ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5."

Transcript

1 ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: Β2. α. DNA πολυµεράση β. πριµόσωµα. γ. DNA δεσµάση. δ. DNA ελικάση. ε. RNA πολυµεράση. Β3. Η διάγνωση των γενετικών ασθενειών µπορεί να πραγµατοποιηθεί : Με τη µελέτη του καρυοτύπου, όπως για παράδειγµα κατά τον προγεννητικό έλεγχο. Με διάφορες βιοχηµικές δοκιµασίες. Με την ανάλυση της αλληλουχίας των βάσεων του DNA (µοριακή διάγνωση). Β4. ιαγονιδιακά ονοµάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθεί το γενετικό υλικό τους µε την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδος. Β5. Με τον όρο ζύµωση εννοούµε τη διαδικασία ανάπτυξης µικροοργανισµών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες. Ο όρος ζύµωση παλαιότερα χρησιµοποιείτο µόνο για αναερόβιες διεργασίες αλλά σήµερα χρησιµοποιείται µε την ευρεία έννοια και περιλαµβάνει όλες τις διεργασίες, αερόβιες και αναερόβιες. Τα προϊόντα της ζύµωσης είναι είτε τα ίδια τα κύτταρα που ονοµάζονται βιοµάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά. 1

2 ΘΕΜΑ Γ Αρχικά προσπαθούµε να αποδείξουµε εάν το αλληλόµορφο γονίδιο που καθορίζει την ασθένεια κληρονοµείται µε επικρατή ή υπολειπόµενο τρόπο και στη συνέχεια εάν κληρονοµείται µε αυτοσωµικό ή φυλοσύνδετο τρόπο. Γ1. Από το γενεαλογικό δένδρο παρατηρούµε ότι γονείς που δεν έχουν την ασθένεια, τα άτοµα Ι1 και Ι2 αποκτούν παιδί µε την ασθένεια, το άτοµο ΙΙ3. Έτσι διαπιστώνουµε ότι το αλληλόµορφο γονίδιο που είναι υπεύθυνο για την ασθένεια κληρονοµείται µε υπολειπόµενο τρόπο. Αυτό γιατί εάν ήταν επικρατές, τότε οι γονείς, τα άτοµα I1 και I2, θα έπρεπε να είναι οµόζυγοι για το υπολειπόµενο αλληλόµορφο, ενώ το παιδί τους το άτοµο II3, θα έπρεπε να έχει ένα τουλάχιστον επικρατές αλληλόµορφο (άτοπο). Αναλυτικότερα, επιτελώντας και τις κατάλληλες διασταυρώσεις για να απορρίψουµε την περίπτωση το αλληλόµορφο γονίδιο για την ασθένεια να κληρονοµείται µε επικρατή τρόπο έχουµε: Αν είναι αυτοσωµικό: Αν είναι φυλοσύνδετο: P 1(υγιείς γονείς) αα ( ) αα Γαµέτες α α F 1 αα Φαινοτυπική αναλογία 100% υγιείς (άτοπο) P 1(υγιείς γονείς) Χ α Χ α ( ) Χ α Υ Γαµέτες Χ α Χ α, Υ F 1 Χ α Χ α, Χ α Υ Φαινοτυπική αναλογία 100% υγιείς (άτοπο) Εποµένως αποκλείεται το αλληλόµορφο που είναι υπεύθυνο για την ασθένεια να κληρονοµείται µε επικρατή τρόπο. Άλλωστε γνωρίζουµε ότι στην επικρατή κληρονοµικότητα, κάθε ασθενής έχει έναν τουλάχιστον ασθενή γονέα. Άρα το αλληλόµορφο που είναι υπεύθυνο για την ασθένεια κληρονοµείται µε υπολειπόµενο τρόπο. Γ2. Επιπρόσθετα, από το παραπάνω γενεαλογικό δένδρο παρατηρούµε, ότι πατέρας που δεν έχει την ασθένεια, το άτοµο ΙI4, αποκτά κόρη µε την ασθένεια, το άτοµο III1. Έτσι διαπιστώνουµε ότι το αλληλόµορφο που καθορίζει την ασθένεια αποκλείεται να κληρονοµείται µε φυλοσύνδετο τρόπο. Αυτό γιατί γνωρίζουµε ότι τα θηλυκά άτοµα παίρνουν από ένα Χ φυλετικό χρωµόσωµα από τους δύο γονείς τους. Έτσι από τη στιγµή που αποδείξαµε ότι το αλληλόµορφο που καθορίζει την ασθένεια κληρονοµείται µε υπολειπόµενο τρόπο, εάν θεωρούσαµε ότι το υπολειπόµενο αλληλόµορφο είναι φυλοσύνδετο τότε το άτοµο III1 θα είχε γονότυπο Χ α Χ α. Έτσι θα έπρεπε να κληρονοµήσει το ένα Χ α υπολειπόµενο αλληλόµορφο από τον πατέρα της. Εποµένως το άτοµο ΙΙ4 θα είχε γονότυπο Χ α Υ και θα έπασχε (άτοπο). Άρα το αλληλόµορφο που καθορίζει την ασθένεια κληρονοµείται µε αυτοσωµικό τρόπο. 2

3 Γ3. Οι πιθανοί γονότυποι των ατόµων θα είναι: Συµβολισµός Αλληλοµόρφου ΙΙ 1 : Αα ή ΑΑ ΙΙ 2 : Αα ή ΑΑ ΙΙ 3 : αα ΙΙ 4 : Αα Ιδιότητα που ελέγχει το αλληλόµορφο Α: Επικρατές αλληλόµορφο υπεύθυνο για τη µη εµφάνιση του χαρακτηριστικού α: Υπολειπόµενο αλληλόµορφο γονίδιο υπεύθυνο για την έκφραση του χαρακτηριστικού Πιθανοί γονότυποι Αα ή ΑΑ Γ4. Οι ανιχνευτές είναι ιχνηθετηµένα µόρια DNA ή RNA που περιέχουν αλληλουχίες συµπληρωµατικές προς το κλωνοποιηµένο DNA. Οι ανιχνευτές αναµειγνύονται µε το DNA της βιβλιοθήκης (το οποίο έχει αποδιαταχθεί) και υβριδοποιούν µόνο το συµπληρωµατικό τους DNA. Οι διαδικασίες που θα ακολουθηθούν προκειµένου ο ανιχνευτής να υβριδοποιήσει την κατάλληλη αλληλουχία DNA είναι: Αν επιδράσουµε στο DNA που αποµονώθηκε από τα τέσσερα άτοµα µε κατάλληλες χηµικές ουσίες ή αυξήσουµε τη θερµοκρασία τότε σπάζουν οι δεσµοί υδρογόνου µεταξύ των δύο συµπληρωµατικών αλυσίδων και οι δύο αλυσίδες αποχωρίζονται η µία από την άλλη. Η διαδικασία αυτή λέγεται αποδιάταξη. Οι δύο µονόκλωνες συµπληρωµατικές αλυσίδες σε κατάλληλες συνθήκες µπορούν να επανασυνδεθούν. Στην ιδιότητα αυτή στηρίζεται η διαδικασία της υβριδοποίησης που είναι η σύνδεση µονόκλωνων συµπληρωµατικών αλυσίδων DNA ή συµπληρωµατικών DNA-RNA. Η υβριδοποίηση είναι µια πολύ σηµαντική ιδιότητα του DNA που µας δίνει τη δυνατότητα αν έχουµε ένα γνωστό µόριο DNA, να το χρησιµοποιήσουµε ως ανιχνευτή για τον εντοπισµό του συµπληρωµατικού του. Τέλος, ο ανιχνευτής αναµειγνύεται µε τα τµήµατα DNA (τα οποία έχουν αποδιαταχθεί) που αποµονώθηκαν από τα τέσσερα άτοµα και υβριδοποιεί µόνο το συµπληρωµατικό του DNA, δηλαδή το µεταλλαγµένο αλληλόµορφο γονίδιο α. Επίσης θα πρέπει να αναφέρουµε ότι ο άνθρωπος είναι διπλοειδής οργανισµός, δηλαδή το γενετικό υλικό υπάρχει σε δύο δόσεις. ηλαδή το κάθε άτοµο φέρει δύο µόρια DNA στα οποία θα εδράζονται τα γονίδια που καθορίζουν την έκφραση της παραπάνω ασθένειας. ηλαδή από το κάθε άτοµο αποµονώθηκαν δύο µόρια DNA. Συνεπώς: Το άτοµο ΙΙ1 θα έχει γονότυπο ΑΑ εφόσον ο ανιχνευτής δεν υβριδοποιεί κανένα µόριο DNA. Το άτοµο ΙΙ2 θα έχει γονότυπο Αα εφόσον ο ανιχνευτής υβριδοποιεί το ένα από τα δύο µόρια DNA. Γ5. Γνωρίζουµε ότι τα άτοµα που πάσχουν από το σύνδροµο Klinefelter, είναι αρσενικά άτοµα και έχουν χρωµοσωµική σύσταση φυλετικών χρωµοσωµάτων ΧΧΥ, έχουν δηλαδή ένα παραπάνω Χ φυλετικό χρωµόσωµα. Επιπρόσθετα, το γονίδιο που είναι υπεύθυνο για την εµφάνιση της µερικής αχρωµατοψίας στο πράσινο και στο κόκκινο αα 3

4 ΘΕΜΑ κληρονοµείται µε υπολειπόµενο φυλοσύνδετο τρόπο και συµβολίζεται µε Χ α. Το φυσιολογικό αλληλόµορφο του συµβολίζεται µε Χ Α και είναι επικρατές. Εφόσον το άτοµο πάσχει και από µερική αχρωµατοψία θα έχει γονότυπο Χ α Χ α Υ. Με βάση το γεγονός ότι οι γονείς έχουν φυσιολογική όραση και η µερική αχρωµατοψία ελέγχεται από φυλοσύνδετο υπολειπόµενο γονίδιο οι γονότυποι των δύο γονέων θα είναι : Χ Α Χ α, Χ Α Υ. ιαπιστώνουµε ότι συνέβη µη διαχωρισµός των αδερφών χρωµατίδων του Χ α φυλετικού χρωµοσώµατος κατά την 2 η µειωτική διαίρεση των άωρων γεννητικών κυττάρων της µητέρας. Έτσι, δηµιουργήθηκε θηλυκός γαµέτης µε ένα παραπάνω φυλετικό χρωµόσωµα και πιο συγκεκριµένα µε Χ α Χ α φυλετικά χρωµοσώµατα, ο οποίος γονιµοποιήθηκε από φυσιολογικό αρσενικό γαµέτη µε Υ φυλετικό χρωµόσωµα και δηµιουργήθηκε έτσι άτοµο µε γονότυπο Χ α Χ α Υ. Σχηµατικά έχουµε: 1. Γνωρίζουµε ότι τόσο η κωδική αλυσίδα του DNA όσο και το mrna, είναι συµπληρωµατικά προς τη µεταγραφόµενη αλυσίδα του DNA. Έτσι, η µόνη τους διαφορά είναι ότι όπου στην κωδική αλυσίδα υπάρχει Τ στο mrna υπάρχει U. Εφόσον το κωδικόνιο έναρξης του mrna είναι το AUG µε κατεύθυνση 5 AUG 3, το αντίστοιχο κωδικόνιο στην κωδική αλυσίδα του DNA θα είναι το ATG και θα έχει κατεύθυνση 5 ATG 3. Επίσης, εφόσον τα κωδικόνια λήξης του mrna είναι τα 5 UAG 3 ή 5 UGA 3 ή 5 UAA 3, τα αντίστοιχα κωδικόνια στην κωδική αλυσίδα του DNA θα είναι τα 5 ΤAG 3 ή 5 ΤGA 3 ή 5 ΤAA 3. Τέλος, οι βάσεις ανάµεσα 4

5 στο κωδικόνιο έναρξης και το κωδικόνιο λήξης θα πρέπει να διαβάζονται ανά τριάδες (κώδικας τριπλέτας), συνεχόµενα χωρίς να παραλείπεται κάποιο νουκλεοτίδιο (συνεχής), καθώς κάθε νουκλεοτίδιο ανήκει σε µία µόνο τριπλέτα (µη επικαλυπτόµενος). Επίσης oι δύο αλυσίδες είναι αντιπαράλληλες, δηλαδή το 3' άκρο της µίας είναι απέναντι από το 5' άκρο της άλλης. Συνεπώς η κωδική αλυσίδα είναι η αλυσίδα Ι µε κατεύθυνση 5 3 από αριστερά προς τα δεξιά. 5 -A G C T A T G A C C A T G A T T A C G G A T T C A C T G 3 I 3 -T C G A C A C T G G T A C T A A T G C C T A A G T G A C 5 II 2. Η RNA πολυµεράση προσδένεται στον υποκινητή µε τη βοήθεια µεταγραφικών παραγόντων και προσθέτει συµπληρωµατικά ριβονουκλεοτίδια έναντι των δεοξυριβονουκλεοτιδίων της µη κωδικής αλυσίδας ενώνοντάς τα µε 3 5 φωσφοδιεστερικό δεσµό. Απέναντι από Α προσθέτει U, απέναντι από Τ προσθέτει Α και απέναντι από G προσθέτει C και αντίστροφα. Το mrna συντίθεται µε κατεύθυνση 5 3 µε µεταγραφή της µη κωδικής αλυσίδας µε βάση τον κανόνα της συµπληρωµατικότητας και της αντιπαραλληλίας. Εποµένως, το mrna που προκύπτει από τη µεταγραφή της µη κωδικής αλυσίδας φέρει την ακόλουθη αλληλουχία: 5 AGCUAUGACCAUGAUUACGGAUUCACUG 3 3. Κατά την έναρξη της µετάφρασης το mrna προσδένεται, µέσω µιας αλληλουχίας που υπάρχει στην 5' αµετάφραση περιοχή του, µε το ριβοσωµικό RNA της µικρής υποµονάδας του ριβοσώµατος, σύµφωνα µε τους κανόνες της συµπληρωµατικότητας των βάσεων. Άρα το τµήµα του mrna στο οποίο θα συνδεθεί η µικρή ριβοσωµική υποµονάδα κατά την έκφραση της µετάφρασης είναι η ακόλουθη: 5 AGCU 3 4. Εφόσον η µετάλλαξη συνέβη στο παραπάνω τµήµα και οδήγησε στην παραγωγή µια πρωτεΐνης µε δύο αµινοξέα λιγότερα διαπιστώνουµε ότι η γονιδιακή µετάλλαξη αντικατάστασης βάσης συνέβη στο κωδικόνιο έναρξης το οποίο καταστράφηκε. Έτσι η πρωτεϊνοσύνθεση ξεκινάει πλέον από το 3 ο κωδικόνιο, το οποίο αναγνωρίζει πλέον η RNA πολυµεράση ως νέο κωδικόνιο έναρξης (δηλαδή ATG). Οι γονιακές µεταλλάξεις αντικατάστασης βάσης µπορεί να προκληθούν είτε από λάθη που γίνονται κατά την αντιγραφή του DNA είτε από παράγοντες του περιβάλλοντος, που ονοµάζονται µεταλλαξογόνοι. 5. Στο οπερόνιο της λακτόζης περιλαµβάνονται εκτός από τα γονίδια που κωδικοποιούν τα ένζυµα που διασπούν τη λακτόζη σε γλυκόζη και γαλακτόζη, που ονοµάζονται δοµικά, και αλληλουχίες DNA που ρυθµίζουν τη µεταγραφή τους. Οι αλληλουχίες αυτές που βρίσκονται µπροστά από τα δοµικά γονίδια είναι κατά σειρά ένα ρυθµιστικό γονίδιο, ο υποκινητής και ο χειριστής. Το οπερόνιο της λακτόζης δε µεταγράφεται ούτε µεταφράζεται, όταν απουσιάζει από το θρεπτικό υλικό η λακτόζη. Τότε λέµε ότι τα γονίδια που το αποτελούν βρίσκονται υπό καταστολή. Πώς επιτυγχάνεται η καταστολή; ύο είναι τα ρυθµιστικά µόρια: µια αλληλουχία DNA, που ονοµάζεται χειριστής και βρίσκεται µεταξύ του υποκινητή και 5

6 του πρώτου γονιδίου, και µια ρυθµιστική πρωτεΐνη-καταστολέας. Όταν απουσιάζει η λακτόζη ο καταστολέας προσδένεται ισχυρά στο χειριστή και εµποδίζει την RNA πολυµεράση να αρχίσει τη µεταγραφή των γονιδίων του οπερονίου. Ο καταστολέας κωδικοποιείται από ένα ρυθµιστικό γονίδιο, που βρίσκεται µπροστά από τον υποκινητή. Το ρυθµιστικό γονίδιο µεταγράφεται συνεχώς και παράγει λίγα µόρια του καταστολέα. Τα µόρια αυτά προσδένονται συνεχώς στο χειριστή. Όταν στο θρεπτικό υλικό υπάρχει µόνο λακτόζη, τότε ο ίδιος ο δισακχαρίτης προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο χειριστή. Τότε η RNA πολυµεράση είναι ελεύθερη να αρχίσει τη µεταγραφή. Εφόσον ο αριθµός των βάσεων που προστέθηκαν µεταξύ του 3 ου και του 4 ου κωδικονίου είναι διαφορετικός του τρία ή πολλαπλασίων του, τότε η αλληλουχία των αµινοξέων δεν εµφανίζει πλέον πολλές οµοιότητες µε την αρχική. Εποµένως η πρωτεΐνη που θα παράγεται δε θα έχει τη λειτουργικότητα της πρωτεΐνης καταστολέα και δε θα συνδέεται πλέον ούτε µε το χειριστή, ούτε µε τη λακτόζη. Συνεπώς απουσία λακτόζης ο καταστολέας δε θα συνδέεται µε το χειριστή και τα τρία δοµικά γονίδια θα εκφράζονται χωρίς λόγο. Έτσι το βακτήριο θα παράγει άσκοπα τα τρία ένζυµα που διασπούν τη λακτόζη σε γλυκόζη και γαλακτόζη. ηλαδή θα καταναλώνει άσκοπα σηµαντικά ποσά ενέργειας κάτι που µπορεί να επηρεάσει την επιβίωσή του. 6

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 4 Ιουνίου 2014 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Β, Α2. Β, Α3. Δ, Α4. Γ, Α5. γ ΘΕΜΑ Β Β1. 1 Α, 2 Γ, 3 Α,4 Β, 5 Α, 6 Α, 7 Γ Β2. Βλ. σχολικό βιβλίο, σελ.24(έκδοση 2014-15)

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ ΘΕΜΑ Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΟΣ Β1. 1 Α, 2 Γ, 3 Α, 4 Β, 5 Α, 6 Α, 7 - Γ Β2. Τα χρωµοσώµατα ταξινοµούνται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ. Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου. ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΠΡΟΤΕΙΝΟΜΕΝΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. α, Α2 γ, Α3 γ, Α4 δ, Α5 β ΘΕΜΑ Β Β1. 1Γ, 2Β, 3Α, 4Α, 5Γ, 6Α Β2. Σελ 136 σχ. βιβλίου: «Η κλωνοποίηση όμως... συγγενικό είδος ζώου.»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις στα θέματα των Εισαγωγικών Εξετάσεων τέκνων Ελλήνων του Εξωτερικού και τέκνων Ελλήνων Υπαλλήλων στο εξωτερικό 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. δ Α4. α Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2016

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2016 ΘΕΜΑ Α Α1) β Α2) β Α3) δ Α4) γ Α5) γ ΘΕΜΑ Β Β1. 1 Α Β2. 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Κάθε φυσιολογικό

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α : Α1. δ, Α2. γ, Α3. β, Α4. β, Α5. β Θέμα Β : Β1. Σελ.123 η παράγραφος με τίτλο «Ανοσοδιαγνωστικά» Β2. α-8, β-1, γ-6, δ-5, ε-7, στ-3 Β3. Σελ. 84

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ II ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2010 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ ËÁÌÉÁ ΘΕΜΑ Α Α1: δ Α2: δ Α3: β Α4: γ Α5: α ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ 2017 ΑΠΑΝΤΗΣΕΙΣ Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII - Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Αυτό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ)

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2013 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2013 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2013 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Nα γράψετε στο τετράδιό σας τον αριθµό κάθε µίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα, που αντιστοιχεί στη λέξη ή στη φράση, η

Διαβάστε περισσότερα

ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ

ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΚΑΤΕΥΘΥΝΣΗΣ 2012

ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΚΑΤΕΥΘΥΝΣΗΣ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2012 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΩΝ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ 2009 ΘΕΜΑ ο. γ. 2. γ. 3. β. 4. α. 5. δ. ΘΕΜΑ 2 ο. Σελ.

Διαβάστε περισσότερα

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α A1. α Α2. β Α3. α Α4. β Α5. α ΘΕΜΑ Β Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ Β1. Καρυότυπος είναι η απεικόνιση

Διαβάστε περισσότερα