενταπεπτίδιο είναι: α) Μείγμα 5 πεπτιδίων. β) Μείγμα 5 όμοιων αμινοξέων. γ) Μείγμα 5 διαφορετικών αμινοξέων. δ) Μείγμα 5 τυχαίων αμινοξέων όμοιων ή διαφορετικών. ε) Χημική ένωση αποτελούμενη από 5 αμινοξέα ενωμένα μεταξύ τους με 4 πεπτιδικούς δεσμούς. στ) Χημική ένωση αποτελούμενη από 5 αμινοξέα ενωμένα μεταξύ τους με 5 πεπτιδικούς δεσμούς. QD

12 ζ) Τίποτα από όλα αυτά. (α)"(λ). (β)-(α), (γ)-(λ), (δ)-(λ), (ε)-(σ), (στ)-(λ), (ζ)-(λ). 14. Τι είναι η νινυδρίνη και ποια η σχέση της με τα αμινοξέα; Η νινυδρίνη είναι οργανική ένωση η οποία αντιδρά με τα αμινοξε'α δίνοντας προϊόν με χαρακτηριστική ιώδη χροιά. Η αντίδραση αυτή χρησιμεύει για τον προσδιορισμό των αμινοξε'ων. 15. Τι γνωρίζετε για το βιολογικό ρόλο των πεπτιδίων; Ο βιολογικός ρόλος των πεπτιδίων μπορεί να είναι ποικίλος. Κατά κύριο λόγο τα πεπτίδια σχετίζονται με την αποικοδόμηση των πρωτεϊνών. Ένα πεπτίδιο όμως είναι δυνατό να έχει και αυτόνομη δράση. Μπορεί να είναι μία ορμόνη που εκκρίνεται από κάποιον αδένα, ρυθμίζοντας έτσι μια συγκεκριμένη λειτουργία. Για παράδειγμα, η καλσιτονίνη είναι ένα πεπτίδιο με 32 αμινοξέα, που εκκρίνεται από το θυρεοειδή αδένα και ελαττώνει την περιεκτικότητα του πλάσματος σε ασβέστιο. Επίσης υπάρχουν πεπτίδια που σχετίζονται με το κεντρικό νευρικό σύστημα και λέγονται νευροπεπτίδια. Για παράδειγμα, στον εγκέφαλο υπάρχει μία ομάδα πενταπεπτιδίων, οι εγκεφαλίνες, οι οποίες ανήκουν στις ενδορφίνες. Οι ουσίες αυτές δεσμεύονται από υποδοχείς που δεσμεύουν επίσης ναρκωτικά, όπως η μορφίνη. 16. Γράψτε το συντακτικό τύπο των παρακάτω τετραπεπτιδίων: α) Ser- Ala-Gly-Leu, β) Ser-Gly-Ala-Leu, γ) Ser-Gly-Leu-Ala. Παρατηρήστε διαφορές στους συντακτικούς τύπους. Για την άσκηση αυτή συμβουλευτείτε τον πίνακα 2.1. NH 2 -CH-CO-NH-CH-CO-NH-CH 2 -CO-NH-CH-COOH CH 2 OH CH 3 CH 3 -CH 2 -CH-CH 3 Ser Ala Gly Leu NH 2 -CH-CO-NH--CH 2 -CO-NH-CH-CO-NH-CH-COOH CH 2 OH CH 3 CH 3 -CH~CH 2 -CH 3 Ser Gly Ala Leu

13 NH 2 -C H-CO-N H-C H 2 -CO-N H-C H-CO-N H-C H-COO Η I I I CH 2 OH CH 3 -CH 2 -CH-CH 3 CH 3 Ser Gly Leu Ala 17. Δίνεται για την αλανίνη pi=6 και για το γλουταμινικό οξύ pi=3,22. Ποια θα είναι η κινητική συμπεριφορά της αλανίνης παρουσία ηλεκτρικού πεδίου σε διαλύματα με τα παρακάτω ρη: α) ρη = 4, β) ρη=6, γ) ρη = 8, και ποια η κινητική συμπεριφορά του γλουταμινικού οξέος σε διαλύματα: α) ρη=2, β) ρη = 3,22, γ) ρη=4; Θα κινηθούν προς την άνοδο (θετικό ηλεκτρόδιο), προς την κάθοδο (αρνητικό ηλεκτρόδιο) ή θα παραμείνουν ακίνητα; Σε διάλυμα με ρη=6 η αλανίνη θα είναι ηλεκτρικά ουδέτερη, αφού βρίσκεται σε ρη=ρι, και κατά συνέπεια δε θα παρουσιάζει κινητικότητα παρουσία ηλεκτρικού πεδίου. Σε ρη=4, δηλαδή σε ρη<ρι, η αλανίνη θα βρίσκεται θετικά φορτισμένη και παρουσία ηλεκτρικού πεδίου θα κινείται προς την κάθοδο. Αντίθετα σε ρη=8, δηλαδή σε ρη>ρι, η αλανίνη θα βρίσκεται αρνητικά φορτισμένη και παρουσία ηλεκτρικού πεδίου θα κινείται προς την άνοδο. Για τον ίδιο λόγο το γλουταμινικό οξύ σε ρη=3,22 θα είναι αφόρτιστο και δε θα κινείται παρουσία ηλεκτρικού πεδίου, ενώ σε ρη=2 θα είναι θετικά φορτισμένο και θα κινείται προς την κάθοδο. Τέλος σε ρη=4 θα είναι αρνητικά φορτισμένο και θα κινείται προς την άνοδο. 18. Ποσότητα ενός πεπτιδίου μάζας m, υδρολύεται, οπότε σχηματίζονται αμινοξέα συνολικής μάζας m 2. Ποιο από τα παρακάτω είναι σωστό: α) mi < m 2, β) πι, = m 2, γ) mi> m 2 ; Λικαιολογήστε την απάντησή σας. Η σωστή απάντηση είναι η (α), δηλαδή ισχύει mi < m 2, αφού η μάζα των αμινοξέων που θα προκύψουν θα ισούται με τη μάζα του πεπτιδίου που υδρολύθηκε, συν τη μάζα του νερού που χρησιμοποιήθηκε στην υδρόλυση. Θα πρέπει να σκεφθούμε ότι το πεπτίδιο δεν αποτελείται από ακέραια μόρια αμινοξέων αλλά από αμινοξικά κατάλοιπα. (D

14 ΚΕΦΑΛΑΊΟ 3 ΠΡΩΤΕΊΝΕς: I. Η αιμοσφαιρίνη είναι μία πρωτείνη που περιέχει τέσσερα άτομα Fe στο μόριό της. Η αιμοσφαιρίνη είναι: α) απλή πρωτεΐνη, β) πρωτέίδιο, γ) μεταλλοπρωτέίνη. Χαρακτηρίστε τις παραπάνω απαντήσεις ως σωστές (Σ) ή λανθασμένες (Α). (α)-(λ), (β)-(σ), (γ)-(σ). 2. Πόσες και ποιες δομές γνωρίζετε για μία πρωτείνη; Την πρωτοταγή δομή, τη δευτεροταγή δομή, την τριτοταγή δομή και την τεταρτοταγή δομή. 3. Τι εκφράζει η πρωτοταγής δομή μίας πρωτείνης; Η πρωτοταγής δομή μίας πρωτεΐνης εκφράζει την αλληλουχία (σειρά) με την οποία βρίσκονται τα αμινοξέα μέσα στο μόριο της πολυπεπτιδικής αλυσίδας. 4. Τι εκφράζει η δευτεροτοταγής δομή μίας πρωτεΐνης; Ποια είδη δευτεροταγούς δομής γνωρίζετε; Η δευτεροταγής δομή μίας πρωτεΐνης εκφράζει τον τρόπο με τον οποίο αναδιπλώνεται η πολυπεπτιδική αλυσίδα σε διάφορα τμήματά της. Η δευτεροταγής δομή μπορεί να έχει δύο διαφορετικές μορφές και συγκεκριμένα: α) τη μορφή α-έλικας, β) τη μορφή β-πτυχωτής επιφάνειας. (Έ)

15 5. Σε ποιους δεσμούς οφείλεται η δευτεροταγής και σε ποιους η τριτοταγής δομή μίας πρωτείνης; Σχη δευτεροταγή δομή συμβάλλουν κυρίως δεσμοί υδρογόνου αλλά και ηλεκτροστατικές αλληλεπιδράσεις. Στην τριτοταγή δομή συμβάλλουν διάφοροι δεσμοί, όπως: α) δεσμοί υδρογόνου μεταξύ αμινοξέων, β) ηλεκτροστατική έλξη μεταξύ αντίθετα φορτισμένων ομάδων, γ) υδρόφοβοι δεσμοί που δημιουργούνται μεταξύ υδρόφοβων ομάδων, όταν η μία πλησιάζει την άλλη, δ) δυνάμεις Van der Waals μεταξύ μη πολικών ομάδων και ε) ομοιοπολικοί δισουλφιδικοί δεσμοί. 6. Τι γνωρίζετε για την τεταρτοταγή δομή μίας πρωτείνης; Πολλές πεπτιδικές αλυσίδες που έχουν αναδιπλωθεί σε σφαιρικές πρωτεΐνες μπορούν συχνά να συνενώνονται σχηματίζοντας μεγαλύτερα πρωτεϊνικά συσσωματώματα. Ο τρόπος που γίνεται αυτή η συνένωση αποτελεί την τεταρτοταγή δομή της πρωτεΐνης, ενώ οι ανεξάρτητες πεπτιδικές αλυσίδες που συνθέτουν το πρωτεϊνικό συσσωμάτωμα αποτελούν τις υπομονάδες. 7. Συμπληρώστε τα κενά στην πρόταση που ακολουθεί: Οι σφαιρικέο πρωτεΐνες είναι ευδιάλυτες στο νερό, ενώ οι ινώδεις είναι αδιάλυτες. 8. Τ ι είναι η υδρόλυση των πρωτεϊνών, με ποιους τρόπους γίνεται και ποια προϊόντα σχηματίζονται; Υδρόλυση μιας πρωτεΐνης είναι η διάσπαση της πρωτεΐνης με πρόσληψη νερού, καθώς και η διάσπαση πεπτιδικών δεσμών. Από την υδρόλυση των πρωτεϊνών σχηματίζονται πεπτίδια ή και αμινοξέα. Η υδρόλυση μπορεί να γίνει: α) Με βρασμό της πρωτεΐνης με διαλύματα βάσεων, αλλά κυρίως με διαλύματα οξέων, όπως το διάλυμα HCI. Τέτοια υδρόλυση ονομάζεται χημική υδρόλυση, β) Με κατεργασία με κατάλληλα ένζυμα, οπότε ονομάζεται ενζυμική υδρόλυση. Τα ένζυμα που προκαλούν υδρόλυση των πρωτεϊνών ονομάζονται πρωτεολυτικά ένζυμα ή πρωτεάσες. 9. Τι είναι η μετουσίωση των πρωτεϊνών και πώς μπορεί να γίνει; Ενώ η πρωτοταγής δομή μιας πρωτεΐνης στηρίζεται σε ισχυρούς δεσμούς, η δευτεροταγής, η τριτοταγής και η τεταρτοταγής δομή στηρίζονται σε ασθενέστερους και σχετικά ευμετάβλητους στη θερμοκρασία και στο ρη δε-

16 σμούς. Έτσι μεταβολές στο ρη ή στη θερμοκρασία μπορούν να οδηγήσουν σε λύση τέτοιων δεσμών και τροποποίηση των δομών της πρωτεΐνης, με εξαίρεση την πρωτοταγή δομή. Το φαινόμενο αυτό λέγεται μετουσίωση. 10. Ποια δομή της πρωτεΐνης παραμένει οπωσδήποτε αναλλοίωτη κατά τη μετουσίωση: α. η πρωτοταγής, β. η δευτεροταγής, γ. η τριτοταγής, δ. η τεταρτοταγής, ε. όλες, στ. καμία; Σημειώστε τη σωστή απάντηση. Σωστή απάντηση είναι η (α). 11. Τι γνωρίζετε για την αντίδραση της διουρίας; Η αντίδραση της διουρίας είναι μια χρωστική αντίδραση που δίνουν όλες οι πρωτεΐνες. Η αντίδραση συνίσταται στην επίδραση αλκαλικού διαλύματος CuS0 4 επί της πρωτεΐνης, οπότε σχηματίζεται ένα χαρακτηριστικό ιώδες χρώμα, το οποίο δίνουν οι πρωτεΐνες, τα πεπτίδια και γενικά όλες οι ενώσεις που περιέχουν στο μόριό τους πεπτιδικό δεσμό, όπως και η διουρία (NH2CONHCONH2), απ' όπου και το όνομα της αντίδρασης. CD 12. Τι γνωρίζετε για το βιολογικό ρόλο των πρωτεϊνών; Ο βιολογικός ρόλος των πρωτεϊνών είναι πολύπλευρος. Μία πρωτεΐνη (όπως π.χ. η μυοσίνη, η τροπονίνη, η ακτίνη) μπορεί να έχει δομικό ρόλο στο μυϊκό ιστό. Κάποιες άλλες πρωτεΐνες έχουν ορμονική δράση, όπως για παράδειγμα η ινσουλίνη και η γλυκαγόνη, που είναι ορμόνες πεπτιδικής φύσης, εκκρίνονται από το πάγκρεας και ρυθμίζουν τη συγκέντρωση του σακχάρου στο αίμα. Άλλες πρωτεΐνες έχουν μεταφορικό ρόλο. Για παράδειγμα, η αιμοσφαιρίνη είναι υπεύθυνη για τη μεταφορά οξυγόνου στο αίμα, ενώ η μυοσφαιρίνη είναι υπεύθυνη για την πρόσληψη οξυγόνου από τους μυς. Υπάρχουν ακόμη πρωτεΐνες που έχουν αμυντικό ρόλο, όπως τα διάφορα αντισώματα με τα οποία ο οργανισμός του ανθρώπου ή των ζώων αμύνεται στην «εισβολή» ενός ξένου σώματος. Επίσης μια πρωτεΐνη μπορεί να έχει ενζυμική δράση, όπως το ένζυμο ριβονουκλεάση, που είναι μία πρωτεΐνη αποτελούμενη από 124 αμινοξέα. Ο ρόλος άλλων πρωτεϊνών είναι αποθηκευτικός, όπως της καζεΐνης, που είναι πρωτεΐνη του γάλακτος και έχει ως ρόλο την αποθήκευση ασβεστίου. Άλλες πάλι πρωτείνες, όπως οι γλυκοπρωτεΐνες, έχουν ως ρόλο να αναγνωρίζουν ουσίες οι οποίες είναι σημαντικές για το μεταβολισμό των κυττάρων

17 και να συνδέονται με αυτές. 13. Ποια η σχέση αντιγόνου - αντισώματος; Ποιο από τα δυο είναι αμυντική πρωτείνη; Τα αντισώματα είναι πρωτεΐνες με τις οποίες ο οργανισμός του ανθρώπου ή των ζώων αμύνεται στην «εισβολή» ενός ξένου σώματος - εισβολέα, που ονομάζεται γενικά αντιγόνο. Τα αντισώματα παράγονται από τον ίδιο τον οργανισμό και έχουν δομή τέτοια, που τα καθιστά ειδικά στο να δεσμεύουν και να εξουδετερώνουν το ξένο σώμα. Πρόκειται δηλαδή για αμυντικές πρωτεΐνες. 14. Αναφέρετε τέσσερις πρωτεΐνες του μυϊκού ιστού. Μυοσίνη, ακτίνη, τροπονίνη και τροπομυοσίνη. Επίσης πρωτεΐνες, όπως η ελαστίνη και το κολλαγόνο, είναι συστατικά των συνδέσμων των οστών και του συνδετικού ιστού αντίστοιχα. 15. Αναφέρετε πέντε ενδεικτικούς ρόλους που μπορεί να έχει μία πρωτεΐνη. Μία πρωτεΐνη μπορεί να έχει, μεταξύ άλλων, τους εξής ρόλους: να είναι ένζυμο, να είναι αντίσωμα, να έχει ορμονική δράση, να έχει ρόλο μεταφορικό ή αποθηκευτικό. 16. Συμπληρώστε τα κενά του πίνακα: Πρωτείνη Γλυκαγόνη Αιμοσφαιρίνη Καζεΐνη, ωαλβουμίνη Ριβονουκλεάση Μυοσίνη, τροπονίνη, ακτίνη Ρόλος Ορμόνη Μεταφορικός ρόλος Αποθηκευτικός χώρος Ένζυμο Πρωτεΐνη μυϊκού ιστού 17. Πώς εξηγείται η ποικιλότητα των βιολογικών ρόλων που μπορεί να έχουν οι πρωτείνες, παρά το γεγονός ότι όλες οι πρωτεΐνες αποτελούνται από τα ίδια δομικά συστατικά, δηλαδή τα αμινοξέα; (Π)

18 Το ερώτημα βρίσκει απάντηση στις διαφορετικές δομές των πρωτεϊνών (πρωτοταγής, δευτεροταγής, τριτοταγής και τεταρτοταγής δομή). Πράγματι, τα ίδια αμινοξέα συνδεδεμένα με διαφορετική σειρά σε μία πρωτεϊνική αλυσίδα προσδίδουν διαφορετικές ιδιότητες στο πρωτεϊνικό μόριο. Αλλά δεν είναι μόνο η πρωτοταγής δομή που καθορίζει τις ιδιότητες της πρωτεΐνης. Διαφορετική αλληλουχία αμινοξέων δεν οδηγεί μόνο σε διαφορετική πρωτοταγή δομή, αλλά μεταβάλλει και τον τρόπο με τον οποίο μπορεί το πρωτεϊνικό μόριο να αναδιπλωθεί, δηλαδή μπορεί να αλλάζει η δευτεροταγής, τριτοταγής και τεταρτοταγής δομή της πρωτεΐνης. Κατά συνέπεια τροποποιείται η διαμόρφωση του πρωτεϊνικού μορίου στο χώρο. Η τρισδιάστατη όμως μορφή της πρωτεΐνης σχετίζεται άμεσα με το λειτουργικό της ρόλο. Έτσι μεταβολές στη θερμοκρασία ή στο ρη είναι δυνατό να προκαλέσουν μετουσίωση της πρωτεΐνης, με αποτέλεσμα αυτή να χάσει τις λειτουργικές της ιδιότητες και να μην μπορεί να ανταποκριθεί στο ρόλο της. 18. Ένα πεπτίδιο αναλύθηκε για τον προσδιορισμό της πρωτοταγούς δομής. Για το σκοπό αυτό το πεπτίδιο υδρολύθηκε με δύο ένζυμα Α και Β. Τα μικρότερα πεπτίδια που σχηματίστηκαν ήταν τα εξής: Ser-Ala-Gly-Tyr-Val-Val-Asp Val-Val-Asp-Glu-lle-Lys-Lys-Val-Arg Lys-Val-Arg-Val-Glu Tyr-Val-Val-Asp-Glu-lle-Lys Lys-Val-Arg-Val-Glu-Ser-Thr-Leu Ser-Ala-Gly-Tyr-Val-Val-Asp-Glu-lle-Lys Να κατασκευαστεί ο πεπτιδικός χάρτης επικαλυπτόμενων θραυσμάτων και να βρεθεί η πρωτοταγής δομή του πεπτιδίου. Ο πεπτιδικός χάρτης επικαλυπτόμενων θραυσμάτων είναι ο ακόλουθος (τονίζονται τα κοινά αμινοξέα): Ser-Ala-Gly-Tyr-Val-Val-Asp Val-Val-Asp-Glu-lle-Lys-Lys-Val-Arg Lys-Val-Arg-Val - GI u Tyr-Val-Val-Asp-Glu-lle-Lys Lys-Val-Arg-Val-Glu -Ser-Thr-Leu Ser-Ala-Gly-Tyr-Val-Val-Asp-Glu-lle-Lys Κατά συνέπεια η πρωτοταγής δομή του πεπτιδίου αυτού είναι η ακόλουθη: Ser-Ala-Gly-Tyr-Vai-Val-Asp-Glu-lle-Lys-Lys-Val-Arg-Val-Glu-Ser-Thr-Leu

19 ΚΕΦΑΛΑΊΟ 4 ΕΝΖΥΜΑ I. Εξηγήστε τους παρακάτω όρους: καταλύτης, αποένζυμο, υπόστρωμα, ενεργό κέντρο, αλλοστερικό κέντρο. Οι καταλύτες είναι ουσίες που μεταβάλλουν την ταχύτητα της αντίδρασης, χωρίς να επηρεάζουν τη θέση της τελικής ισορροπίας. Με τη βοήθεια του καταλύτη μειώνεται η ενέργεια ενεργοποίησης και η αντίδραση προχωρεί με πολύ μεγαλύτερη ταχύτητα. Η ενζυμική πρωτεΐνη χωρίς το συνένζυμο ονομάζεται αποένζυμο. Σε μία αντίδραση που καταλύεται από ένζυμο το αντιδρών ονομάζεται υπόστρωμα. Ενεργό κέντρο είναι μία κατάλληλα διαμορφωμένη περιοχή του ενζυμικού μορίου όπου γίνεται η πρόσδεση του υποστρώματος και η κατάλυση της αντίδρασης. Αλλοστερικό κέντρο του ενζύμου ονομάζεται η περιοχή στην οποία δεσμεύεται ο αλλοστερικός τροποποιητής και μπορεί να είναι όχι μόνο μακριά από το ενεργό κέντρο αλλά και σε άλλη υπομονάδα. 2. Συγκρίνετε τη θεωρία κλειδιού - κλειδαριάς με τη θεωρία της επαγόμενης προσαρμογής. Στο μοντέλο κλειδιού - κλειδαριάς η δομή του ενεργού κέντρου του ενζύμου είναι τέτοια, ώστε να προσαρμόζεται το υπόστρωμα τέλεια στο ένζυμο, όπως ένα μικρό κομμάτι σε ένα μεγάλο «παζλ». Στο μοντέλο της επαγόμενης προσαρμογής πρώτα γίνεται η πρόσδεση του υποστρώματος στο ένζυμο και στη συνέχεια οι αλληλεπιδράσεις μεταξύ των ομάδων του υποστρώματος και του ενεργού κέντρου συντελούν στην «τέλεια εφαρμογή». 3. Εξηγήστε γιατί ένα ένζυμο χάνει την ενεργότητά του, όταν βρεθεί σε ακραίες τιμές ρη.

20 Οι ακραίες τιμές ρη προκαλούν αποδιάταξη των πρωτεϊνικών μορίων, με αποτέλεσμα αυτά να χάνουν το βιολογικό τους ρόλο. Τα ένζυμα, εφόσον είναι πρωτεΐνες, υπακούουν σ' αυτό τον κανόνα. 4. Συμπληρώστε τα κενά στις παρακάτω φράσεις: α. Η πρόσδεση του υποστρώματος στο ένζυμο γίνεται σε κατάλληλη περιοχή που ονομάζεται ενεργό κέντρο. β. Η μονάδα μέτρησης της ενζυμικής ενεργότητας είναι το unit, γ. Οσο μεγαλύτερη είναι η τιμή της σταθεράς Km, τόσο μικρότερη είναι η συγγένεια μεταξύ ενζύμου και υποστρώματος, δ. Ο αλλοστερικός τροποποιητής προκαλεί τροποποίηση στη δομή του ενζύμου. 5. Ποιες από τις παρακάτω προτάσεις είναι σωστές; α. Σε μία ενζυμική αντίδραση τόσο το ένζυμο όσο και το συνένζυμο δεν υφίστανται χημική μεταβολή. β. Κατά τη μη-συναγωνιστική αναστολή η Km δε μεταβάλλεται, γ. Ο συναγωνιστικός αναστολέας δεσμεύεται σε διαφορετική θέση από το υπόστρωμα. δ. Η ταχύτητα της ενζυμικής αντίδρασης επηρεάζεται από το ρη και τη θερμοκρασία. (α)-(λ), (β)-(σ), (γ)-(λ), (δ)-(σ). 6. Ποια είναι η βιολογική σημασία του φαινομένου της ρύθμισης με ανάδραση; Μέσα στο κύτταρο παράγονται διαρκώς εκατοντάδες ενώσεις. Σε πολλές περιπτώσεις η σύνθεση ενός συστατικού απαιτεί μία σειρά ενζυμικών αντιδράσεων. Το κύτταρο πρέπει να είναι σε θέση να ελέγχει την παραγωγή των συστατικών και να επεμβαίνει στη σύνθεσή τους ανάλογα με τις ανάγκες του. Εάν σε μία αλυσίδα αντιδράσεων η συγκέντρωση του τελικού προϊόντος υπερβεί μία τιμή, το προϊόν μπορεί να δράσει ως αναστολέας του ενζύμου το οποίο καταλύει μία από τις αρχικές αντιδράσεις της αλυσίδας, ώστε να μην προχωρήσει η σύνθεση των ουσιών και να μη διαταραχθεί η ισορροπία του οργανισμού. 7. Πώς δρα ένας αλλοστερικός τροποποιητής; Ο αλλοστερικός τροποποιητής δεσμεύεται στο αλλοστερικό κέντρο του

21 ενζύμου. Η δημιουργία του συμπλέγματος ενζύμου - αλλοστερικού τροποποιητή δεν ενεργοποιεί κάποια χημική αντίδραση, αλλά προκαλεί μία ελαφρά τροποποίηση στη δομή του ενζύμου. Αυτή η τροποποίηση ονομάζεται αλλοστερική μετάπτωση και μεταβάλλει τη χωροδιάταξη του ενεργού κέντρου, με αποτέλεσμα να μεταβάλλεται η βιολογική δράση του ενζύμου. 8. Τι είναι τα ισοένζυμα; Υπάρχουν ένζυμα που καταλύουν την ίδια αντίδραση αλλά μπορεί να διαφέρουν τόσο στην πρωτοταγή τους δομή όσο και σε ορισμένες φυσικές και χημικές τους ιδιότητες. Αυτά τα ένζυμα ονομάζονται ισοένζυμα και είναι προϊόντα διαφορετικών γονιδίων. 9. Ποιοι παράγοντες επηρεάζουν την ταχύτητα μίας ενζυμικής αντίδρασης; Εξηγήστε σύντομα το ρόλο του καθενός. Η απάντηση βρίσκεται στην παράγραφο 4.3. (Παράγοντες που επηρεάζουν την ταχύτητα των ενζυμικών αντιδράσεων) και στην παράγραφο 4.4. (Κινητική ενζυμικών αντιδράσεων). 10. Η ταχύτητα μίας ενζυμικής αντίδρασης αυξάνεται, όσο αυξάνεται η συγκέντρωση του υποστρώματος, έως ότου φτάσει σε ένα μέγιστο σημείο (Vmax), πέρα από το οποίο δεν παρατηρείται μεταβολή. Σε ποιον από τους παρακάτω λόγους οφείλεται αυτό; α. Όλο το υπόστρωμα έχει κατανα Χωθεί. β. Όλα τα μόρια του ενζύμου έχουν καταληφθεί από μόρια υποστρώματος. γ. Έχει επέλθει φθορά των ενζυμικών μορίων. Η σωστή απάντηση είναι η (β). 11. Σε τι διαφέρουν τα συνένζυμα από τις προσθετικές ομάδες; Οι προσθετικές ομάδες είναι οργανικές ενώσεις πολύ ισχυρά δεμένες πάνω στα ένζυμα και δεν απομακρύνονται. Αντίθετα, τα συνένζυμα είναι χαλαρά προσδεδεμένα στα ένζυμα και απομακρύνονται εύκολα.

22 12. Ποιοι κίνδυνοι μπορεί να προκληθούν, κατά τη γνώμη σας, από: α. μία αποκλειστικά χορτοφαγική διατροφή, β. από μία διατροφή χωρίς φρέσκα λαχανικά και φρούτα; Από μία αποκλειστικά χορτοφαγική διατροφή (με βάση τα στοιχεία που αναφέρονται στον πίνακα των βιταμινών του βιβλίου) ο οργανισμός δεν προμηθεύεται ικανές ποσότητες βιταμίνης B, 2 και βιταμίνης D. Από μία διατροφή χωρίς φρέσκα λαχανικά και φρούτα ο οργανισμός δεν προμηθεύεται τις βιταμίνες C και Κ. 13. Σε ένα πείραμα εξετάζουμε τη μετατροπή ενός υποστρώματος σε προϊόν σε διάφορες τιμές ρη. Η συγκέντρωση του υποστρώματος, του ενζύμου, καθώς και η θερμοκρασία διατηρούνται σταθερά. Ο χρόνος διεξαγωγής του πειράματος είναι 10 λεπτά. Στο τέλος του πειράματος λαμβάνουμε τα δεδομένα που αναγράφονται στον πίνακα: Ποσοτητα προϊοντος (σε pg) α. Να γίνει η γραφική παράσταση των αποτελεσμάτων. Στον οριζόντιο άξονα τοποθετήστε τις τιμές ρη και στον κάθετο τα units (εκφράστε τα units σε μ προϊόντος ανά λεπτό). β. Σε ποιο ρη λειτουργεί καλύτερα το ένζυμο; γ. Γιατί διατηρήσαμε τις υπόλοιπες παραμέτρους σταθερές;

23 ο α. (units) (ΡΗ) β. Το ένζυμο λειτουργεί καλύτερα σε ρη=5. γ. Διατηρήσαμε τις υπόλοιπες παραμέτρους (συγκέντρωση ενζύμου, συγκέντρωση υποστρώματος, θερμοκρασία, χρόνο επώασης) σταθερές, γιατί θέλαμε να μελετήσουμε μόνο την επίδραση του ρη στην ενζυμική ενεργότητα. Όλες οι παράμετροι που αναφέραμε επηρεάζουν την ταχύτητα της ενζυμικής αντίδρασης, ενώ σε περίπτωση που υπήρχε διακύμανσή τους δε θα ήμασταν σε θέση να αποδώσουμε αποκλειστικά στην επίδραση του ρη τις μεταβολές στην ενεργότητα του ενζύμου.

24 ΚΕΦΑΛΑΊΟ 5 ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ I. Οι δύο αλυσίδες του DNA είναι συμπληρωματικές μεταξύ τους και αντιπαράλληλες. Εξηγήστε. Οι δύο αλυσίδες του DNA αποτελούνται από συμπληρωματικές μεταξύ τους βάσεις. Εάν η αλληλουχία των βάσεων σε ένα τμήμα της μίας αλυσίδας είναι, για παράδειγμα, ATGCAC, η αλληλουχία στο αντίστοιχο τμήμα της απέναντι αλυσίδας θα είναι TACGTG. Οι δύο αλυσίδες καλούνται μεταξύ τους συμπληρωματικές. Στη διπλή έλικα η μία αλυσίδα έχει κατεύθυνση 5'-->3', ενώ η συμπληρωματική της έχει κατεύθυνση 3'->5'. Οι δύο αλυσίδες καλούνται μεταξύ τους αντιπαράλληλες. Κάθε άκρο της διπλής έλικας αποτελείται από το 5' άκρο της μίας αλυσίδας και το 3' άκρο της άλλης. 2. α. Πώς συγκρατούνται οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA μεταξύ τους; β. Ποια η διαφορά νουκλεοσιδίου - νουκλεοτιδίου; γ. Ποια η διαφορά νουκλεοτιδίου - νουκλεϊνικού οξέος; α. Οι δύο αλυσίδες του DNA συγκρατούνται μεταξύ τους με δεσμούς υδρογόνου και δημιουργούν τη διπλή έλικα. β. Το νουκλεοσίδιο αποτελείται από μία πεντόζη και μία αζωτούχα βάση. Εάν στο νουκλεοσίδιο προστεθεί μία φωσφορική ομάδα (ή δύο ή τρεις), προκύπτει το νουκλεοτίδιο. γ. Τα νουκλεοτίδια -δεσοξυριβονουκλεοτίδια και ριβονουκλεοτίδια- είναι τα μονομερή των νουκλεϊνικών οξέων DNA και RNA. Τα νουκλεϊνικά οξέα προκύπτουν από τον πολυμερισμό των νουκλεοτιδίων. 3. Ποιες οι διαφορές μεταξύ DNA και RNA; Στο DNA το σάκχαρο είναι η δεσοξυριβόζη, ενώ στο RNA είναι η ριβόζη. Στο DNA βρίσκεται αποκλειστικά η βάση θυμίνη, ενώ στο RNA η βάση ου-

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ 19-21 -10681 210 3824614 210 3847670 www.irakleitos.gr ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 04/06/2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ Α A1. γ A2. δ A3. α) Σ β) Λ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΘΕΜΑ Α Α.1. γ Α.2. δ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Α.. α. Σωστό, β. Λάθος,

Διαβάστε περισσότερα

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001

Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 Χηµεία-Βιοχηµεία Τεχνολογικής Κατεύθυνσης Γ Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο 1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 22/05/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: XHMEIA-BIOXHMEIA ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α A1. δ A2. β A3. Λάθος

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Χηµείας Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο

Διαβάστε περισσότερα

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 2000. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Ζήτηµα 1ο Θέµατα Χηµείας - Βιοχηµείας Τεχνoλογικής Κατεύθυνσης Γ Λυκείου 000 Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ένα υδατικό διάλυµα χαρακτηρίζεται ουδέτερο στους

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΑΠΑΝΤΗΣΕΙΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 16/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΟΚΤΩ (8) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Για τις προτάσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και, δίπλα, το γράμμα που αντιστοιχεί στη σωστή επιλογή. Α1. Ποιο

Διαβάστε περισσότερα

5 ο Κ Ε Φ Α Λ Α Ι Ο ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

5 ο Κ Ε Φ Α Λ Α Ι Ο ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 5 ο Κ Ε Φ Α Λ Α Ι Ο ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

ΑΠΑΝΤΗΣΕΙΣ. Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Για τις ερωτήσεις Α1 έως Α3 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Το συζυγές οξύ της ΝΗ 3 είναι: α. ΝΗ 2 - β.νa

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ. δ. S 2 Μονάδες 4 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (1ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ. Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (1ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Α. δ Α2 Α3 Α4 Α5 α Σ Λ Σ Λ Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ (ος Κύκλος) ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Ηµεροµηνία: Τετάρτη 5 Απριλίου 205 ιάρκεια Εξέτασης: 3 ώρες Α: CH3CH2COOCH2CH3 Β:

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1.

Μονάδες 6 ΘΕΜΑ Β. ιαθέτουμε υδατικό διάλυμα CH 3 COONa συγκέντρωσης 0,1 Μ ( ιάλυμα 1 ). Β1. Να υπολογίσετε το ph του διαλύματος 1. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 21 ΜΑΪΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5

συμπεριφέρεται ως α. βάση. β. οξύ. γ. πρωτονιοδότης. δ. αμφολύτης. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΘΕΜΑ 1ο 1.1 1.2 1.1. γ. Μονάδες 5 1.2. Μονάδες 5

ΘΕΜΑ 1ο 1.1 1.2 1.1. γ. Μονάδες 5 1.2. Μονάδες 5 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τις

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ Για τις ηµιτελείς προτάσεις Α1 και Α2 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης

Διαβάστε περισσότερα

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες

Είναι σημαντικές επειδή: Αποτελούν βασικά δοµικά συστατικά του σώµατος Εξυπηρετούν ενεργειακές ανάγκες Ασκούν έλεγχο σε όλες τις βιοχηµικές διεργασίες ΕΞΕΤΑΣΤΕΑ ΥΛΗ ΕΝΟΤΗΤΑ 2: Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 2.1 ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά) 2.2 ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ ΤΟΥ ΣΗΜΑΣΙΑ, 9 14 (απλή αναφορά), 2.4 ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ, σελ. 20 36 Οργανικές Ουσίες

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ 005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το

Διαβάστε περισσότερα

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5

1.1 Η συζυγής βάση του Η 2 SO 4 είναι α. SO 4 2. β. HSO 4. γ. H 2 SO 3. δ. H 2 S. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

1.2. Ένα υδατικό διάλυμα έχει ph = 5 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει α. ΝΗ 3. β. HCOOH. γ. HCOONa. δ. KCl.

1.2. Ένα υδατικό διάλυμα έχει ph = 5 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει α. ΝΗ 3. β. HCOOH. γ. HCOONa. δ. KCl. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΛΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τις ερωτήσεις 1.1 και 1.2 και δίπλα στη κάθε µία το γράµµα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τις ερωτήσεις 1.1 και 1.2 και δίπλα στη κάθε µία το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τις ερωτήσεις 1.1 και 1. και δίπλα στη κάθε µία το γράµµα που αντιστοιχεί στη σωστή απάντηση: 1.1. Ποιο από τα παρακάτω υδατικά διαλύµατα στους 5 ο C έχει τη µεγαλύτερη

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2004

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2004 ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 1 Ι. Στην ακόλουθη εικόνα παρουσιάζονται σχηματικά δύο χημικές αντιδράσεις. Να απαντήσετε στις ερωτήσεις: α) Πώς χαρακτηρίζονται τα χημικά μόρια Α και Β; Πώς χαρακτηρίζεται

Διαβάστε περισσότερα

Μονάδες 5 1.2.α. Να γράψετε στο τετράδιό σας τον παρακάτω πίνακα σωστά συμπληρωμένο.

Μονάδες 5 1.2.α. Να γράψετε στο τετράδιό σας τον παρακάτω πίνακα σωστά συμπληρωμένο. ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΠΡΟΑΓΩΓΙΚΕ ΕΞΕΣΑΕΙ Γ ΣΑΞΗ ΕΝΙΑΙΟΤ ΛΤΚΕΙΟΤ ΔΕΤΣΕΡΑ 12 ΙΟΤΝΙΟΤ 2000 ΕΞΕΣΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΣΕΧΝΟΛΟΓΙΚΗ ΚΑΣΕΤΘΤΝΗ (ΚΤΚΛΟ ΣΕΧΝΟΛΟΓΙΑ ΚΑΙ ΠΑΡΑΓΩΓΗ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΝΟΛΟ ΕΛΙΔΩΝ: ΕΠΣΑ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2006 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα

Διαβάστε περισσότερα

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Ενδεικτική διδακτική προσέγγιση ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ενδεικτική διδακτική προσέγγιση Ε νότητα 1 ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ 30 Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει να έχει: Διαπιστώσει ότι τα χημικά στοιχεία που

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Δίνονται: Κ a CH 3 COOH = 10 5, Κ b NH 3 = 10 5 Μονάδες 3 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΓΕΝΙΚΥ ΛΥΚΕΙΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΥ 2013 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΧΗΜΕΙΑ ΤΕΧΝΛΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΣ ΤΕΧΝΛΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΛ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ)

ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. της Νικολέτας Ε. 1. Να οξειδωθούν και να παράγουν ενέργεια. (ΚΑΤΑΒΟΛΙΣΜΟΣ) ΕΡΓΑΣΙΑ ΣΤΟ ΜΑΘΗΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ της Νικολέτας Ε. 3ο Κεφάλαιο Περιληπτική Απόδοση 3.1. Ενέργεια και οργανισμοί Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται

Διαβάστε περισσότερα

Επιμέλεια: Ομάδα Χημικών της Ώθησης ΑΠΑΝΤΗΣΕΙΣ

Επιμέλεια: Ομάδα Χημικών της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Χημικών της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Παρασκευή, 22 Μαΐου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΘΕΜΑ A Για τις προτάσεις Α1 και Α2 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και,

Διαβάστε περισσότερα

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ

3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ 3 ο Κ Ε Φ Α Λ Α Ι Ο ΠΡΩΤΕΪΝΕΣ Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Ερωτήσεις πολλαπλής επιλογής Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

Ανακτήθηκε από την ΕΚΠΑΙΔΕΥΤΙΚΗ ΚΛΙΜΑΚΑ http://edu.klimaka.gr ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι:

Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Συνδυάζοντας το πρώτο και το δεύτερο θερμοδυναμικό αξίωμα προκύπτει ότι: Για να είναι μια αντίδραση αυθόρμητη, πρέπει η μεταβολή της ελεύθερης ενέργειας της αντίδρασης να είναι αρνητική. Η μεταβολή της

Διαβάστε περισσότερα

1.2. Ένα υδατικό διάλυμα έχει ph = 5 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει α. ΝΗ 3. β. HCOOH. γ. HCOONa. δ. KCl.

1.2. Ένα υδατικό διάλυμα έχει ph = 5 στους 25 ο C. Το διάλυμα αυτό μπορεί να περιέχει α. ΝΗ 3. β. HCOOH. γ. HCOONa. δ. KCl. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΛΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4. Να συμπληρώσετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α

Φ ΣΙ Σ Ο Ι Λ Ο Ο Λ Γ Ο Ι Γ Α Δηµοκρίτειο Πανεπιστήµιο Θράκης Τµήµα Αγροτικής Ανάπτυξης Οξείδωση της γλυκόζης ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ «Καταβολισµός ή ανοµοίωση» C 6 H 12 O+6O 2 +6H 2 O 12H 2 O+6CO 2 +686 Kcal/mol Πηγές ενέργειας κατά την

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ÊÏÑÕÖÇ ΕΚΦΩΝΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 ο ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία. Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου :

Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία. Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : Τμήμα Τεχνολογίας Τροφίμων ΤΕΙ Αθήνας Εαρινό Εξάμηνο 2006 2007 a 1 η Εξέταση στην Βιοχημεία Ονοματεπώνυμο : Τυπικό εξάμηνο : Αριθμός Μητρώου : 1. Στο παρακάτω διάγραμμα του κύκλου του Krebs να σημειωθούν

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί

3.1 Ενέργεια και οργανισμοί Δημήτρης Η. Β 1 25.3.14 3 Ο Κεφάλαιο 3.1 Ενέργεια και οργανισμοί Η ενέργεια έχει κεντρική σημασία για έναν οργανισμό, γιατί ό,τι και να κάνουμε χρειαζόμαστε ενέργεια. Ο κλάδος της βιολογίας που ασχολείται

Διαβάστε περισσότερα

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου

Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Χαρίλαος Μέγας Ελένη Φωτάκη Ελευθέριος Νεοφύτου Απαντήσεις στις ερωτήσεις: Πρόλογος Το βιβλίο αυτό γράφτηκε για να βοηθήσει το μαθητή της Γ Γυμνασίου στην κατανόηση των θεμελιωδών γνώσεων της Βιολογίας

Διαβάστε περισσότερα

Καθηγητής Δ. Μόσιαλος

Καθηγητής Δ. Μόσιαλος Μικροβιολογία-Ιολογία Επίκουρος Καθηγητής Καθηγητής Δ. Μόσιαλος Βιοενεργητική μικροβίων Βακτηριακή Γενετική Επισκόπηση Βακτηριοφάγων Προκαρυωτική ποικιλότητα (Βακτήρια) Προκαρυωτική ποικιλότητα (Αρχαία)

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr π. Αναστάσιος Ισαάκ Λύκειο Παραλιμνίου Δεκέμβριος 2013 www.biomathia.webnode.gr EΞΕΤΑΣΤΕΑ ΥΛΗ: ΕΝΟΤΗΤΑ 8: Η ελευθέρωση της ενέργειας, σελ. 155-168 ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η κυτταρική αναπνοή είναι η διαδικασία

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ

ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛ. ΜΑΚΡΟΜΟΡΙΑ 1 ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ 2010 2 ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ ΚΕΦΑΛΑΙΟ ΠΡΩΤΟ ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ-ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Βιολογία είναι η επιστήμη

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1 ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

ΑΡΧΗ 2ΗΣ ΣΕΛΙ ΑΣ. 1.4 Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) ΣΥΝΟΛΟ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2013 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 013 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που

Διαβάστε περισσότερα

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο;

Μεταβολισμός του γλυκογόνου. Μεταβολισμός των υδατανθράκων κατά την άσκηση. Από που προέρχεται το μυϊκό και ηπατικό γλυκογόνο; Μεταβολισμός των υδατανθράκων κατά την άσκηση Μεταβολισμός του γλυκογόνου Το γλυκογόνο είναι ο αφθονότερος υδατάνθρακας των ζώων Το γλυκογόνο αποθηκεύεται κυρίως στο ήπαρ (3-7% κατά βάρος) και στους μύες

Διαβάστε περισσότερα

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ

Εργασία Βιολογίας 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Εργασία Βιολογίας Καθηγητής: Πιτσιλαδής Β. Μαθητής: Μ. Νεκτάριος Τάξη: Β'2 Υλικό: Κεφάλαιο 3 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΜΕΤΑΒΟΛΙΣΜΟΣ Την ενέργεια και τα υλικά που οι οργανισμοί εξασφαλίζουν από το περιβάλλον

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Μαντώ Κυριακού 2015 Ενεργειακό Στα βιολογικά συστήματα η διατήρηση της ενέργειας συμπεριλαμβάνει οξειδοαναγωγικές αντιδράσεις παραγωγή ATP Οξείδωση: απομάκρυνση e από ένα υπόστρωμα

Διαβάστε περισσότερα

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ο αριθμός mol OH ΘΕΜΑ Α Στις ερωτήσεις Α1 και Α να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΥΣ ΚΑΘΗΓΗΤΕΣ κύριο ΚΕΦΑΛΛΩΝΙΤΗ ΓΙΑΝΝΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που

3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που 3.1 Ενέργεια και οργανισμοί Όλοι οι οργανισμοί με εξαίρεση τους φωτοσυνθετικούς εξασφαλίζουν την απαραίτητη ενέργεια διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Αντίθετα οι φωτοσυνθετικοί,

Διαβάστε περισσότερα

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF.

1.2. Να γράψετε στο τετράδιό σας την παρακάτω πρόταση. Από τα παρακάτω ζεύγη ουσιών ρυθµιστικό διάλυµα είναι το α. HF / NaF. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΥΤΕΡΑ 10 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ A ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Κεφάλαιο τρίτο. 3.1: Ενέργεια και οργανισμοί

Κεφάλαιο τρίτο. 3.1: Ενέργεια και οργανισμοί Κεφάλαιο τρίτο 3.1: Ενέργεια και οργανισμοί Όλοι οι οργανισμοί εξασφαλίζουν την ενέργεια που χρειάζονται με την διάσπαση των θρεπτικών ουσιών της τροφής τους. Οι οργανισμοί που έχουν την ικανότητα να φωτοσυνθέτουν

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ Θέμα Α ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες

Οργανική Χημεία. Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες Οργανική Χημεία Κεφάλαιο 27: Βιομόρια, αμινοξέα, πεπτίδια και πρωτεΐνες 1. Γενικά Πρωτεΐνες: μεγάλα βιομόρια που απαντούν σε όλους τους ζωντανούς οργανισμούς Διαφορετικά είδη πρωτεϊνών με ποικίλη βιολογική

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ-ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα