UNIVERSITY OF PATRAS SCHOOL OF HEALTH SCIENCES DEPARTMENT OF PHARMACY DOCTORAL THESIS

Transcript

1 UNIVERSITY OF PATRAS SCHOOL OF HEALTH SCIENCES DEPARTMENT OF PHARMACY DOCTORAL THESIS Title: Development and validation of phosphonate-based inhibitors and activity-based probes (ABPs) for detection and pharmacological targeting of kallikreins EVANGELOS BISYRIS Pharmacist Patras April 2021

2 Copyright University of Patras, Pharmacy Department Evangelos Bisyris 2021 All rights reserved

3 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Τι λος: Ανάπτυξη και αξιολόγηση φωσφονικών αναστολέων και ιχνηθετών ενεργότητας (ABPs) για την ανι χνευση και φαρμακολογική στόχευση των καλλικρεϊνών ΕΥΑΓΓΕΛΟΣ ΜΠΙΣΥΡΗΣ Φαρμακοποιός Πάτρα Απρι λι ς 2021

4 Πνευματικά Δικαιώματα Ευάγγελος Μπισύρης Πανεπιστη μιο Πατρω ν, Τμη μα Φαρμακευτικη ς Με την επιφύλαξη παντός δικαιω ματος Σύμφωνα με τις διατάξεις του ν.2121/1993 απαγορεύεται η αναδιατύπωση η αναπαραγωγη της παρούσας Διδακτορικη ς Διατριβη ς στο σύνολό της η τμημάτων τη; με οποιονδη ποτε τρόπο. Ε λε χος πρωτοτυπιά για αποφυγη ογοκλοπη : Ο συγγραφέας της παρούσης Διδακτορικη ς Διατριβη ς, Ευάγγελος Μπισύρης, φέρει αποκλειστικά την ευθύνη ότι το περιεχόμενο αυτη ς, στο σύνολό της, δεν αποτελεί προϊόν λογοκλοπη ς. Η Επιβλέπουσα Γεωργία Σωτηροπούλου, καθω ς και τα λοιπά μέλη της Επταμελούς Εξεταστικη ς Επιτροπη ς δεν φέρουν καμία ευθύνη για το περιεχόμενο της παρούσας Διδακτορικη ς Διατριβη ς. Το κείμενο στο σύνολό του ελέγχθηκε επιτυχω με τη διαδικτυακη εφαρμογη Turnitin που διατίθεται/συνιστάται από το Πανεπιστη μιο Πατρω ν για την εξακρίβωση της πρωτοτυπίας. Το αποτέλεσμα του ελέγχου Turnitin κατατίθεται στο τέλος της παρούσης. iv

5 ADVISORY COMMITTEE Georgia Sotiropoulou, Professor, Supervisor Department of Pharmacy, School of Health Sciences, University of Patras Sofia Antimisiaris, Professor Department of Pharmacy, School of Health Sciences, University of Patras Georgios Pampalakis, Assistant Professor Department of Pharmacy, School of Health Sciences, Aristotle University of Thessaloniki EXAMINATION COMMITTEE Georgia Sotiropoulou, Professor, Supervisor Department of Pharmacy, School of Health Sciences, University of Patras Sofia Antimisiaris, Professor Department of Pharmacy, School of Health Sciences, University of Patras Georgios Pampalakis, Assistant Professor Department of Pharmacy, School of Health Sciences, Aristotle University of Thessaloniki Plato A. Magriotis, Associate Professor Department of Pharmacy, School of Health Sciences, University of Patras Gerasimos Tsivgoulis, Associate Professor Department of Chemistry, University of Patras Vasiliki Magafa, Assistant Professor Department of Pharmacy, School of Health Sciences, University of Patras Κonstantinos Xanthopoulos, Assistant Professor Department of Pharmacy, School of Health Sciences, Aristotle University of Thessaloniki v

6

7 ΤΡΙΜΕΛΗΣ ΣΥΜΒΟΥΛΕΥΤΙΚΗ ΕΠΙΤΡΟΠΗ Γεωργι Σωτηροπου λου, Καθηγη τρια, Επιβλε πουσα Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Σοφιά Α τιμησιάρη, Καθηγη τρια Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Γεώργιος Παμπαλάκης, Επίκουρος Καθηγητη ς Τμη μα Φαρμακευτικη ς, Αριστοτέλειο Πανεπιστη μιο Θεσσαλονίκης ΕΠΤΑΜΕΛΗΣ ΕΞΕΤΑΣΤΙΚΗ ΕΠΙΤΡΟΠΗ Γεωργι Σωτηροπου λου, Καθηγη τρια, Επιβλε πουσα Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Σοφιά Α τιμησιάρη, Καθηγη τρια Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Γεώργιος Παμπαλάκης, Επίκουρος Καθηγητη ς Τμη μα Φαρμακευτικη ς, Αριστοτέλειο Πανεπιστη μιο Θεσσαλονίκης Πλάτων Μαγκριώτης, Αναπληρωτη ς Καθηγητη ς Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Γεράσιμος Τσιβγου λη Αναπληρωτη ς Καθηγητη ς Τμη μα Χημείας, Σχολη Φυσικω ν Ε ιστημω ν, Πανεπιστη μιο Πατρω ν Βασιλική Μαγκαφά, Επίκουρη Καθηγη τρια Τμη μα Φαρμακευτικη ς, Σχολη Επιστημω ν Υ είας, Πανεπιστη μιο Πατρω Κωνσταντι νος ανθόπουλος, Επίκουρος Καθηγητη ς Τμη μα Φαρμακευτικη ς, Αριστοτέλειο Πανεπιστη μιο Θεσσαλονίκης

8

9 Στον γιο μου Ηλία και την γυναίκα μου Νατάσα

10

11 ΕΥΧΑΡΙΣΤΙΕΣ Θα η θελα να ευχαριστη σω την Επιβλέπουσα Καθηγη τριά μου κα Γεωργία Σωτηροπούλου για την ευκαιρία και τη δυνατότητα να εκπονη σω αυτη τη Διδακτορικη Διατριβη. Είμαι ευγνω ων και θεωρω τον εαυτό μου πολύ τυχερό να την έχω Επιβλέπουσα, δεδομένου ότι χαίρει μεγάλης διεθνούς αναγνω ισης για την εις βάθος χρόνου εξελισσόμενη πορεία και ενασχόληση με τις Καλλικρεΐνες, μεταξύ των άλλων ερευνητικω ν της ενδιαφερόντων και σημαντικω ν επιτεύξεων. Η εκπόνηση της Διατριβη ς υπό την επίβλεψη της η ταν ένα μεγάλο μάθημα και πέρα από το επιστημονικό μέρος. Η σταθερότητα και η προση λωση της στις επιστημονικές αξίες, αλλά και στις αξίες της ζωη, η δικαιοσύνη, ο τρόπος και η μεθοδολογία με την οποία αντιμετωπίζει τις προκλη σεις που ανακύπτουν στην εξέλιξη της έρευνας, είναι λίγα μόνο από τα μαθη ματα που πη ρα από εκείνη και θα με συντροφεύουν εφεξη ς. Μεγάλη επίσης η ταν η τύχη μου και η ευγνωμοσύνη μου για το μέλος της Συμβουλευτικη ς Επιτροπη ς επίκουρο Καθηγητη κ. Γεω ργιο Παμπαλάκη. Το εύρος των ενδιαφερόντων του είναι μεγάλο και είναι εντυπωσιακη, εκτός του εύρους, η εις βάθος γνω η του στο επιστημονικό του πεδίο, τη φαρμακευτικη βιοτεχνολογία, αλλά και σε πεδία όπως της οργανικη ς χημείας, ακόμη και των χημικω ν κη πων. Η ικανότητά του να σχεδιάζει και να αξιολογεί την πορεία της έρευνας είναι εντυπωσιακη και συνέβαλε τα μέγιστα στην ολοκλη ρωση αυτη ς της Διατριβη. Θα η θελα ακόμη να ευχαριστη σω τις μεταδιδάκτορες ερευνη τριες κυρίες Ελένη Ζη νκου και Γκόλφω Κορδοπάτη για τη μεγάλη συμβολη τους στην εκπόνηση της Διατριβη ς.. Πρόκειται για νέες επιστη μονες με στέρεο επιστημονικό υπόβαθρο, ορθοκρισία, εργατικότητα και υψηλη ικανότητα αξιολόγησης των πειραματικω ν δεδομένων. Ιδιαίτερα ευχαριστω την κα Χριστίνα Γιαννακοπούλου, αλλά και την κα Ελένη Τσιαούση πρω ην μεταπτυχιακές φοιτη τριες, για τη βοη θει που μου προσέφεραν στην εκμάθηση τεχνικω ν καθω και στη διενέργεια πειραμάτων, αλλά και για τη διενέργεια πειραμάτων που εκτέλεσαν στο πλαίσιο του Μεταπτυχιακού τους. Επίσης ευχαριστω τον αναπληρωτη Καθηγητη κ. Πλάτωνα Μαγκριω τη για τη φιλοξενία, τη διάθεση εξοπλισμού, καθω ς και για τις συζητη σεις και συμβουλές του αναφορικά με τη σύνθεση.

12 Ευχαριστω επίσης την επίκουρο Καθηγη τρια κα Βασιλικη Μαγκαφά για την ηθικη και εργαστηριακη υποστη ριξη της, καθω ς και για τις συμβουλές της αναφορικά με την πεπτιδικη σύνθεση. Επίσης την αναπληρω τρια Καθηγη τρια κα Φωτεινη Λάμαρη, την μεταδιδακτορικη ερευνη τρια κα Βιργινία Δημάκη και ιδιαίτερα την υποψη φιο διδάκτορα κα Αθηνά Λύκουρα για την υλικοτεχνικη βοη θει που μου προσέφεραν και τον πολύτιμό τους χρόνο. Τέλος, ευχαριστω τους οικείους μου, την μητέρα μου και τα αδέλφια μου, που με στη ριξαν με όλους τους τρόπους σε όλη μου τη ζωη. Κυρίως όμως ευχαριστω την σύζυγό μου και τον γιό μας. Η σύζυγος ταλαιπωρη θηκε κατά την εκπόνηση της διατριβη ς, αλλά η στη ριξη της και οι θυσίες της που πηγάζουν από την αγάπη της, η ταν και θα είναι ανεκτίμητη. Τίποτα δεν θα μπορούσε να γίνει χωρίς αυτη ν. Τον γιο μου τον ευχαριστω ου απλά υπάρχει! xii

13 TABLE OF CONTENTS LIST OF FIGURES, SCHEMES, AND TABLES...v ABSTRACT... xiii ΠΕΡΙΛΗΨΗ...xv ABBREVIATIONS... xvii INTRODUCTION KALLIKREIN-RELATED PEPTIDASES...3 Kallikrein-related peptidases in normal physiology and disease...9 KLK KLK KLK KLK KLK KLK KLK6 activity and specificity...25 KLK7 activity and specificity...27 INHIBITORS OF KALLIKREIN-RELATED PEPTIDASES...28 ABPs FOR SERINE PROTEASES...35 Structure and design of ABPs...36 Phosphonate inhibitors, ABPs, and qabps...48 STATE-OF-THE-ART...52 SPECIFIC AIMS OF THE STUDY...55 MATERIALS AND METHODS MATERIALS...59 Chemicals Reagents...59 Antibodies...59 Equipment...59 METHODS...60 i

14 RESULTS CHAPTER 1: DESIGN, SYNTHESIS, AND VALUATION OF KLK7 INHIBITORS AND ABPs DESIGN OF KLK7 INHIBITORS AND ABPs...69 SYNTHESIS OF KLK7 INHIBITORS AND ABPs...72 Synthesis of Boc-Phe-Phe P -(OPh)2 and biotin-x-x-phe-phe P -(OPh) Synthesis of Boc-Phe-Phg P -(OPh)2 and biotin-x-x-phe-phg P -(OPh) Synthesis of Boc-Phe-Hph P -(OPh) Synthesis of Boc-Phe-Phe P -(OCH2CF3) EVALUATION OF KLK7 INHIBITORS AND ABPs...79 Inhibition and specificity of inhibitors Boc-Phe-Phe P -(OPh)2 (9), H2N-Phe-Phe P - (OPh)2 (10) and activity-based probe biotin-x-x-phe-phe P -(OPh)2 (11)...79 Biochemical evaluation of the Boc-Phe-Phg P -(OPh)2 (15), Boc-Phe-Hph P -(OPh)2 (21), and activity-based probe biotin-x-x-phe-phg P -(OPh)2 (17)...82 IC50 determination...83 Analysis of clinical specimens with activography...83 Development of a specific ELISA for the quantified detection of active KLK Evaluation of inhibitor 9 and ABP 11 in vivo on a preclinical mouse model of Netherton syndrome...87 CHAPTER 2: DESIGN, SYNTHESIS, AND VALUATION OF KLK7 qabp DESIGN OF KLK7 qabp Cy5-Phe-Phe P -(OEt)(Tya-QSY21)...97 SYNTHESIS OF KLK7 qabp Cy5-Phe-Phe P -(OEt)(Tya-QSY21)...98 EVALUATION OF KLK7 qabp Cy5-Phe-Phe P -(OEt)(Tya-QSY21) ii

15 CHAPTER 3. DESIGN, SYNTHESIS, AND EVALUATION OF KLK6 INHIBITORS AND ABP DESIGN OF KLK6 ABP SYNTHESIS OF KLK6 ABP Synthesis of biotin-dpeg 4-His(Clt)-Ile-Val-OH Synthesis of Z-Arg P -(OPh)2 (67), H2N-Arg P -(OPh)2 (69), and biotin-dpeg 4-His- -Ile-Val-Arg P -(OPh)2 (71) EVALUATION OF KLK6 INHIBITORS AND ABPS EXPERIMENTAL PROCEDURES AND DATA General experimental procedures Experimental procedures and analytical data of synthesized compounds Spectra and data of all synthesized compounds DISCUSSION REFERENCES APPENDIX CURRICULUM VITAE ORIGINALITY REPORT iii

16

17 LIST OF FIGURES, SCHEMES, AND TABLES FIGURES Figure 1: Protease active site nomenclature according to Schechter and Berger...4 Figure 2: Schematic representation of KLK gene and protein structures...5 Figure 3: Kallikreins (KLKs) in the human protease family tree...6 Figure 4: Proteomic structure overview of KLK-related peptidases...7 Figure 5: Serine protease mechanism of action....8 Figure 6: The KLK proteolytic cascade in skin epidermis...11 Figure 7: The structure and mechanism of peptide aldehydes inhibitors Figure 8: Figure 9: KLK7 cyclic depsipeptide inhibitor...30 Structure of isocoumarins extracted from Paepalanthus bromelioides Silv Figure 10: Chloromethylkenote based compounds that inhibit KLKs Figure 11: Structure of boronic-type peptides inhibiting KLK Figure 12: Examples of synthetic LMW KLK inhibitors Figure 13: The structure of ABPs FP-biotin and DCG Figure 14: Schematic representation and application of ABPs Figure 15: Representative electrophiles used in ABPs Figure 16: Influence of kinetics and warhead reactivity on ABP efficiency and specificity Figure 17: Reporter types and their associated techniques Figure 18: Sequence determination by PS-SCL and HyCoSuL Figure 19: Increasing selectivity analysis using antibodies Figure 20: A qabp example: structure and mechanism Figure 21: a-aminophosphonic acid structure compared to amino acids and examples Figure 22: Nomenclature for the abbreviation of a-aminophosphonic acid compared to a-amino acids and example...49 Figure 23: KLK7 and related peptidases substrate specificity matrix Figure 24: Structure of the designed KLK7 inhibitor and ABP Figure 25: Designed inhibitors with various carbon side chain lengths at P Figure 26: The chemical structure of Boc-Phe-Phe P -(OCH2CF3) Figure 27: Inhibition of KLK7 by inhibitor 9 and specificity against other serine proteases Figure 28: Inhibition of KLK7 by inhibitors 9 and v

18 Figure 29: Detection of active KLK7 with ABP biotin-x-x-phe-phe P -(OPh)2 (11) in the Western-like blot assay Figure 30. KLK7 inhibition by inhibitor Boc-Phe-Phe P -(OPh)2 (9) compared to Boc-Phe-Phg P -(OPh)2 (15) and Boc-Phe-Hph P -(OPh)2 (21) Figure 31: Comparison of detection efficiency of the active rklk7 with the ABPs biotin-x-x-phe-phg P -(OPh)2 (17) and biotin-x-x-phe-phe P - (OPh)2 (11) by Western blotting Figure 32: Tissue localization of active KLK7 by activography using the synthesized KLK7 ABP Figure 33: Schematic design of the ELISA developed for the detection of active KLK Figure 34: Representative analysis of active KLK7 with ELISA Figure 35: Sequence alignment of human KLK7 and mouse Klk7 sequences Figure 36: Immunodepletion experiment shows that the KLK7 ABP 11 can bind to mouse Klk Figure 37: Detection of Klk7 in Spink5 -/- Klk5 -/- mouse skin extracts by ABP Figure 38: Cytotoxicity tested in normal human fibroblasts treated with inhibitor 9 and ABP Figure 39: Effect of KLK inhibitor 9 treatment on Spink5 -/- Klk5 -/- mice skin Figure 40 Effect of KLK ABP 11 treatment on Spink5 -/- Klk5 -/- mice skin Figure 41: Suppression of inflammatory cytokines expression after inhibitor 9 application...94 Figure 42: Expression of Klk7 is induced by TPA-treatment Figure 43: Structure and mechanism of the qabp Cy5-Phe-Phe P -(OEt)(OTya- QSY21) Figure 44: Stability of qabp Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43) in PBS Figure 45: Evaluation of labeling and quenching action of qabp Cy5-Phe-PheP-(OEt)(OTya-QSY21) (43) Figure 46. Substrate specificity matrixes indicate the recognition sequence for KLK6 ABP design Figure 47. Partially deprotected side-products during deprotection of biotin-dpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh) Figure 48: Gelatin zymography shows the inhibitory activity of Z-Arg p -(OPh)2 (67) and H2N-Arg P -(OPh)2 (69) against rklk6 and trypsin Figure 49: Structures of Z-Arg p -(OPh)2 (67) and Cbz-(4-AmPhGly) P (OPh)2, phosphonate analogues of Arg Figure 50: Determination of potencies (Kinact/KI values) for irreversible inhibitors vi

19 Figure 51: Determination of kinetic constants for the irreversible inhibitor Z-Arg P -(OPh)2 (67) against rklk6 with BAEE substrate Figure 52: Determination of kinetic constants for the irreversible inhibitor H2N-Arg P -(OPh)2 (69) against rklk6 with BAEE substrate Figure 53: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OPh)2 (7) Figure 54: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OPh)2 (7) Figure 55: ESI-MS of compound Ζ-Phe P -(OPh)2 (7) Figure 56: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OPh)2 (9) Figure 57: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OPh)2 (9) Figure 58: 31 P NMR (243 MHz, 298 K, CDCl3)of compound Boc-Phe-Phe P -(OPh)2 (9) Figure 59: ESI-MS of compound Boc-Phe-Phe P -(OPh)2 (9) Figure 60: ESI-MS of crude compound H2N-Phe-Phe P -(OPh)2 (10) Figure 61: 1 H NMR (600 MHz, 298 K, CDCl3) of compound biotin-x-x-phe-phe P -(OPh)2 (11) Figure 62: 31 P NMR (243 MHz, 298 K, CDCl3) of compound biotin-x-x-phe-phe P -(OPh)2 (11) Figure 63: ESI-MS of compound biotin-x-x-phe-phe P -(OPh)2 (11) Figure 64: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phg P -(OPh)2 (13) Figure 65: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phg P -(OPh)2 (13) Figure 66: ESI-MS of compound Z-Phg P -(OPh)2 (13) Figure 67: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15) Figure 68: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15) Figure 69: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15) Figure 70: ESI-MS of compound Boc-Phe-Phg P -(OPh)2 (15) Figure 71: ESI-MS of crude compound H2N-Phe-Phg P -(OPh)2 (16) Figure 72: 1 H NMR (600 MHz, 298 K, CDCl3) of compound biotin-x-x-phe-phg P -(OPh)2 (17) Figure 73: 31 P NMR (243 MHz, 298 K, CDCl3) of compound biotin-x-x-phe-phg P -(OPh)2 (17) Figure 74: ESI-MS of compound biotin-x-x-phe-phg P -(OPh)2 (17) vii

20 Figure 75: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Hph P -(OPh)2 (19) Figure 76: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Hph P -(OPh)2 (19) Figure 77: ESI-MS of compound H2N-Hph P -(OPh)2 (20) Figure 78: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Hph P -(OPh)2 (21) Figure 79: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Hph P -(OPh)2 (21) Figure 80: ESI-MS of compound Boc-Phe-Hph P -(OPh)2 (21) Figure 81: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25) Figure 82: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25) Figure 83: 19 F NMR (565 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25) Figure 84: ESI-MS of compound Z-Phe P -(OCH2CF3)2 (25) Figure 85: ESI-MS of crude compound Z-Phe P -(OCH2CF3)2 (25) Figure 86: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P - (OCH2CF3)2 (27) Figure 87: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P - (OCH2CF3)2 (27) Figure 88: ESI-MS of compound Boc-Phe-Phe P -(OCH2CF3)2 (27) Figure 89: 1 H NMR (600 MHz, 298 K, DMSO-d6) of compound HO-Tya-N-Pht (29) Figure 90: ESI-MS of compound HO-Tya-N-Pht (29) Figure 91: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30) Figure 92: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30) Figure 93: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30) Figure 94: ESI-MS of compound Z-Phe P -(OEt)2 (30) Figure 95: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OEt)2 (32) Figure 96: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OEt)2 (32) Figure 97: ESI-MS of compound Boc-Phe-Phe P -(OEt)2 (32) viii

21 Figure 98: 1 H NMR (600 MHz, 298 K, CDCl3) of compound HO-Tya-NH-Boc (34) Figure 99: ESI-MS of compound HO-Tya-NH-Boc OEt)2 (34) Figure 100: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya-Boc) (35) Figure 101: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya-Boc) (35) Figure 102: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya-Boc) (35) Figure 103: ESI-MS of compound Z-Phe P -(OEt)(OTya-Boc) (35) Figure 104: ESI-MS of crude compound H2N-Phe P -(OEt)(OTya-Boc) (36) Figure 105: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe-OH (38) Figure 106: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a) Figure 107: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a) Figure 108: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a) Figure 109: ESI-MS of compound Fmoc-Phe-Phe P -(OEt)(OTya-Boc) (39a) Figure 110: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe-Phe P - (OEt)(OTya-Boc) (39b) Figure 111: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe-Phe P - (OEt)(OTya-Boc) (39b) Figure 112: ESI-MS of compound Z-Phe-Phe P -(OEt)(OTya-Boc) (39b) Figure 113: ESI-MS of compound H2N-Phe-Phe P -(OEt)(OTya-Boc) (40) Figure 114: Analytical HPLC of Cy5-Phe-Phe P -(OEt)(OTya-Boc) (41) Figure 115: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-Boc) (41) Figure 116: Analytical RP-HPLC of Cy5-Phe-Phe P -(OEt)(OTya-NH2) (42) Figure 117: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-NH2) (42) Figure 118: Analytical RP-HPLC of Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43) Figure 119: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43) Figure 120: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Fmoc-His(Clt)-Ile-Val-OH (53) Figure 121: Analytical RP-HPLC of biotin-dpeg 4-His(Clt)-Ile-Val-OH (56) Figure 122: 1 H NMR (600 MHz, 298 K, CDCl3) of compound biotin-dpeg 4- His(Clt)-Ile-Val-OH (56) Figure 123: 13 C NMR (151 MHz, 298 K, CDCl3) of compound biotin-dpeg 4- His(Clt)-Ile-Val-OH (56) ix

22 Figure 124: ESI-MS of compound biotin-dpeg 4-His(Clt)-Ile-Val-OH (56) Figure 125: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Bu-OH (59). 180 Figure 126: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Pht-Bu-OH (62)..180 Figure 127: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Pth-Pr-CHO (63). 181 Figure 128: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Orn P (Pht)-(OPh)2 (64) Figure 129: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Orn P (Pht)-(OPh)2 (64) Figure 130: ESI-MS of compound Z-Orn P (Pht)-(OPh)2 (64) Figure 131: ESI-MS of compound Z-Orn P -(OPh)2 (65) Figure 132: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Arg P (Boc)2-(OPh)2 (66) Figure 133: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Arg P (Boc)2-(OPh)2 (66) Figure 134: ESI-MS of compound Z-Arg P (Boc)2-(OPh)2 (66) Figure 135: ESI-MS of compound Z-Arg P -(OPh)2 (67) Figure 136: Analytical RP-HPLC of H2N-Arg P (Boc)2-(OPh)2 (68) Figure 137: ESI-MS of compound H2N-Arg P (Boc)2-(OPh)2 (68) Figure 138: ESI-MS of compound H2N-Arg P -(OPh)2 (69) Figure 139: ESI-MS of biotin-dpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70). 185 Figure 140: ESI-MS of biotin-dpeg 4-His-Ile-Val-Arg P -(OPh)2 (71) Figure 141: Schematic outline of the results obtained in this study Figure 142: RT-qPCR expression of inflammatory cytokines Figure 143: ESI-MS of the reaction mixture of biotin-dpeg 4-His(Clt)-Ile-Val- Arg P (Boc)2-(OPh)2 deprotection SCHEMES Scheme I: Synthesis of amino phosphonic acid symmetrical esters by threecomponent amidoalkylation Scheme II: Mechanism of irreversible inhibition of SP by DPPs Scheme III: General synthesis of diaryl esters of 1-aminoalkanephosphonic acids Scheme IV: Inhibitor and ABP synthesis with the motif -Phe-Phe P -(OPh) Scheme V: Inhibitor and ABP synthesis with the motif -Phe-Phg P -(OPh) Scheme VI: Synthesis of inhibitor Boc-Phe-Hph P -(OPh) Scheme VII: Synthesis of inhibitor Boc-Phe-Phe P -(OCH2CF3) x

23 Scheme VIII: Protection of tyramine with phthalic anhydride Scheme IX: Synthetic routes for the synthesis of Cy5-Phe-Phe P -(OEt)(OTya- QSY21) using Boc/Pth for the orthogonal amine protection Scheme X: Protection of tyramine with di-tert-butyl dicarbonate (Boc)2O Scheme XI: Synthetic route for the synthesis of Cy5-Phe-Phe P -(OEt)(OTya- QSY21) using Fmoc/Boc or Z/Boc orthogonal amine protection..101 Scheme XII: Synthesis of Z-Phe-OH (37) Scheme XIII: Extended structure of Cy5-Phe-Phe P -(OEt)(OTya-QSY21) Scheme XIV: Synthesis of biotin-dpeg 4-His(Clt)-Ile-Val-OH (56) Scheme XV: Synthesis of Z-Arg P -(OPh)2 (67), H2N-Arg P -(OPh)2 (69) and biotin-dpeg 4-His-Ile-Val-Arg P -(OPh)2 (71) TABLES TABLE I: Serine protease-reactive warheads TABLE II. Pros and Cons of common detection tags TABLE III. Lack of inhibition of trypsin and KLK6 by Boc-Phe-Phe P -(OPh)2 (9). 80 TABLE IV. Inhibitor 9 and ABP 11 are not irritants on the mice skin TABLE V. Inhibitor 9 and ABP 11 are not provoking oedema on the mice's skin.. 91 xi

24

25 ABSTRACT The generation of a novel activity-based probe (ABP) and inhibitor specific for kallikrein 7 (KLK7) and validation of its therapeutic effects in vivo is described here. KLK7 is a protease with well-established functions in skin inflammation and overdesquamation and in cancer. ABPs, on the other hand, are small molecules that recognise the active enzyme specifically. Thus, in contrast to antibody-based assays, ABPs are uniquely valuable tools for the detection and quantification of the active fraction of a given enzyme, as well as for in vivo imaging enzymatic activities. To generate the KLK7-ABP, an in silico approach was applied for the identification of a new KLK7-specific substrate. The substrate was modified to yield a specific and selective KLK7 phosphonate inhibitor (Boc-Phe-Phe P -(OPh)2) that was biotinylated to yield an ABP (biotin-x-x-phe-phe P -(OPh)2). In addition, a fluorescently quenched ABP (KLK7-qABP) was synthesized and validated in vitro by established analytical methods, as well as a new histochemical assay, named activography (Pampalakis et al., Chem Commun (Camb) 53: , 2017). It is shown that the developed KLK7- ABP recognizes the active form of human KLK7 in vitro, but also the endogenous human KLK7 and mouse Klk7 proteins in corresponding cell extracts and skin biopsies. The therapeutic potential of the KLK7-ABP and KLK7-inhibitor was demonstrated in vivo using Spink5 -/- Klk5 -/- mice. Spink5 -/- mice represent an established preclinical model of the rare disease Netherton syndrome, but also for common atopic dermatitis. Netherton syndrome is a severe (potentially lethal) rare ichthyosis characterized by pathological skin ovedesquamation and constitutive inflammation. It is known that KLK7 is aberrantly high in the skin of Spink5 -/- mice upon ablation of the Klk5 protease, i.e., in the studied Spink5 -/- Klk5 -/- mice, and is functionally implicated in pathology (Furio et al., 2015; Kasparek et al., 2017). Epidermal administration of both the KLK7 inhibitor and the ABP attenuated skin inflammation and overdesquamation significantly. These novel results provide preclinical proof-of-concept for potential therapeutic and diagnostic (theranostic) applications of the developed KLK7-ABP in skin pathologies and, potentially, in ovarian and pancreatic cancer, in which KLK7 has been implicated. Further, a KLK6-ABP (biotin-dpeg 4-His-Ile-Val-Arg P -(OPh)2) was generated with the same strategy to determine the active KLK6 protease in biological and clinical xiii

26 specimens, since it is well-established that KLK6 is implicated in Alzheimer's and Parkinson's disease and in different types of cancer. Until now, the roles of theranostic ABPs targeting multiple cathepsin cysteine proteases have been assessed for cancer and cardiovascular diseases (Ben-Nun et al., 2015; Weiss-Sadan et al., 2019). In terms of this thesis, novel ABP-inhibitors with dual functions accommodated on a single chemical scaffold were developed and validated against the KLK7 (Bisyris et al., 2021a and 2021b) and KLK6 serine proteases. Evidence is provided for their potential analytical, diagnostic, and therapeutic applications, which expands the use of ABPs as theranostic agents by demonstrating their application in targeting the kallikreins, the largest family of serine proteases in the human genome. xiv

27 ΠΕΡΙΛΗΨΗ Στην παρούσα διδακτορικη διατριβη περιγράφεται ο σχεδιασμός και η σύνθεση ενός νέου ιχνηθέτη ενεργότητας (activity-based probe, ABP) και αναστολέων ειδικω για την καλλικρεΐνη 7 (KLK7), καθω ς και η αποτίμηση των θεραπευτικω ιδιοτη των τους in vivo. Η KLK7 είναι μία σερινοπρωτεάση η οποία έχει μελετηθεί ιδιαίτερα για τον ενεργό της ρόλο στην φλεγμονη και την αποφολίδωση του δέρματος, καθω ς και σε διάφορους τύπους καρκίνου. Οι ιχνηθέτες ενεργότητας (ABPs) είναι μικρά μόρια ικανά να αναγνωρίζουν ειδικά τις καταλυτικω ενεργές μορφές των ενζύμων. Η ιδιότητά τους αυτη, τους καθιστά μοναδικά και ιδιαίτερα χρη σιμα εργαλεία για την ανίχνευση και την ποσοτικοποίηση του ενεργού κλάσματος του ενζύμου, καθω ς επίσης και για την in vivo απεικόνιση της ενζυμικη ς δραστηριότητας, με πολυάριθμες εφαρμογές στην βιοχημικη ανάλυση, αλλά και στην μοριακη διάγνωση. Σημειω νεται ότι τα αντισω ματα, που χρησιμοποιούνται στις διάφορες ανοσοδοκιμές, αναγνωρίζουν την ολικη ποσότητα του ενζύμου στην οποία περιλαμβάνονται και ενζυμικω ανενεργές μορφές, όπως για παράδειγμα προένζυμα, σύμπλοκα ενζύμου-αναστολέα, κολοβωμένες πρωτεΐνες που έχουν απωλέσει την ενζυμικη ενεργότητα, κλπ. Για τον σχεδιασμό του ιχνηθέτη της KLK7 εφαρμόσαμε μια in silico προσέγγιση για τον προσδιορισμό ενός νέου υποστρω ατος ειδικού για την KLK7. Τροποποίηση του πεπτιδικού υποστρω ατος έδωσε τον φωσφωνικό αναστολέα (Boc-Phe-Phe P -(OPh)2), ειδικό για την KLK7, ενω ο ειδικός ιχνηθέτης ενεργότητας (biotin-x-x-phe-phe P - (OPh)2) παρη χθη με βιοτινυλίωση του αναστολέα. Επιπλέον, συντέθηκε ένας ιχνηθέτης ABP με απόσβεση φθορισμού (KLK7-qABP, όπου q: quenched), ο οποίος αξιολογη θηκε in vitro με καθιερωμένες αναλυτικές μεθόδους, αλλά και με μία νέα μεθοδολογία ιστοχημικη ς ανάλυσης ενζύμων, την ακτιβογραφία (activography) (Pampalakis et al., Chem Commun (Camb) 53: , 2017). Πειραματικά δείχθηκε ότι ο ιχνηθέτης KLK7-ABP ανιχνεύει την ενεργη μορφη της ανθρω πι ης KLK7, καθω ς και την ενδογενη ανθρω πι η KLK7 και την Klk7 του ποντικού, σε εκχυλίσματα κυττάρων και βιοψίες δέρματος, αντίστοιχα. Οι θεραπευτικές δυνατότητες του αναστολέα και του ιχνηθέτη της KLK7 καταδείχθηκαν in vivo χρησιμοποιω ντας ποντικούς Spink5 -/- Klk5 -/-. Το σύνδρομο Netherton είναι μια (ενίοτε θανατηφόρα) μορφη ιχθύωσης, η οποία χαρακτηρίζεται από παθολογικη υπεραποφολίδωση του δέρματος και ιδιοσυστατικά ενεργοποιημένη φλεγμονη στην επιδερμίδα, με αποτέλεσμα την εκτεταμένη βλάβη του δερματικού φραγμού. Η νόσος xv

28 οφείλεται στην ανεπάρκεια του αναστολέα σερινοπρωτεασω ν LEKTI λόγω μεταλλάξεων στο αντίστοιχο γονίδιο SPINK5, με αποτέλεσμα την έκτοπη ενεργοποίηση της πρωτεόλυσης στην επιδερμίδα των ασθενω ν με σύνδρομο Netherton, αλλά και των ποντικω ν Spink5 -/- που αναπαράγουν την ανθρω πι η νόσο, και αποτελούν καθιερωμένο πρότυπο για την μελέτη του συνδρόμου Netherton και της ατοπικη ς δερματίτιδας. Επίσης, έχει δειχθεί ότι η πρωτεάση KLK7 είναι ενεργοποιημένη στο δέρμα των ποντικω Spink5 -/- Klk5 -/-, στους οποίους έχει αδρανοποιηθεί η πρωτεάση Klk5, και εμπλέκεται αιτιολογικά στην παθολογία του δέρματος (Furio et al., 2015; Kasparek el al., 2017). Επομένως οι ποντικοί αυτοί αποτελούν ιδανικό πρότυπο για την δοκιμη και αξιολόγηση αναστολέων της πρωτεάσης Klk7. Επιδερμικη χορη ηση τόσο του αναστολέα όσο και του ABP της KLK7 εξασθένισε σημαντικά την φλεγμονη και την υπεραποφολίδωση του δέρματος. Τα δεδομένα αυτά παρέχουν προκλινικές ενδείξεις για την δυνητικη θεραπευτικη και διαγνωστικη (θεραποδιαγνωστικη / therapeutic and diagnostic: theranostic) χρη σ του KLK7-ABP σε δερματικές παθολογίες, καθω ς και σε καρκίνους των ωοθηκω και του παγκρέατος, όπου επίσης εμπλέκεται η KLK7. Με την ίδια στρατηγικη αναπτύχθηκε ένας ΑΒΡ για την KLK6 (biotin-dpeg 4-His- Ile-Val-Arg P -(OPh)2) με σκοπό την ανίχνευση και ποσοτικό προσδιορισμό της ενεργούς KLK6 σε βιολογικά και κλινικά δείγματα, δεδομένου ότι η KLK6 εμπλέκεται στις νόσους Alzheimer και Parkinson, καθω και σε διάφορους τύπους καρκίνων. Μέχρι ση μερ, ο ρόλος θεραποδιαγνωστικω ν ABPs για τις κυστεϊνοπρωτεϊνάσες καθεψίνες έχει μελετηθεί και αξιολογηθεί σε καρκίνους και καρδιαγγειακές παθη σει (Ben-Nun et al., 2015; Weiss-Sadan et al., 2019). Στην παρούσα διατριβη, για πρω τη φορά αναπτύχθηκαν και αξιολογη θηκαν νέοι αναστολείς-abps για την KLK7 (Bisyris et al, 2021a and 2021b) και την KLK6 με διττές λειτουργίες φιλοξενούμενες σε έναν πεπτιδικό σκελετό, δηλαδη αναστολέα και ιχνηθέτη, και με ποικίλες δυνατές θεραποδιαγνωστικές εφαρμογές. Η εφαρμογη τους στην στόχευση των καλλικρεϊνω ν την μεγαλύτερη οικογένεια σερινοπρωτεασω ν του ανθρω πι ου γονιδιω ματος, η οποία καταδείχθηκε στην παρούσα διατριβη, διευρύνει γενικότερα την χρη ση των ABPs ως θεραποδιαγνωστικω μέσων (theranostic agents). xvi

29 ABBREVIATIONS A, alanine Aa, Amino acid ABP(s), activity-based probe(s) ABPP, activity-based protein profiling ACC, 7-amino-4-carbamoyl-methyl coumarin AD, atopic dermatitis Ala, alanine AMC, 7-amino-4-methylcoumarin APP, amyloid precursor protein Arg, arginine Asn, asparagine Asp, aspartic acid a-syn, a synuclein BAEE, Na-benzoyl-L-arginine ethyl ester Boc, tert-butyloxycarbonyl BSA, Bovine serum albumin C, cysteine CDSN, corneodesmosin Clt, 2-chlorotrityl CMK, chloromethylketone CNS, central nervous system CSF, cerebrospinal fluid Cys, cysteine D, aspartic acid DAB, 3,3'-diaminobenzidine DCM, dichloromethane DIPEA, diisopropylethyl amine DMSO, dimethyl sulfoxide dpeg, discrete polyethylene glycol DPP, diphenyl phosphonate DSC1, desmocollin 1 DSG1, desmoglein 1 E, glutamic acid ECL, enhanced chemiluminescence ELASA, enzyme-linked activitysorbent assay ELISA, enzyme-linked Immunosorbent Assay ESI-MS, electrospray ionization mass spectrometry F, phenylalanine Fmoc, fluorenylmethyloxycarbonyl FRET, fluorescence resonance energy transfer G, glycine Gln, glutamine Glu, glutamic acid Gly, glycine H, histidine HGF, hepatocyte growth factor His, histidine HOBt, 1-hydroxybenzotriazole Hph, homophenylalanine HPLC, high-performance liquid chromatography HRP, horseradish peroxidase HyCoSuL, hybrid combinatorial substrate libraries I, Isoleucine IFN, interferon IGFBP, insulin-like growth factorbinding protein xvii

30 Il, interleukin Il-1β, interleukin 1 beta Ile, isoleucine K, lysine KLK1, KLK2, human kallikrein 1, human kallikrein 2,. Klks, mouse kallikrein-related peptidases KLKs, tissue kallikrein-related peptidases L, leucine LEKTI, lympho-epithelial kazal-type related inhibitor Leu, leucine LGs, lamellar granules LMW, low molecular weight LMWK, low molecular weight kininogen Lys, lysine M, methionine MCA, 4-methylcoumaryl-7-amide Met, methionine MMP20, matrix metalloproteinase 20 MS, mass spectrometry MTSP1, membrane-type serine protease 1 N, Asparagine NHS, N-hydroxysuccinimide NMR, nuclear magnetic resonance NS, Netherton syndrome P, proline PARs, protease-activated receptors PBS, phosphate buffered saline PCC, pyridinium chlorochromate PCR, polymerase chain reaction PEG, polyethylene glycol Phe, phenylalanine Phg, phenylglycineand pna, p-nitroaniline Pro, proline PSA, prostate-specific antigen PS-SCLs, positional scanning synthetic combinatorial libraries Pth, phthalimido PVDF, polyvinylidene fluoride Q, glutamine qabp(s), quenched activity-based probe(s) R, arginine RP-HPLC, reverse phase highperformance liquid chromatography RT-PCR, real-time polymerase chain reaction RT-qPCR, real-time quantitative reverse transcription PCR S, serine SBP(s), substrate-based probe(s) SC, stratum corneum SCC25, squamous cell carcinoma cell line SCCE, stratum corneum chymotryptic enzyme SCTE, stratum corneum tryptic enzyme SDS-PAGE, sodium dodecyl sulphatepolyacrylamide gel electrophoresis Ser, serine SFTI-1, sunflower trypsin inhibitor-1 xviii

31 SP(s), serine protease(s) SPINK5, serine peptidase inhibitor Kazal type 5 T, threonine TAILS, terminal amine isotopic labeling of substrates TBTU, 2-(1H-benzotriazol-1-yl)- 1,1,3,3-tetramethyluronium tetra fluoroborate TES, triethylsilane TFA, trifluoroacetic acid TFE, trifluoroethanol TGFβ, transforming growth factor beta TGFβ, transforming growth factor β Thr, threonine TLC, thin layer chromatography TNF, tumor necrosis factor TSLP, thymic stromal lymphopoietin TPA, 12-O-tetradecanoylphorbol 13- acetate Trp, tryptophan Tya, tyramine Tyr, tyrosine upa, u-plasminogen activator V, valine Val, valine W, tryptophan X, any amino acid Xaa, Any amino acid Y, Tyrosine Z, benzyloxycarbonyl xix

32

33 INTRODUCTION

34

35 KALLIKREIN-RELATED PEPTIDASES Proteases (also called peptidases or proteinases) are protein-degrading enzymes that act by hydrolyzing peptide bonds in proteins or polypeptides. Protein processing by proteolysis is a posttranslational modification that occurs during the final stages of protein maturation, and it is unidirectional. For example, it is required to recycle amino acids derived from protein degradation, to release peptides or proteins from larger (poly)proteins, to release ("shed") cell surface proteins, to activate prohormones or latent signaling molecules by cleavage of the signal peptide, to terminate (switch off) cell signaling by degradation of the involved peptides and proteins, to release antigenic peptides or to destroy toxic (or potentially lethal) proteins from various pathogens and parasites, etc. Thus, proteolytic enzymes are involved in a plethora of biological pathways, including apoptosis, cytokine processing, antigen presentation, and blood coagulation. Dysregulation of protease activities has been implicated in various diseases such as rheumatoid arthritis and other inflammatory and autoimmune diseases, bacterial and viral infections, cancer, neurodegeneration, and cardiovascular diseases. The localization of proteases may be either intracellular or extracellular. Their catalytic mechanism is the primary classification criterion. Proteases are classified either by their specificity, i.e., exopeptidases (that cleave off one or two amino acids from the N- or C- terminus) and endopeptidases (that cleave an internal peptide bond) or by their "catalytic type" according to the nature of the nucleophilic attack performed by the protease, which also can help determine the optimal ph for a given protease as well as the protease-inactivating inhibitors. The following catalytic types are known: serine-, threonine-, cysteine- aspartyl-, glutamyl-, metallo-peptidases, and the seventh category of unknown catalytic type. Rawlings and Barrett (1993) have introduced the MEROPS classification of peptidases according to which protein sequences bearing homologous peptidase units are grouped into a peptidase family. The catalytic type is denoted by the first character in the family name, i.e., aspartic ("A"), cysteine ("C"), glutamic ("G"), metallo ("M"), serine ("S"), threonine ("T"), and unknown ("U"). According to Schechter and Berger (1967) nomenclature, the amino acids on the N- terminal side of the scissile bond are termed P1, P2,, Pn, and the corresponding pockets on the protease called S1, S2, Sn (Figure 1). Accordingly, on the C-terminal side, the residues and the pockets are named by taking an apostrophe (P1', S1', etc.; pronounced P1 prime, S1 prime, etc.). 3

36 Figure 1: Protease active site nomenclature according to Schechter and Berger. The scissile bond is indicated by scissors. Sn S1, S1', Sn' refers to protease pockets, while Pn, P1, P1', Pn' to residues around the scissile peptide bond. The tissue kallikrein-related peptidases, a 15 membered group of serine peptidases, consists of kallikrein 1 (KLK1) and 14 kallikrein-related peptidases (KLK2-KLK15). The first kallikrein was identified in human urine and was described by its action in a proteolytic peptidergic system. The same substance was found in more significant amounts in the human pancreas and was named "kallikrein" from kallikreas (καλλίκρεας denoted the pancreas in ancient Greek). This kallikrein (plasma kallikrein or KLK1B) was found to be unrelated to tissue kallikrein proteases based on structural features. The KLK locus spans approximately 320 kb localized on human chromosome 19q (Figure 2), while plasma kallikrein is mapped on chromosome 4q The 19q locus comprises all fifteen KLK genes arranged in tandem and uninterrupted by unrelated genes. The first member to be discovered was kallikrein 1 (KLK1), and the others (KLK2-KLK15) were named in a chronological manner of their discovery. The KLK gene family evolved from a single gene via duplication and diversification events initiated about 330 million years ago and resulted in the currently known human kallikrein family of genes (Pavlopoulou et al., 2010). KLKs belong to the chymotrypsin- and trypsin-like serine endopeptidase family S1 (also known as part of the clan PA) branch of the human protease family tree (Figure 3). Approximately 80% of the 178 known human serine proteases (SPs) belong to the S1 family. In this family also belong major proteinases such as trypsin, chymotrypsin, thrombin, matripase, and elastase (Rawlings et al., 2018). 4

37 Figure 2: Schematic representation of KLK gene and protein structures. Upper, Schematic representation of the human KLK gene cluster on chromosomal locus 19q13.3-q13.4. Lower, The intron-exon structure of a KLK gene. Boxes indicate exons and lines introns. Red color refers to coding exons and blue to untranslated exons. His, Asp, and Ser refer to the residues of the catalytic triad. ψ: a KLK pseudogene. (Adapted from Sotiropoulou et al., 2012a). The internationally accepted nomenclature for the kallikrein family was re-established by Lunwall et al. (2006) in light of a vast number of new studies on the identification, gene cloning, chromosomal mapping and regulation, protein structure, and biochemistry data of the then-unknown members of the kallikrein family, and the fine mapping of the human KLK locus by three independent groups in the year 2000 (Lawrence et al., 2010; Sotiropoulou et al., 2009). It turned out that only kallikrein 1 (KLK1) has a clear kininogenase activity, while all other genes in this same gene cluster encode active proteases with trypsin-like, chymotrypsin-like, or mixed trypsin/chymotrypsin-like activity, while these enzymes have no proven kininogenase activity, despite the significant sequence homology. Consequently, these proteases were renamed human kallikrein-related peptidases or KLKs (Klks for mouse). In particular, KLK6, which is a subject of this dissertation, is highly conserved between the homo sapiens, canis lupus familiaris, bos taurus, mus musculus, and rattus norvegicus. The amino acid sequence identity between the homo sapiens and mus musculus is 68.4%, and the identity between homo sapiens and rattus norvegicus is 66.8% (Pampalakis et al., 2008; Pampalakis et al., 2006c). 5

38 Figure 3: Kallikreins (KLKs) in the human protease family tree. More than 690 proteases have been identified in humans, the genes for which account for 2-4% of the genome. A criterion for classification is the catalytic mechanism. Major categories are metalloproteinases (200), serine proteases (178), cysteine proteases (160), threonine proteases (30), and aspartic acid proteases (25); the remaining 97 are grouped in an 'unknown' category. KLKs and other significant proteases belong to S1 family, the major of SP families. KLKs are separated into human plasma kallikrein (KLK1B) and tissue kallikrein (KLK1) proteins, the genes for which are on chromosomes 4q35 and 19q , respectively. The genes encoding the KLKrelated peptidases colocalize with the KLK1 on chromosome 19q13.4, and these enzymes are listed along with any alternative gene or protein names. Reprinted by permission from Springer Nature Customer Service Centre GmbH: Springer Nature, Nature Reviews Drug Discovery. Unleashing the therapeutic potential of human kallikrein-related serine proteases. Prassas I, Eissa A, Poda G, Diamandis EP KLKs are extracellular enzymes synthesized as pre-pro-enzymes. They are secreted as pro-enzymes (also named zymogens) following the removal of the signal peptide (Figure 4). All KLK enzymes consist of a single polypeptide with a peptide signal of aa, a propeptide of 3-37 aa, and an active enzyme of aa. The comparison 6

39 of the amino acid sequence reveals structural features that are invariant or highly conserved amongst the KLKs and other common features to only a few family members. KLK activation occurs within a motif that is generally well-conserved. Activation of the enzyme occurs after Arg/Lys for 14 of the 15 KLKs (Arg for KLK1- KLK3, KLK5, KLK9-KLK11; Lys for KLK6-KLK8, KLK12-KLK15) (Yoon et al., 2007). Only in KLK4, the propeptide's last residue is Gln (Lundwall and Brattsand, 2008). Figure 4: Proteomic structure overview of KLK-related peptidases. KLK mrnas are translated as inactive pre-pro-enzymes and are secreted after prepeptide cleavage of secretion signal. Pro-KLKs are turned into active KLKs by cleavage of the propeptide after lysine or arginine in the extracellular matrix. A trypsin-like protease is required for this cleavage, except in the case of pro KLK4, which is activated by a metalloproteinase (MMP20) after glutamine. H, D, and S indicate the position of catalytic triad Histidide, Aspartic acid, and Serine residues. Reprinted by permission from Springer Nature Customer Service Centre GmbH: Springer Nature, Nature Reviews Drug Discovery. Unleashing the therapeutic potential of human kallikrein-related serine proteases. Prassas I, Eissa A, Poda G, Diamandis EP Active KLK proteases act by the classical catalytic mechanism of serine proteases. The peptide substrate binds to the active-site surface of the enzyme, such that the carbonyl carbon of the scissile bond is positioned proximal to the nucleophilic serine of the catalytic triad, which is comprised of His 57, Asp 102, and Ser 195 (according to chymotrypsin numbering). The hydroxyl group of the catalytic serine attacks the carbonyl carbon of the substrate's scissile peptide bond, resulting in the activation, inactivation, or substrate degradation (Figure 5). The interaction between the S1 site of a KLK and the P1 site of its substrate, according to interaction nomenclature by 7

40 Schechter and Berger (1967), is a critical determinant of the potency and specificity of each KLK-substrate pair (Pathak et al., 2013). KLKs exhibit trypsin-like activity (KLK2, KLK4-6, KLK8, KLK10, KLK12, KLK13, and KLK15) or chymotrypsin-like activity (KLK3, KLK7, and KLK9) or mixed (tryptic and chymotryptic) activity (KLK1, KLK11, and KLK14) (Kalinska et al., 2016). The six amino acid residues before Ser 195, which is located deep inside the S1 pocket, apparently affect the kind of tryptic behavior. The KLK1, KLK2, KLK4-KLK6, KLK8, and KLK10-KLK14 have Asp 189, and all of them present trypsin-like activity cleaving after basic amino acids Arg or Lys (designated the P1 position), except for KLK1, KLK11, and KLK14, which present mixed action, although they have the same residue. The same position in KLK3, KLK7, KLK9, and KLK15 is occupied by Ser, Asn, Gly, and Glu, respectively. These KLKs present chymotrypsin-like action, preferring bulky aromatic acid at P1, like Tyr and Phe. Figure 5: Serine protease mechanism of action. Adopted by permission from Masurier et al.,

41 P1 and P1' represent the side chains of the substrate's residues. Accordingly, S1 and S1' represent the regions of protease. The typical S1 family catalytic triad residues (His 57, Asp 102, Ser 195 ) are conserved for all KLKs (Sotiropoulou et al., 2009). KLK1-KLK3 also contain an insertion of 11 residues prior to the catalytic Asp, denoted as the "kallikrein loop". Kallikrein loop contributes to substrate specificity. KLK4-KLK15 do not have this loop, but six of them (KLK8-KLK13) exhibit smaller insertions. All KLKs possess ten conserved Cys residues thought to be involved in intramolecular disulfide bond formation. KLK1- KLK3, KLK13, and KLK15 have two additional Cys residues. Each of the KLKs contains consensus motifs for N-glycosylation. KLKs contain interconnected adjacent β-barrels, like the other SP. The catalytic triad His, Asp, and Ser residues are located along the junction of the barrels (Debela et al., 2008). A salt bridge essential for the formation of the S1 pocket that accommodates the P1 side chain of the substrate is formed between the side chain of the amino-terminal residue of the mature protease and the invariant Asp located immediately before the catalytic Ser. As mentioned above, the residue located six residues before catalytic Ser lies at the bottom of the S1 pocket and thereby determines the primary P1 specificity of the KLK. Kallikrein-related peptidases in physiology and disease The expression profiles of the KLK proteases are broad, suggesting specific roles for both physiology and disease. For many years, KLKs were known for the implication of KLK1 to lysyl-bradykinin peptide release from low molecular weight kininogen (LMWK) and the clinical applicability of KLK3/PSA (prostate-specific antigen) as a prostate cancer biomarker (Marceau and Regoli, 2004; Lilja et al., 2008). Much less was understood about the remaining KLKs and their roles in physiology and disease. However, over the past 15 years, our understanding has been augmented regarding the tissue and cellular localization, regulation, and in vivo physiological (and pathophysiological) functions for most of the newer KLKs. The development of animal models with modifications in the Klk genes or their endogenous inhibitors and the identification of individuals with KLK deficiencies shed light on functional insights of the other KLKs. KLKs are now known to be involved in mechanistic pathways that 9

42 regulate kidney function, skin homeostasis and epidermal desquamation, tooth enamel formation and homeostasis, seminal plasma liquefaction by hydrolysis of seminogelins, cervico-vaginal mucous remodeling, synaptic neural plasticity, and brain function as well as neurodegeneration or deposition of amyloid plaques by hydrolyzing the amyloid precursor protein in Alzheimer's disease (Sotiropoulou et al., 2009; Pampalakis and Sotiropoulou, 2007; Emani and Diamandis, 2007). The localization of KLKs varies widely in the human body. Some of them are expressed in a single tissue, e.g., KLK2 and KLK3 in the prostate. Others are represented in some more tissues (such as KLK5-KLK8 and KLK13), whereas there are KLKs (KLK1, KLK9-KLK11, KLK14) ubiquitously expressed (Shaw and Diamandis, 2007). KLKs act individually or participate in proteolytic cascades involved in crucial physiological processes. Abnormal KLK activity is associated with many tissue-specific pathologies. Many KLKs (KLK1, KLK5 KLK8, KLK10, KLK11, KLK13, and KLK14) are expressed in the skin, especially in the stratum corneum and upper stratum granulosum of normal human epidermis, as well as in associated sebaceous glands, eccrine sweat glands, hair follicles, and nerves (Borgoño et al., 2007). In normal human skin, most serine protease activity has been ascribed to KLKs (especially KLK5, KLK7, KLK8, and KLK14) (Brattsand et al., 2005; Eissa et al., 2011; Stefansson et al., 2006). KLK5 and KLK7 were first extracted from the stratum corneum and so initially named the stratum corneum tryptic enzyme (SCTE) and stratum corneum chymotryptic enzyme (SCCE), respectively (Brattsand and Egelrud, 1999; Hansson et al., 1994). The KLKs expressed in the skin are transported along with other skin-barrier proteins by lamellar granules in keratinocytes and secreted into stratum corneum interstices. KLK5 initiates a proteolytic activation cascade in the stratum corneum interstitial milieu that involves all these secreted KLKs. Autoactivated KLK5 (Michael et al., 2005) activates downstream pro KLK7, pro KLK8 and pro KLK14 by cleaving their propeptides after the arginine or lysine residues. Activated KLK14 can, in turn, further activate pro KLK5 in a positive feedback loop (Brattsand et al., 2005). The KLK cascade in the epidermis is summarized in Figure 6. This KLK cascade is also known as the KLK activome. 10

43 Figure 6: The KLK proteolytic cascade in skin epidermis. Epidermal KLKs and other barrier proteins are secreted by lamellar granules (LGs) of upper keratinocytes in the stratum granulosum into stratum corneum (SC) interstices during terminal keratinocyte differentiation (Ishida-Yamamoto et al., 2005). Intrinsic increase in Ca 2+ and decrease in the ph gradient from the lower stratum granulosum (ph 7.0) to the uppermost SC (ph 5.0) regulate this process. Activation cascade(s) convert pro-klks to active KLKs by removing propeptide (indicated by a yellow rectangle). A KLK may be an initiator, propagator and/or executor in these cascades. The cascade initiator is pro-klk5, which is autoactivated (Michael et al., 2005), then KLK5 activates pro-klk7, pro-klk8, and pro-klk14. Through a positive feedback loop, KLK14 activates pro-klk5 (Brattsand et al., 2005). Upon activation, KLK5 and KLK7 cleave the components of the corneodesmosomes (indicated by dashed arrows), i.e., desmoglein 1 (DSG1), desmocollin 1 (DSC1) and corneodesmosin (CDSN), leading to skin desquamation or shedding of SC corneocyte cells. KLK activity in the normal and diseased epidermis is also regulated by other epidermal SP, such as matripase and inhibitors, such as the lympho-epithelial Kazal-type-related inhibitor (LEKTI) (Deraison et al., 2007). Lack of KLK5, KLK7, and KLK14 inhibition by LEKTI is implicated in Netherton syndrome (Descargues et al., 2005). Enhanced processing of antimicrobial cathelicidin peptides (e.g., LL-37) by KLK5 and KLK7 is implicated in acne rosacea (Yamasaki et al., 2007). Reprinted by permission from Springer Nature Customer Service Centre GmbH: Springer Nature, Nature Reviews Drug Discovery. Unleashing the therapeutic potential of human kallikrein-related serine proteases. Prassas I, Eissa A, Poda G, Diamandis, EP

44 Under physiological conditions, pro-klks are activated to maintain healthy skinbarrier function by performing three main tasks: (a) regulation of skin renewal and barrier thickness, by promoting desquamation and/or keratinocyte proliferation (Brattsand et al., 2005); (b) modulation of the lipid-rich permeability barrier by regulating lipid-processing enzymes (Hachem et al., 2005 and 2006); and (c) induction of antimicrobial and innate immune responses by processing antimicrobial peptides and pro-cytokines (Yamasaki et al., 2007; Morizane et al., 2010; Kanada et al., 2012). The involvement of KLKs in skin desquamation is the best characterized thus far. Corneocytes in the uppermost stratum corneum are 'desquamated' (sloughed off the skin surface) every 2-4 weeks to ensure healthy skin cell renewal. The aberrant activity of KLKs has been involved in the pathogenesis of atopic dermatitis (Komatsu et al., 2007a; Vasilopoulos et al., 2011; Voegeli et al., 2011). Overexpression of KLK7 in transgenic mice's epidermis develops increased epidermal thickness and dermal inflammation, just like seen in humans with atopic dermatitis (Ny and Egelrud, 2004). Recently, KLK5 is also considered a critical factor in atopic dermatitis development (Zhu et al., 2017). The detrimental and abnormally sustained KLK activities in the skin are best illustrated by the devastating and rare skin disease Netherton syndrome (NS) (Hovnanian, 2013). Loss-of-function mutations cause NS in the SPINK5 gene encoding LEKTI. It is a rare (1:200,000) form of ichthyosis highlighted by abnormally elevated proteolysis, excessive desquamation, and sustained inflammation in the epidermis associated with a severe barrier defect leading to dehydration that is often lethal (Chavanas et al., 2000). atopic dermatitis is a frequent disease for which predisposing gene polymorphisms in SPINK5 but also in KLK7 have been identified (Fortugno et al., 2012; Walley et al., 2001; Vasilopoulos et al., 2004). NS is characterized by severe desquamation, skinbarrier dysfunction and atopic skin-allergy-like symptoms, and abnormal hair structure referred to as bamboo hair. It is an autosomal recessive genetic disease caused by inactivating mutations in SPINK5 that lead to the abrogation of its gene product, the serine protease inhibitor LEKTI (Descargues et al., 2005; Chavanas et al., 2000; Komatsu et al., 2002). The role of KLK5 and KLK7 as key mediators of the disease pathogenesis was revealed by in depth biochemical analyses of human and mice with NS skin tissues (Kasparek et al. 2017; Furio et al., 2015; Deraison et al., 2007; Fortugno et al., 2012; Ishida-Yamamoto et al., 2005; Wang et al., 2014). 12

45 Another common skin disease, which affects approx. 2% of the population, in which KLKs have been known to be crucial, is psoriasis. Epidermal and autoimmune aberrations that cause epidermal scaling and hyperkeratosis characterize psoriasis (Gottlieb, 2005). From all KLKs in the skin, mainly KLK6 is considered responsible for the psoriasis phenotype (Billi et al., 2020). Moreover, KLKs are now considered major regulators of skin-resident immunity, as highlighted by their roles in the pathobiology of acne rosacea (Yamasaki et al., 2007; Meyer-Hoffert and Schröder, 2011; Coda et al., 2013). The relationship of KLKs with hormone-related cancers as breast, ovarian, prostate, and testicular cancer is indicated by the high expression of several KLKs in these tumors (Lawrence et al., 2010; Clements et al., 2004). Furthermore, KLK5, KLK7, and KLK8 display high levels in other cancers, such as in skin and lung cancers, suggesting the implication of KLKs in a wide range of cancers (Pampalakis et al., 2019; Zhao et al., 2011; Planque et al., 2005; Pettus et al., 2009). Thus, KLKs emerge as diagnosis and monitoring biomarkers for various cancers. Notably, the precise enzymatic function underpinning many of these events is not well known. However, the roles of KLKs in cancer are inferred from in vitro biochemical assays that include degradation of extracellular matrix proteins (fibrinogen, fibronectin, laminin, collagens I and IV) to facilitate tumour invasion, activation (pro-hgf, latent TGFβ, pro-urinary plasminogen activator/upa, PARs) or degradation (IGFBPs, upa receptor/upar) of growth factors and other protease systems involved in cancer progression (Lawrence et al., 2010; Sotiropoulou et al., 2009). A potential KLK cascade in the central nervous system, including KLK5, KLK6, KLK8, KLK11, KLK12, and KLK14, is suggested by in vitro studies (Yoon et al., 2007). This cascade will be discussed in detail below. Given the pleiotropic roles of KLKs, both activators and inhibitors of KLK activities are of therapeutic interest (Sotiropoulou and Pampalakis, 2012; Pampalakis and Sotiropoulou, 2012) but also in the development of novel cosmetics (Sotiropoulou et al., 2021). For example, inhibitors of hyperactive KLKs in the epidermis would be effective against excess skin desquamation and inflammation, whereas KLK activators could benefit hyperkeratosis caused by diminished KLK proteolysis. Expression of active KLKs by cancer cells and tissues can be exploited to target prodrugs that are proteolytically cleaved to release a cytotoxic compound or a cytolytic toxin at the site 13

46 of KLK activity, as realized with the KLK3/PSA-activated prodrugs (Aloysius and Hu, 2015). For example, in light of the results from clinical and tumor-biological studies, together with the available pharmaceutical tools, it was suggested that KLK4, KLK5, KLK6, and possibly KLK7 as preferred targets for inhibition in ovarian cancer. (Loessner et al., 2018). Recent studies indicate that some members of the KLK family could be considered as tumor biomarkers to estimate cancer prognosis and clinical response to therapeutic schemes (Haddada et al., 2018; Loessner et al., 2018). Other studies have been suggested that proteolytic activity of KLKs may regulate the establishment and progression of neoplasia by activating growth factors and modulating factors that initiate angiogenesis and finally by degrading the basement membrane and components of the extracellular matrix (ECM) (Sotiropoulou et al., 2009; Kryza et al., 2016). The importance of KLKs as cancer biomarkers is undoubtedly supported by the clinical serum values of KLK3 (PSA) in the screening, diagnosis, and monitoring of prostate cancer (Schröder et al., 2008; Ulmert et al., 2009). Active recombinant proteins, monoclonal antibodies and sensitive immunoassays were developed as tools for assessment of KLKs as biomarkers, as for example for KLK6 (Sotiropoulou et al., 2012b; Bayés et al., 2004; Sotiropoulou et al., 2003; Diamandis et al., 2000a) and KLK13 (Kapadia et al., 2003; Sotiropoulou et al., 2003). KLK1 KLK1 is the most abundant kininogenase in the airway system. Cleavage of lowmolecular-weight kininogen (LMWK) by KLK1 produces the decapeptide Lysbradykinin (Madeddu ey al., 2007). KLK1-mediated production of kinin activates bradykinin B2 receptor and induces bronchoconstriction and hypersecretion of mucus. In patients with asthma or chronic bronchitis, KLK1 is significantly elevated in the bronchial alveolar lavage fluid after exposure to allergens or bronchoconstrictive stimuli. Consequently, inhibition of KLK1 may be helpful in these individuals. Also, KLK1 is involved in crucial pathways, particularly in the cardiovascular and renal systems. In contrast to the airway system activity, elevated KLK1 activity is probably beneficial in renal and cardiac injuries. 14

47 KLK3 KLK3 is known as the prostate-specific antigen (PSA). It is co-expressed with many other KLKs (KLK2, KLK4, KLK5, KLK11, KLK12, KLK14, and KLK15) in varying degrees, but KLK3 expression is restricted to the prostate. Multiple splice variants for the KLK3 gene have been identified (Pampalakis et al., 2008). KLK3 facilitates semen liquefaction and enhanced sperm motility by cleavage of fibronectin and the seminalgel-forming proteins semenogelin 1 and semenogelin 2 (Emami and Diamandis, 2010 and 2008; Pampalakis and Sotiropoulou, 2007; Michael et al., 2006). Although other KLKs (such as KLK5 and KLK14) cleave fibronectin and semenogelins in vitro and are postulated to regulate KLK3 activity through a zymogen activation cascade, KLK3 remains the key executor of semenogelin hydrolysis during clot liquefaction in vivo. Zn 2+ ions inhibit KLK activity by allosteric binding to the enzyme in a reversible manner. In prostate cancer, the downregulation of Zn 2+ ions transporters leads to reduced concentrations of Zn 2+ ions (Costello et al., 2004). Low concentrations of Zn 2+ ions are associated with high KLK3 activity that mediates prostate cancer progression and metastasis, particularly to the bone (Logothetis and Lin, 2005). Thus, the development of KLK3-based therapeutics is an attractive target. KLK4 KLK4 activity is essential for enamel formation. Known initially as enamel-matrix protease 1, KLK4 is secreted during the transition and maturation stages of enamel formation (Simmer et al., 1998) and activated by matrix metalloproteinase 20 (MMP20). Active KLK4 degrades enamel-matrix proteins, such as amelogenin, enamelin, and ameloblastin, and facilitates the lateral expansion of the hydroxyapatite crystal of the tooth via a transforming growth factor β (TGFβ)-associated mechanism (Cho et al., 2013). Future efforts to restore regular KLK4 activity in teeth might prove therapeutically useful for amelogenesis-related pathologies. KLK5 KLK5 activity is critical in skin homeostasis and pathology, as discussed above in detail. KLK5 initiates a proteolytic activation cascade. Autoactivated KLK5 cleaves the propeptides of pro-klk7, pro-klk8, and pro-klk14 to maintain healthy skin barrier function. The KLK5 roles are discussed below in connection with KLK7. Herein, we focus on dysregulation along with other KLKs in other malignancies. High KLK5 levels 15

48 observed in ovarian cancer are associated with significantly shorter tumor progressionfree as well as overall survival (Bandiera et al., 2009). Also, KLK5 expression is elevated in lung cancer, carcinomas of the oral cavity, and colorectal cancer (Planque et al., 2005; Pettus et al., 2009; Jiang et al., 2011). On the other hand, KLK5 attenuates tumorigenicity of invasive breast cancer cells in vitro and in vivo and may represent a putative Class II tumor suppressor (Pampalakis et al., 2014). Some studies have shown that KLKs can alter the extracellular matrix (ECM) not only directly by proteolytic processing of ECM protein components but also indirectly via mirna-mediated pathways (Pasic et al., 2015). It was shown that KLK5 transfected into malignant breast tumor cell lines that do not express the KLK5 gene induced global downregulation of numerous mirnas, of which many novel targets are related to the degradation of ECM components, while only a few mirnas were upregulated (Sidiropoulos et al., 2014). Thus, KLK5 can affect mirna networks, leading to a new compelling hypothesis of the interplay between serine proteases and mirnas (Sidiropoulos et al., 2014). More recently, a tumor suppressor role of KLK5 in vaginal carcinogenesis was also proposed (Pampalakis et al., 2018). KLK6 The cdna encoding KLK6 was originally identified, cloned and sequenced as protease M based on the differential expression of the corresponding gene in breast and ovarian cancers (Anisowicz et al., 1996; Anisowicz et al., 1996, PCT Int. Patent, WO 98/11238) Later, the same gene was reported as being involved in Alzheimer's disease and was named zyme (Little et al., 1997). Finally, it was also cloned from colon carcinoma cells and was named neurosin (Yamashiro et al., 1997). The gene was localized on human chromosomal locus 19q (Anisowicz et al., 1996), where also is localized the known PSA (prostate-specific antigen; now KLK3). The KLK6 gene spans 10.5 kb of genomic sequence and is comprised of seven exons, the first two of which are untranslated (Yousef et al., 1999). Early tissue expression studies indicated that the KLK6 (zyme/protease M/neurosin) gene is expressed in the brain (including spinal cord and cerebellum) as well as in other tissues like the mammary gland, uterus, and kidney (Anisowicz et al., 1996). The gene is regulated by steroid hormones, as shown in the breast carcinoma cell line BT-474 (Yousef et al., 1999). According to the international nomenclature established more recently for human kallikreins (Lundwall et al., 2006), these proteases were renamed kallikrein-related peptidases or KLKs, while protease 16

49 M/zyme/neurosin was renamed kallikrein-related peptidase 6 or KLK6. The cdna for the zyme/protease M/neurosin gene is symbolized PRSS9 (HGMW-approved symbol). The expression of KLK6 is regulated at multiple levels (Pampalakis and Sotiropoulou, 2006a). Transcription of the KLK6 mrna is under the control of at least two different promoters (Pampalakis et al., 2004), while multiple splice variants have been identified that lack the exon encompassing the ATG translational initiating codon or they encode for putative KLK6 proteins that are truncated and are not expected to have enzymatic activity, since they lack catalytic amino acids that are indispensable for serine protease activity (Pampalakis et al., 2004). It has been shown that in cancer cells KLK6 expression is regulated by epigenetic mechanisms that include promoter methylation and histone (de)acetylation (Pampalakis et al., 2009; Pampalakis and Sotiropoulou, 2006b). Similarly, the human kallikrein 10 (KLK10 or NES1) is downregulated in breast, ovarian, and prostate cancers via hypermethylation of CpG islands (Sidiropoulos et al., 2005). Further, the KLK6 mrna is regulated by members of the let-7 family of mirnas (Chow et al., 2008). Notably, at the genomic level, gene amplification has been observed in a subset of ovarian cancers and was responsible for the increased KLK6 expression (Ni et al., 2004). Gene expression profiles of human SCC25 head and neck squamous carcinoma cells treated with EB1089, a low calcemic 1,25-(OH)2D3 analog, a known chemoprevention, antiproliferative, and cell differentiation-inducing agent, revealed KLK6 as one of the target genes most highly unregulated by EB1089 (vitamin D analogue) driving SCC25 cells toward a less malignant phenotype, similar to that of basal keratinocytes (Lin et al., 2002). Finally, it was shown that the expression of KLK6 is regulated by vitamin D3 (Pampalakis et al., 2006). KLK6 is produced as a pre-pro-enzyme. After removal of the signal peptide, KLK6 is secreted as an inactive zymogen that is amenable to autoactivation. Then, the mature/active KLK6 is auto-inactivated by limited proteolysis, i.e., primarily by internal cleavage at Arg 80 and more slowly at Arg 92 (Bayés et al., 2004). The structures of pro-klk6 and mature KLK6 have been resolved by X-ray crystallography at 1.80 and 1.75 Å (Gomis-Rüth et al., 2002; Bernett et al., 2002), respectively. Finally, KLK6- specific antibodies have been developed (Sotiropoulou et al., 2012b; Diamandis et al., 2000a). Also, DNA aptamers that bind to KLK6 have been identified (Arnold et al., 2012). 17

50 KLK6 was initially suggested to be a degrading enzyme (Gosh et al., 2004). However, in a more recent study that employed a TAILS mass spectrometry-based approach, it was demonstrated that KLK6 acts on a limited number of substrates; thus, it represents a regulatory enzyme that can cleave a limited number of specific protein substrates (Pampalakis et al., 2017; Sotiropoulou et al., 2003) rather than a generally degrading enzyme. For example, KLK6 has been implicated in the regulation of TGFβ signaling (Pampalakis et al., 2017; Pampalakis et al., 2008) and the expression of S100A proteins and the apoptosis-related proteases (Pampalakis et al., 2019). Further, KLK6 activates the expression of prommp2 (Pampalakis et al., 2017), prommp9 (Bando et al., 2018), and proforms of ADAMs (Klucky et al., 2007). In addition, KLK6 regulates the expression of multiple mirnas to modulate oncogenic signaling in breast cancer (Sidiropoulos et al., 2016). KLK6 in skin inflammation KLK6 is implicated in psoriasis, as demonstrated by various studies. Increased KLK6 expression has been found in psoriatic skin relative to healthy (Billi et al., 2020; Lundberg et al., 2015; Komatsu et al., 2007b). Overexpression of Klk6 in mouse epidermis induces psoriasiform dermatitis and inflammatory joint disease. The role of KLK6 in psoriasis is mediated by PAR1 receptor, since deletion of Par1 but not Par2 in Klk6-overexpressing mice reversed the psoriatic and joint disease symptoms (Billi et al., 2020). In accordance with the imiquimod model of psoriasis in mice, Klk6 -/- mice display significantly attenuated psoriasis-symptoms and associated inflammation compared to wt mice (Iinuma et al., 2017). The role of KLK6 in driving epidermal inflammation is also corroborated by the fact that the deletion of Klk6 in Spink5 -/- mice, the murine model of Netherton syndrome, suppresses the expression of proinflammatory cytokines (Zingkou et al., 2019). Also, deletion of the Klk6 gene in mice highly suppresses the expression of proinflammatory cytokines after chronic induction of epidermal inflammation with TPA (Khoury et al., 2018). KLK6 in cancer KLK6 is overexpressed in ovarian cancer (Anisowicz et al., 1996) and has been suggested as an unfavorable prognostic indicator of survival in ovarian cancer (Hoffman et al., 2002). However, the functional role of KLK6 in ovarian cancer has not 18

51 been investigated. KLK6 is overexpressed in primary breast tumors but inactivated in the corresponding lung metastases (Anisowicz et al., 1996). It has been found that in breast cancer cells, re-expression of KLK6 at physiological levels, namely concentration secreted by normal mammary epithelial cells, exhibited tumor suppressor function. Nonetheless, overexpression of KLK6 at levels more than 50-fold compared to normal cells increased tumorigenicity (Pampalakis et al., 2009). Previously, it was shown that keratinocytes adjacent to benign nevi, primary melanomas, and metastatic cutaneous lesions display increased KLK6 expression and absent KLK6 expression by melanoma cells (Krenzer et al., 2011). Re-expression of KLK6 in MDA-MB-435 melanoma cells reduced their in vivo growth in SCID mice, indicating the KLK6 may have a suppressor function in melanoma (Pampalakis et al., 2021). Aberrant elevation of KLK6 also occurs in non-small cell lung cancer and is associated with tumor cell proliferation and reduced survival rates (Nathalie et al., 2009). In colon cancer, higher KLK6 transcript and protein levels have been associated with shorter overall and recurrence-free survival, and blocking KLK6 using sirna approaches decreases both tumor cell proliferation and invasion (Kim et al., 2011). Secretion of KLK6 by colon cancer cells takes place through caveolin-1 (Henkhaus et al., 2008), while KLK6 promotes colon cancer by inducing HMGA2 (Chen et al., 2019). KLK6 is also elevated in gastric (Nagahara et al., 2005) and uterine cancers (Santin et al., 2005). Interestingly, KLK6 is involved in the regulation of E-cadherin shedding (Klucky et al., 2007). The potential employment of KLK6 as a prognostic indicator of survival in cancer is very interesting. Indeed, KLK6 has been suggested as an unfavorable prognostic indicator of survival in ovarian cancer (Hoffman et al., 2002), as already mentioned. It was found that KLK6 is not expressed in normal ovaries, but its expression is significantly elevated in ovarian carcinomas at both the protein and RNA levels (Hoffman et al., 2002; Tanimoto et al., 2001). The KLK chromosomal locus on 19q is subject to copy number gains and structural rearrangements in ovarian cancer. A net loss of the KLK locus is associated with more prolonged disease-free survival (Bayani et al., 2008). KLK6 in neurodegeneration KLK6 is the most abundant KLK in the CNS. It may be the most abundant CNS serine protease identified to date, present at the highest levels in the brain stem and spinal 19

52 cord, with significant expression levels in other clinically important brain regions, including the hippocampus, frontal lobe, substantia nigra, and subthalamic nucleus, and thalamus. KLK6 can also be detected in the adult brain neurons, while a paucity of KLK6 labeling was observed in resting astrocytes and microglia. It is mainly secreted by oligodendrocytes, pyramidal cells, astrocytes, and glial cells (Murakami et al., 2013). Several studies of neurological diseases, including Parkinson's disease (PD), Alzheimer's disease, and multiple sclerosis (MS), indicated that KLK6 could play important functional roles in the brain. The original finding that KLK6 expression is reduced in brain lesions associated with Alzheimer's disease and PD triggered further studies on the potential involvement of the KLK6 protease in neurodegeneration (Zargooni et al., 2002; Ogawa et al., 2000;). Alzheimer's disease is the most common form of dementia, and it is characterized by the pathological accumulation of amyloid β, a proteolytic fragment of the amyloid precursor protein (APP). Not only has KLK6 been shown to cleave APP in vitro efficiently, but the immunohistochemical examination of healthy brain tissue and brain tissue from individuals with Alzheimer's disease has confirmed the proximal co-localization of APP and KLK6 in the brain (Magklara et al., 2003; Ogawa et al., 2000). On the other hand, PD is characterized by the abnormal accumulation of insoluble a synuclein (a-syn) aggregates in Lewy bodies, a pathognomonic feature characteristic of PD and other synucleinopathies such as dementia with Lewy bodies (DLB). Interestingly, KLK6 co-localizes with a syn in Lewy bodies in the brains of PD patients (Iwata et al., 2003). KLK6 cleaves the recombinant a-syn efficiently but not the endogenously secreted a-syn. Resistance of endogenous a-syn to KLK6 proteolysis is probably due to modifications, mainly lipidation (Ximerakis et al., 2014). It has been proposed that KLK6 triggers a proteolytic cascade that also involves metalloprotease(s), leading to cleavage of endogenous a-syn (Ximerakis et al., 2014). In vivo, administration of a lentivirus driving the liver expression of a KLK6 fusion protein with apolipoprotein B (ApoB), which could cross the blood-brain barrier, showed significant improvement of pathology in a mouse model of multiple system atrophy, manifested by improved behavioral tests, as well as reduced a-syn in oligodendrocytes and astrocytes (Spencer et al., 2015). Although KLK6 is considered to be involved in PAR1-mediated inflammation (Billi et al., 2020), no signs of 20

53 neuroinflammation were observed upon administering the KLK6-ApoB fusion protein (Spencer et al., 2013 and 2015). More recently, it was found that KLK6 is involved in the turnover and uptake of extracellular a-syn species (Pampalakis et al., 2017). Taken together, the results of these studies indicate that KLK6 could represent a novel therapeutic protein for PD and other synucleinopathies. Further, the expression of KLK6 has been found elevated in sera and cerebrospinal fluid of patients with progressive multiple sclerosis (Scarisbrick et al., 2012), an autoimmune neurodegenerative disorder. Although KLK6 is highly abundant in CNS, studies on KLK6 mrna and protein expression indicate a relatively widespread distribution. That includes high to moderate levels of expression in the kidney, testis, appendix, pancreas, thymus, and spleen (Shaw and Diamandis, 2007). In addition to robust expression in neurons, oligodendroglia, and choroid plexus of the adult CNS, KLK6-immunoreactivity has been demonstrated in peripheral nerve, prostate, kidney, breast, endometrium, colon, placenta, salivary glands, appendix, endocervix, fallopian tube, bronchus, epididymis, thyroid and parathyroid oxyphilic cells, Hassall's corpuscles of thymus and dendritic cells in the spleen. Also, KLK6 has been found in neuroendocrine tissues, including islets of Langerhans, anterior pituitary, and adrenal medulla (Petraki et al., 2001). Recently, it was reported that KLK6 is implicated in skin inflammation and may represent a novel druggable target for NS and other inflammatory conditions, e.g., atopic dermatitis (Zingkou et al., 2019). KLK7 KLK7 was initially isolated from stratum corneum tissue as a serine protease with a chymotrypsin-like activity involved in the regulated desquamation of terminally differentiated keratinocytes, and it was initially named stratum corneum chymotryptic enzyme (SCCE) (Egelrud and Lundstrom, 1991; Lundstrom and Egelrud, 1988). KLK7 is produced as a single-chain pre-proenzyme that is secreted after removing the signal peptide as a zymogen. The short propeptide is removed by KLK5 and leads to mature enzyme production with 225 residues. There is one potential glycosylation site at Asn

54 KLK7 is mainly expressed in the skin. KLK7 is also detected at relatively high levels in the esophagus, heart, liver, central nervous system, kidney, pancreas, mammary and salivary glands (Yousef et al., 2000; Shaw and Diamandis, 2007). The study of skin homeostasis revealed KLK7 biology and its physiological roles. Zymogen pro-klk7 is secreted by keratinocytes in the stratum granulosum and secreted to the outermost layer of the skin extracellular space, the stratum corneum (Caubet et al., 2004; Brattsand et al., 2005). KLK5 activates pro-klk7, while serine protease matriptase (Sales et al., 2010) and the metalloprotease meprin β (Ohler et al., 2010) may also be involved in KLK7 activation. That occurs either directly by removing the propeptide of KLK7 or indirectly through the activation of upstream members of the KLK cascade (Pampalakis and Sotiropoulou, 2017d). KLK7 plays an essential role in the skin desquamation process through hydrolysis of the corneodesmosin and desmocollin 1, two corneodesmosomal adhesive proteins in the stratum corneum (Caubet et al., 2004; Descargues et al., 2006; Emani and Diamandis, 2008), as well as the acidic sphingomyelinase and β-glucocerebrosidase, two enzymes involved in lipid biosynthesis (Hachem et al., 2005). For skin homeostasis maintenance, a tight balance between the new corneocytes production and desquamation is required. In contrast, a misbalance between these two processes results in an impaired skin function and ultimately in dermatological diseases such as atopic dermatitis or Netherton syndrome, two diseases characterized by epidermal barrier dysfunction (Cork et al., 2009). In normal conditions, this balance is maintained by expressing endogenous protein inhibitors of KLK7, counteracting its proteolytic activity. The serine protease inhibitor LEKTI encoded by the SPINK5 gene inhibits KLK7, KLK5, and KLK14 in human skin (Deraison et al., 2007; Schechter et al., 2005; Brattsand et al., 2005). In skin disorders, KLK7 overexpression and/or increased activity result in overdesquamation (Hachem et al., 2006; Komatsu et al., 2007a and 200b). In addition to its role in the structural component of skin diseases with impaired barrier function, KLK7 may also contribute to their inflammatory components. Indeed, KLK7 was shown to cleave the antimicrobial peptide precursor cathelicidin to yield the active antimicrobial peptide LL-37 (Yamasaki et al., 2006) as well as the precursor of the pro-inflammatory cytokine IL-1β (Brattsand and Egelrud, 1998; Nylander-Lundqvist and Egelrud, 1997). Increased KLK7 expression has been found in the epidermis of Netherton syndrome and atopic dermatitis patients (Jun et al., 22

55 2018; Igawa et al., 2017; Morizone et al., 2012; Komatsu et al., 2007a). The involvement of KLK7 in skin disorders development is further supported by the genetic association in both animal models and humans. It has been shown that transgenic mice overexpressing human KLK7 develop skin features similar to those seen in chronic atopic dermatitis patients (Hansson et al., 2002). Similarly, mice lacking the endogenous serine-protease inhibitor LEKTI display characteristic features of Netherton syndrome, including altered desquamation through the degradation of desmosomes by epidermal protease hyperactivity in the epidermis (Descargues et al., 2005). Recently, it was showed that targeting the KLK5 protease can rescue neonatal lethality in Spink5 -/- mice that recapitulate Netherton syndrome (Furio et al., 2015), but KLK7 must be additionally inhibited in Spink5 -/- Klk5 -/- epidermis to sustain low proteolysis, normal desquamation rates and suppressed inflammation (Kasparek et al., 2017). Numerous potentially biologically relevant proteins have been shown to be cleaved by KLK7 in vitro, including E-cadherin (Johnson et al., 2007), corneodesmosin (CDSN), and desmocollin 1, responsible for maintaining cellular junctions (Caubet et al., 2004), the lipid-processing enzymes β-glucocerebrosidase and acidic sphingomyelinase (Hachem et al., 2005), and the proinflammatory cytokine pro-interleukin 1β (Nylander- Lundqvist and Egelrud, 1997). Most of these proteolytic processes are degradative and proceed rapidly (Caubet et al., 2004; Hachem et al., 2005), further illustrating that the enzyme is very active against larger peptide and protein substrates. The optimum ph for KLK7 is between 7 and 8, but significant activity is also found at ph 5.6, the ph found at the outer layers of the stratum corneum (Caubet et al., 2004). KLK7 can be inhibited by the broad-spectrum serine protease inhibitors PMSF, aprotinin and soybean trypsin inhibitor, as well as the chymotrypsin inhibitor chymostatin (Egelrud and Lundstrom, 1991). KLK7 can also be inhibited by peptidebased chloromethyl ketone (CMK) inhibitors and non-competitively inhibited by Zn 2+ and Cu 2+, with a KI(app) of 10 μm and 0.6 μm, respectively (Debela et al., 2007). A number of macromolecular protease inhibitors expressed in the skin have been proposed to regulate KLK7 activity in vivo. The inhibitors antileukoproteinase (Hachem et al., 2005), LEKTI (Schechter et al., 2005), and serine protease inhibitor Kazal-type 6 (SPINK6) (Meyer-Hoffert et al., 2010) have all been purified from the stratum corneum tissue and can inhibit KLK7 in vitro with KI in the low nanomolar to 23

56 low micromolar range. The best-characterized endogenous protein inhibitor of KLK7 is the serpin vaspin (SERPINA12) (Heiker et al., 2013; Ulbricht et al., 2015). Another well-characterized endogenous inhibitor is LEKTI, a Kazal-type serine protease inhibitor encoded by the SPINK5 gene (Ishida-Yamamoto et al., 2005; Schechter et al., 2005). For pharmaceutical purposes, various inhibitors of kallikreins have been developed, such as natural peptides and proteins (Krastel et al., 2013), natural heterocyclic compounds, synthetic peptides (de Veer et al., 2017), and non-peptidic compounds (Masurier et al., 2018). The latter include coumarin-3-carboxylate derivatives, which act as inhibitors for certain kallikreins, a-chymotrypsin, human leukocyte elastase, and matriptase (details and additional examples are given below). Roles of KLK7 protease in cancer While increased KLK7 expression levels have been associated with the prognosis in various types of cancers, its contribution to tumor progression at the molecular level remains mainly unclear and therefore deserves further investigation. Emerging, however, is the potential involvement of KLK7 in the progression of prostate cancer. KLK7 transcripts found in the skin differing from transcripts expressed from acinar cells of the exocrine pancreas (Dong et al., 2008) and expression profiling studies revealed that KLK7 was overexpressed in pancreatic adenocarcinomas (Johnson et al., 2007). The current hypothesis for the molecular mechanism by which KLK7 may promote pancreatic tumor progression argues for a similar protease function described in the skin. KLK7 was reported to cleave the intercellular adhesive desmosomal protein desmoglein 2 in vitro, as well the extracellular matrix protein fibronectin (Ramani and Haun, 2008), and can facilitate pancreatic cancer cell invasion through the shedding of E-cadherin (Johnson et al., 2007). These findings are further supported by the observation that KLK7 increased the migration and invasion of prostate carcinoma cells in vitro and induced several markers specific to epithelial-to-mesenchymal transition (Meyer-Hoffert et al., 2010). However, whether KLK7 mediates prostate cancer progression and promotes invasion and metastasis will have to be demonstrated in animal models or prostate cancer patients. 24

57 KLK6 activity and specificity Juliano and coworkers utilized positional scanning at five positions within an internally quenched heptapeptide substrate to elucidate the P3-P2' specificity (Angelo et al., 2006). This study identified an exclusive specificity for Arg in the substrate P1 position, with no detectable hydrolysis occurring after any other residue (including Lys). The P2 specificity was pronounced for Phe, with hydrolysis at a reduced rate for Leu, Gln, and Val residues, thus indicating a general hydrophobic preference at this position. The P3 preference was broad, but Ala is exhibiting the highest rate of hydrolysis. The P1' preference was for either Phe or Ser, with generally reduced hydrolysis and no preference beyond these two residues. There was no significant P2' preference, although Ser appeared to have the highest rate of hydrolysis. Thus, these results identified KLK6 as an Arg-specific peptidase with a comparatively broad specificity but preference for hydrolysis after Arg in the sequence Xaa-Phe-Arg- -(Phe/Ser)-Xaa. A subsequent positional scanning study of 7-amino-4-carbamoyl methylcoumarin tetrapeptides (covering the P4-P1 substrate positions) supported the P1 positional preference for Arg (Debela et al., 2006). However, it also identified reduced but significant hydrolysis after Lys, Ala, Leu, and Met. Notably, this study identified a substantial preference for the basic residues Arg/Lys in the substrate P2 position and did not identify any hydrophobic preference. Substrate specificities were essentially undetectable at the P3 and P4 positions. Thus, these KLK6 substrate specificity studies have significant disparities. Georgiou and coworkers later reported a phage display study of KLK6 extending over the substrate P4-P4' positions (Li et al., 2008). Using this library, the P1 specificity was identified as exclusively Arg with no hydrolysis observed after Lys or other residues. The observed P2 specificity was for hydrolysis after either Phe or Val, while P3 and P4 specificities were broad. The P1' specificity was for hydrolysis after Ser (with a secondary preference for hydrolysis after Met, Asn, and Tyr). The P2' specificity exhibited a preference for Ala (with a secondary preference for Val, Ser, and Trp). The P3' and P4' specificities were broad. Thus, this study identified the KLK6 substrate specificity as Xaa-Xaa-(Phe/Val)-Arg- -Ser-Ala- Xaa-Xaa for P4-P4'. This result is generally in good agreement with the results of Juliano and coworkers. Georgiou and coworkers proposed that a possible basis for the disparate results of Bode s group (Debela et al., 2006) might be due to the 25

58 methycoumarin fluorophore in the Bode study residing in the substrate P1' position and exerting an influence upon substrate hydrolysis. Hollenberg and coworkers reported a related phage display study of KLK6 substrate specificity involving a random hexapeptide library (Sharma et al., 2008). After five cycles of panning, 32 colonies were picked for sequencing, in which twenty-seven clones contained Arg, nine contained Lys, and three clones contained neither Arg nor Lys residues. The most common Arg-Xaa dipeptide sequence observed in the panned library was Arg-Ser (11 instances). The most common Xaa-Arg dipeptide sequence observed was Ala-Arg (8 instances); however, a set of hydrophobic residues comprised a total of 19 cases (Leu (5), Val (3), Ile (1), Phe (2), and Ala (8)). These results are consistent with the results of Juliano and Georgiou in identifying KLK6 as an Argspecific protease with only limited ability to hydrolyze after Lys and exhibiting a substrate P2 preference for hydrophobic residues and P1 preference for Ser, but little specificity in other positions. Further studies are needed to fully elucidate the substrate specificity of KLK6. However, a general consensus sequence Xaa-Xaa-(hydrophobic)- Arg is emerging for P4-P1. In another study (Magklara et al., 2003), several synthetic 7-amino-4-methylcoumarin (AMC) tripeptides were tested as substrates with sequence Xaa-Xaa-Arg-AMC or Xaa- Xaa-Lys-AMC. Phe-Ser-Arg-AMC and Val-Pro-Arg-AMC were the best ones, with the highest kcat and kcat/km values, but the selectivity was low. KLK8 also easily hydrolyzed these tripeptides. At this point, it should be noted that all the studies mentioned above were based on synthetic peptides and may not fully recapitulate what is happening in cells and tissues. Indeed, a recent terminal amine isotopic labeling of substrates (TAILS) mass spectrometry-based study suggested that KLK6 has a restricted number of natural substrates (Pampalakis et al., 2017b). Regulation of KLK6 activity is achieved via a two-step autoactivation involving initial autolysis after an atypical Gln residue in the propeptide (Bayés et al., 2004). Studies revealed the second mechanism of regulation with active recombinant KLK6, which identified several arginine residues within (RAT)Klk6 and KLK6 that are subject to autolytic cleavage. Like trypsin, unlike many of the kallikreins, such autolysis results in the inactivation of the enzyme activity (Blader et al., 2007; Bayés et al., 2004; Bernett 26

59 et al., 2002; Blader et al., 2002). Thus, autolysis is a potential autoregulatory mechanism. Western blots of CNS tissue have indicated the third mechanism extracts with (RAT)Klk6 specific antibodies, which have shown that a significant proportion of (RAT)Klk6 is present in these tissues as an SDS-resistant complex of ~50 kda (Blader et al., 2002). The identity of (RAT)Klk6-specific inhibitor(s) remains to be determined, but these probably represent another important regulatory mechanism leading to inactivation. KLK7 activity and specificity The S1 pocket of KLK7 comprised of the catalytic triad residues is shallow and wide and has an asparagine residue at position 189. This is unusual among serine proteases and helps define the rather limited P1 specificity of KLK7, which prefers aromatic residues, but cannot cleaves after Trp, presumably due to steric constraints. The surface loops surrounding the protease active site are relatively small, creating a shallow and open active site, and there is no large kallikrein loop as seen in KLK1. In addition to the main specificity pocket S1, subsites S2-S4 and S1'-S4' contribute to substrate recognition. The structure of KLK7 in complex with Cu 2+ and the inhibitor Suc-Ala- Ala-Pro-Phe-CMK helps to define a mechanism of non-competitive inhibition by metal ions. A Cu 2+ atom is coordinated by His 99 and Thr 96, and although it cannot rotate in the presence of a CMK inhibitor, it is proposed that the His 57 side chain can rotate and coordinate the Cu 2+ atom, thus disrupting the catalytic triad and non-competitively inhibiting the enzyme (Debela et al., 2006 and 2007). KLK7 proteolytic activity was first detected by zymogram, where the enzyme was shown to readily cleave heat-denatured casein (Egelrud and Lundstrom, 1991). The chymotrypsin-like specificity of the KLK7 was determined by observing the cleavage of chromogenic peptide substrates preferred by chymotrypsin (Egelrud and Lundstrom, 1991) and noting that the enzyme cleaved the β-chain of bovine insulin after an aromatic residue (Skytt et al., 1995). Positional scanning substrate libraries revealed that KLK7 has a strong preference for substrates with Phe and Tyr at the P1 position, bulky amino acids in the P2 position, and broad tolerance at P3 and P4 (Debela et al., 2006). Another study (Oliveira et al., 2015) confirmed the preference for Phe and Tyr at P1. The enzymatic activity of KLK7 is relatively low on tetrapeptide substrates such as (Suc)- 27

60 Ala-Val-Pro-Phe-pNA (kcat/km of 16.0 M -1 s -1 ) (Debela et al., 2007). However, it increases drastically when a larger peptide substrate is used. Screening of a positional library of 120 tetrapeptides demonstrated that Tyr and Phe at P1 are preferred, with Tyr slightly more than Phe (de Veer et al., 2017). Optimal sequences for P4-P1 were H2N-Lys-His-Leu-Tyr-pNA (KHLY-pNA), H2N-Lys-Thr- Leu-Tyr-pNA (KTLY-pNA), and H2N-Lys-His-Leu-Phe-pNA (KHLF-pNA). These peptides are selective substrates for KLK7 and not for chymotrypsin. This selectivity is reduced when P4-P1 of sunflower trypsin inhibitor-1 (SFTI-1) is substituted with KHLY and KHLF. SFTI-1 turns from a high trypsin affinity inhibitor to a chymotrypsin cyclic peptide inhibitor. Both SFTI-1 (KHLY) and SFTI-1(KHLF) are potent KLK7 inhibitors (Ki=2.5 nm and Ki=4 nm, respectively). Another screening study (de Veer et al., 2013) showed that SFTI-1(WCTF) with Thr and Phe at P2 and P1, respectively, completely blocked hydrolysis of KHLY-pNA substrate by KLK7 but did not inhibit the activity of KLK5 and KLK14. The molecular dynamic analysis suggested that SFTI-1(WCTF) is attached to the enzyme through aromatic interactions. The Thr at P2 was a surprise for the researchers but is in agreement with previous studies where the substrate specificity with Thr at the P2 was enhanced (Debela et al., 2006). Inhibitors of kallikrein-related peptidases Various physiological mechanisms, shared with the other proteases, regulate the expression and the activity of KLKs: (a) transcriptional and (b) post-transcriptional level of expression, (c) compartmentalization, (d) presence of an activation cascade, (e) ph, and (f) presence of protease inhibitors (Pampalakis and Sotiropoulou, 2003, 2006 and 2009; Lu et al., 2005). The inhibitors are distinguished in reversible and irreversible binding inhibitors, where a covalent bond with the protease is formed. They can also be distinguished in endogenous physiological and non-physiological inhibitors. Metal ions. The simplest KLK inhibitors are the cations Zn 2+ (mainly) and Cu 2+. The majority of KLKs (KLK2-5, 7, 8, 10, 12, and 14) are inhibited by Zn 2+ (Debela et al., 2006 and 2007; Borgoño et al., 2007b; Lovgren et al., 1999; Costello et al., 2004). Briefly, the inhibition mechanism involves the coordination of zinc cation by one or more residues of the catalytic triad or other residues. The coordination disrupts the 28

61 hydrogen bonds of catalytic triad or salt bridges elsewhere, resulting in enzyme inhibition. Endogenous protein inhibitors. Serpins (serine protease inhibitors), Kazal-type inhibitors, macroglobulins, and Kunitz-type inhibitors are all peptides or proteins that inhibit KLKs and other serine proteases (Masurier et al., 2018). Most of them are covalent inhibitors and inactivate the proteases by binding in the active pocket or elsewhere. The complexes are degraded by proteolysis in the extracellular matrix or lysosomes after endocytosis. The main serpins that inhibit KLKs are kallistatin (KLKs 1,7,13,14), a1-antitrypsin (a1- AT, KLKs 1,3-7,12,14), a1-antichymotrypsin (a1-act, KLKs 2,3,6,7,14), a2- antiplasmin (a2-ap, KLKs 2,4-8,11-14), antithrombin III (ATIII, KLKs 2-4,6,8,12-14), and Protein C Inhibitor (PCI, KLKs 2,3,5,7,8,11-14) (Goettig et al., 2010). Representative Kazal-type inhibitors are the LEKTI (lympho-epithelial-kazal-type inhibitor) fragments resulting from the macromolecular KEKTI, encoded by the SPINK5 gene. LEKTI is crucial in skin development, as mutations affecting LEKTI synthesis underlie Netherton syndrome. LEKTI is not a specific inhibitor for the KLKs, and single- or multi-domain peptides generated by cleavage of the macromolecular precursor inhibit several serine proteases. KLK5 and KLK7 are mainly inhibited, but some domains also inhibit KLK6, 13, and 14 (Masurier et al., 2018). Kunitz inhibitor (BPTI, bovine pancreatic basic trypsin inhibitor or the pancreatic Kunitz inhibitor, also known as aprotinin) is a plasma polypeptide and inhibits mainly trypsin-like KLK1,2,4,5,12,14 and plasma KLK. Others Kunitz-type serine protease inhibitors that inhibit KLKs are the soybean trypsin inhibitor (SBTI), the lima bean trypsin inhibitor, and hirustatin. Altered peptides: Peptide aldehydes and depsipeptides. Leupeptin, chymostatin, and antipain are peptidyl aldehydes isolated from microorganisms (Figure 7) that inhibit some KLKs. They are reversible inhibitors, and the inhibition results from the nucleophilic attack of Ser 195 to the aldehydic carbonyl group. Depsipeptdes isolated from Chondromyces bacteria, like the example shown in Figure 8, can inhibit KLK7 but not selectively because they also inhibit other proteases such as chymotrypsin or the human neutrophil elastase (Krastel et al., 2013). 29

62 Figure 7: The structure and mechanism of peptide aldehydes inhibitors. Upper, peptide aldehydes inhibitors, the C-terminal carboxylic group has been replaced by an carbonyl group. Lower, Mechanism of action. Figure 8: KLK7 cyclic depsipeptide inhibitor. Isocoumarins. The isocoumarins (Figure 9) are natural derivatives extracted from Paepalanthus bromelioides Silv., and are competitive inhibitors of KLK5 and KLK7 (Teixeira et al., 2011). They are positioned at S1 and S1' pockets of the KLKs to form a complex stabilized by hydrogen bonds. The best affinity inhibitor for KLK7 is the 8,8' paepalantin dimer (Ki = 12.2 μm). 30

63 Figure 9: Structure of isocoumarins extracted from Paepalanthus bromelioides Silv. Synthetic peptidic derivatives. Cyclic peptides, chloromethylketone (CMK) peptides, boronic-type peptides, pseudopeptides, and peptidyl phosphonates have been reported to inhibit kallikreins. Phosphonate peptides will be discussed in detail in the next chapter. The cyclic peptide sunflower trypsin inhibitor-1 (SFTI-1) consists of 14 residues (amino acid sequence: [GRCTKSIPPICFPD]c) and mimics a substrate for trypsin, where SFTI-1 Lys5 inserts to S1. Modifications at P4, P2, P1, and P2' gave potent inhibitors of KLK4, KLK5, KLK7, and KLK14 (Jendrny et al., 2016; de Veer et al., 2015; Swedberg et al., 2009; Chen et al., 2016). The chloromethylketone peptides (Figure 10) are covalent, irreversible, but nonselective KLK inhibitors. The nucleophilic attack of Ser 195 to carbonyl group finally leads to akylation of His 57 and irreversible inhibition of KLKs. Peptides with boronic- instead of carboxyl-end (Figure 11) are KLK3 inhibitors with Ki in the low nanomolar range (LeBeau et al., 2009). These compounds can mimic the tetrahedral transition state during the amide hydrolysis by serine proteases, resulting in inhibition. Synthetic LMW inhibitors Numerous LMW synthetic compounds have been developed and tested as inhibitors of serine proteases, in particular, KLKs (Figure 12). Sulfonyl fluorides inhibit many serine proteases and some of KLKs (Powers et al., 2002). The inhibition is achieved by sulfonylation of Ser 195. The resulting sulfonyl enzyme is very stable. Benzoxazinones (Koistinen et al., 2008) and β-lactams (Adlington et al., 2001) are potent inhibitors of KLK3 and 1-acyl-1,2,4-triazoles (Tan et al.; 2013) inhibitors of KLK7 (Figure 12A). 31

64 Figure 10: Chloromethylkenote based compounds that inhibit KLKs. Figure 11: Structure of boronic-type peptides inhibiting KLK3. Their inhibitory mechanism involves the nucleophilic attack to carbonyl moiety, the ring opening (in the case of oxazinones and lactams), and the acylation of Ser 195. The enzyme adduct is stable; however, slow hydrolysis can occur that re-generates the enzyme. These inhibitors are also not selective for KLK3 or KLK7. The 3-carboxylate coumarin derivatives (Figure 12A) are KLK5, KLK7, KLK14, and matriptase inhibitors (Tan et al., 2015). They inhibit KLK5, KLK14, and matriptase reversibly and KLK7 irreversibly. These coumarin derivatives have two reactive moieties, a lactone, and a halogen-substituted methylene group. Αcylation of Ser 195 due to lactone opening is followed by covalent bond formation with His

65 Figure 12: Examples of synthetic LMW KLK inhibitors. A, covalent inhibitors. B, noncovalent inhibitors. The p-amidobenzylamine derivatives (Figure 12B) are active against KLK6 (Liang et al., 2012). Several potential inhibitors of KLK5 and KLK7 have reported by Tan et al. Among them, a quinazolinone derivative (Figure 12B) was proved to be a potent reversible inhibitor of KLK7 (Tan et al., 2013) and selective among the proteases tested 33

66 (KLK5, 7, 14 and matriptase). Among other synthesized heterocyclic compounds, the compound containing the imidazodiazepinone moiety (Figure 12B) was determined to be a potent KLK7 inhibitor (Arama et al., 2015; Masurier et al., 2012). Finally, isomannide derivatives are potent competitive inhibitors of KLK5 and KLK7 (Freitas et al., 2012; Oliveira et al., 2013). Recently, another isomannide derivative was reported as a selective KLK1 inhibitor with no inhibitory potency against KLK2, 5, 6, and 7 (Barros et al., 2017). Finally, DNA aptamers that bind specifically to KLK6 have been identified (Arnold et al., 2012), as well as DNA (Savory et al., 2010) and RNA aptamers for KLK3/PSA (Jeong et al., 2010). Whether these aptamers can inhibit the enzymatic activity of KLK6 remains to be identified in the future. Benzamidines (Figure 12B) are noncovalent, weak, unspecific, and reversible inhibitors of trypsin-like proteases that mimic the P1 side chain of Arg. Benzamidine inhibits KLK1, 2, 6, 8, 11, and 12, and p-amino-benzamidine inhibits KLK4 and 5 (reviewed in Masurier et al., 2018). The inhibitory effect of the noncovalent inhibitors mentioned below is due to the hydrogen bonds formed between the inhibitors and the residues of the catalytic triad and/or other residues of S1, S1' and S2' pockets. 34

67 ABPs for serine proteases Activity-based probes (ABPs) are relatively small synthetic molecules that covalently bind to the active site of a given enzyme. ABPs have been designed and tested against many enzyme classes but have the greatest utility and application in proteases. They bind irreversibly via a covalent bond formation that deleterious the enzyme and, thus, this kind of probes are also inhibitors. The inactivation of the conjugated enzyme also tags the enzyme, rendering possible a subsequent analysis. ABPs are central in activitybased protein profiling (ABPP), also known as activity-based proteomics. ABPP is a technique that monitors the activity of the enzymes in complex biological systems and discerns active enzymes from zymogens and inactivated endogenous inhibited forms. In that regard, ABPP is superior to proteomics, which detects the abundance of enzymes. ABP probes react with conserved residues within the active site of enzymes, and the mechanistic differences between proteases affect ABP specificity. ABPs have been developed for a wide range of enzyme classes, especially over the past two decades. In this study, we focus on proteases, especially serine proteases. Early examples of class-specific ABPs are the FP-biotin, a biotinylated fluorophosphonate probe for serine hydrolases (Liu et al., 1999), and DCG-04, a biotinylated peptidyl epoxide phosphate probe for papain-like cysteine proteinases (Greenbaum et al., 2000) (Figure 13). Fluorophosphonate derivatives are broad-spectrum serine hydrolase probes and are widely used in chemical proteomic studies. DCG-04 and derivatives are used for monitoring the activity of cysteine proteases. Figure 13: The structure of ABPs FP-biotin and DCG

68 ABPs can be used in protease enzymology studies, to discover and develop drugs and as diagnostic tools (Edgingston et al., 2011; Fonovic and Bogyo, 2012; Deu et al., 2012). Substrate-based probes (SBPs), as ABPs, have also been used to study protease activation. The use of ABPs is advantageous due to the selective active site targeting, and thus only active forms are identified. A subcategory of fluorescent ABPs, the quenched activity-based probes (qabps), selective for specific localized proteases in vivo, can help localize the disease and, especially, the tumor margins (Cutter et al., 2012). This feature could be handy to ensure that all tumor is cut during an operative procedure. Structure and design of ABPs Usually, protease ABP (Figure 14A and 14B) consists of three parts: a reactive group (also called Warhead), a spacer or linker, and a tag or a ligation handle. A warhead is a reactive group, usually an electrophile, responsible for the covalent bond formation with the enzyme's active site. A warhead must react only with amino acid residues on the active site, not with off-target residues, to ensure that ABP labels the active form solely. The linker or spacer component is inserted to reduce the interaction between the warhead and reporter tag. Usually, the linker also plays a significant role in recognizing and selecting the target enzymes. Finally, the reporter tag provides various means to visualize, identify, isolate and/or quantify the target enzymes by SDS-PAGE, MS, blotting, fluorescence microscopy, noninvasive imaging, etc. When a tag is used, the ABP is considered one-step or direct ABP (Figure 14A). When a ligation handle is used, ABP becomes a two-step ABP (Figure 14B) since one more step, a bioorthogonal ligation reaction, is needed prior to subsequent analysis. For one-step ABPs, the common reporter group is an affinity tag as biotin (for the enrichment of the labeled enzymes and subsequent MS or detection by Western blotting) and fluorophores (used for microscopy visualization or in-gel analysis). In general, gel-based techniques are the initial and principal methods for the visualization of the labeled enzymes (Deng et al., 2020). There are two perspectives for designing selective ABPs for serine, cysteine, and threonine proteases. One is to take a highly selective substrate and introduce a reporter and a warhead to bound irreversibly to protease active site. The other is to take an irreversible inhibitor, either of synthetic or natural origin, and add a detection tag. 36

69 Many modifications may be applied to the three ABP components in both cases, obtaining the optimum ABP for a given protease(s). Figure 14: Schematic representation and application of ABPs. A and B, The general structure of one-step and two-step ABP, respectively. C and D, Target identification and detection by one-step or two-step ABP, respectively. (Adapted by permission from Deng et al., 2020). Reactive group (Warhead) The warhead of ABPs for most serine (SP), threonine (TP), and cysteine proteases (CP) are electrophiles that directly react with the -OH or -SH group of residues on the active site pocket. Such electrophiles are activated ketones, phosphorylating (SP and TP ABPs), or sulfonylating (CP ABPs) agents, epoxides, and Michael acceptors (Figure 15). The reactive group of aspartyl and metalloprotease ABPs is a latent reactive crosslinker, activated by light. More specific reactive groups for SP are the fluorophosphonate, which gives pan-serine protease ABPs, diphenyl phosphonate (DPP) and 4-chloroisocoumarin moiety. DPP derivatives are very useful ABPs for the 37

70 study of S1 family (PA clan) of proteases, to which KLKs belong. In Table I have summarized the warheads targeting serine proteases, selectively or not. Figure 15: Representative electrophiles used in ABPs. A, Activated ketones. B, Phosphonylating and sulfonylating agents. C, Epoxides. D, Michael acceptors. 38

71 TABLE I: Serine protease-reactive warheads. Entry Warhead Targets References 1 Serine hydrolases Liu et al., 1999 Tuin et al., 2009 Fluorophosphates 2 Phosphonates Serine proteases Abuelyaman et al., 1994 Mahrus and Craik, 2005 Pan et al., Serine proteases Kam et al., 1993 Haedke et al., 2012 Isocoumarines 4 Sulfonyl fluorides Serine proteases Lipases Yan et al., 2004 Tam et al., β Lactones Variety of enzymes, including serine proteases Böttcher and Sieber, β-lactams Variety of enzymes, including serine proteases Staub and Sieber,

72 Figure 16: Influence of kinetics and warhead reactivity on ABP efficiency and specificity. A, ABP-enzyme two-step interactions: the first reversible step is characterized by the KD (k-1/k1) and determined by the binding affinity. The second irreversible step is characterized by the kcat and determined by the warhead reactivity. Even a board selectivity of the warhead for the protease family is required. B, The affecting of KD and Kcat in the target protease characterization. High KD values indicate low substrate affinity. High kcat values indicate very reactive warheads. Various combinations of these constants are represented by numbers 1-5. Each ABP usually reacts also with off-target proteases. Optimized Kcat/KD allows the target protease characterization, excluding the off-target protease visualization (B, top right). (Adapted from Sanman and Bogyo, 2014). 40

73 The ideal warhead electrophile must be easy to synthesize and have good bioavailability and desired and targeted reactivity. The warhead reactivity is crucial for the specificity and reactivity of an ABP, which are affected by the second step of the irreversible attaching on the enzyme's active site. The first binding step is reversible and is influenced mainly by the ABP substrate affinity and is characterized by the dissociation constant, KD. The second, irreversible step, is driven by the warhead reactivity and is measured by the kcat, the rate constant (Figure 16A). High kcat, resulted from high warhead reactivity, diminishes the impact of probe selectivity (KD). Low kcat values, indicating a slow reaction rate, affect the overall capacity to labeling the target enzyme. In the middle range of values, the influence of KD is altered, and the optimization of the substrate affinity and warhead reactivity tunes the efficiency and selectivity of an ABP (Figure 16B). Spacer or linker As was mentioned above, the linker or spacer component of an ABP is inserted to reduce the warhead and reporter tag interaction. Linker also can be used to reduce steric hindrance, modulate membrane permeability, and solubility in biological media. Usually, the linker also plays a significant role in recognizing and selecting the target enzymes. The nature of the electrophile (targeting SP or CP etc.) combined with a recognition peptide sequence results in ABPs with reasonable selectivity. The linker/warhead combination provides a tuning selectivity means. A substrate protein domain, even an entire protein, can be an ABP linker. Usually, peptide sequences that correspond to Pn P2P1 before the scissile bond or Pn P2P1 P1'P2' Pn' around the scissile bond of the optimal substrate are used as a spacer (Edgington et al., 2011). Actually, in these cases, the spacer is, in fact, a recognition sequence. However, it must be mentioned that the best substrate sequence does not ensure that the resulting ABP is the most potent and specific (Kahler et al., 2020). It is challenging to choose a recognition sequence specific for a single protease because relative proteases have overlapping substrate specificity. In some cases, valuable tools to overcome this problem are the substrate screening libraries (including sequences with natural and non-natural amino acids) (Martin et al., 1995; Kasperkiexicz et al., 2012). 41

74 An excellent example is the production of ABPs capable of distinguishing well enough similar caspases (Vickers et al., 2013). Another way to generate and screen libraries for determining the optimum sequence is the phage display (Heinis et al., 2009; Pollaro et al., 2012). In some cases, the linker is extended to the reporter tag with a non-cleavable part, usually polyethylene glycol (PEG) or alkyl units. Both are non-immunogenic and biologically inert parts. Alkyl groups are hydrophobic and less flexible than the PEG units, while PEG units provide polarity and solubility. The desirable properties of the ABP can be affected by these units to improve accessibility and selectivity. For example, a hydrophobic extended alkyl region may help facilitate access of a given probe to a hydrophobic enzyme pocket. When biotin is used, longer spacers between biotin and warhead give more potent ABPs (Kam et al., 1993). Reporter or detection tags The detection tag enables visualization and/or manipulation of the enzyme targets (Jeffery and Bogyo, 2003; Greenbaum et al., 2002; Patricelli et al., 2001). Often, the detection technique determines the choice of reporter tag (Figure 17). The analysis takes place by gel electrophoresis, tandem mass spectrometry-based proteomics (after biotin enrichment), fluorescent microscopy, whole-body imaging, or flow cytometry. Most detection labels can be used for gel-based technics. A fluorescent or radioactive label can be used for imaging experiments, while an affinity handle (usually biotin) is suitable for target identification experiments. Tandem mass spectrometry proteomics requires the target separation assisted by biotin tag and (strept)avidin enrichment, even from very low concentration mixtures. A disadvantage of biotin use is that endogenous biotinylated proteins may enhance the noise signal and cause interference. For the two-step ABPs, the reporter tag overcomes using bio-orthogonal chemistry after the ABP/enzyme conjugate. The chosen reporter reacts with the ligation handle being an azide or alkyne by click chemistry (Willems et al., 2011; McKay and Finn, 2014), first reported by the Cravatt group in 2003 (Speers et al., 2003). This way, the reporter tag's influence on the ABP's physicochemical properties, which can affect the target binding, is reduced (Chakrabarty et al., 2019). The detection techniques are the same as those for one-step ABPs. 42

75 Figure 17: Reporter types and their associated techniques. (Adapted by permission from Chakrabarty et al., 2018). Selectivity Depending on the application, ABPs with either reduced or enhanced selectivity are both valid. When a high degree of selectivity is required, combined modifications on warhead and linker may provide significant selective probes, as was mentioned above. For example, if the target is a serine protease between other hydrolases, a good choice for the warhead is certainly a diphenyl phosphonate moiety (TABLE I, entry 2). Additional modifications on a DPP warhead with donating or electron-withdrawing groups may result in more specific probes. This way, Sienczyk and Oleksyszn developed probes with differential specificity between the trypsin and urokinase-type plasminogen (upa) (Sienczyk and Oleksyszn, 2006). Selectivity can be influenced by the incorporation of amino acids into the recognition component of the ABP. For example, phenylalanine and lysine next to diphenyl phosphonate moiety provide to ABP chymotrypsin- or trypsin-like protease selectivity, 43

76 respectively (Pan et al., 2006). The selectivity can be further enhanced by the elongation of the peptide sequence (Mahrus and Craik, 2005). A tool to tune specificity via selective substrate sequences is the positional scanning synthetic combinatorial libraries (PS-SCLs) (Backes et al., 2000). PS-SCLs are produced by isokinetic mixtures of natural amino acids to the invariable positions Pn P2, while the preferred amino acid always occupies P1 for the given single protease or family of interest (e.g., Arg or Lys for the trypsin-like proteases) (Figure 18). This way, selective ABPs for granzyme A and granzyme B were obtained (Mahrus and Craik, 2005). Incorporating unnatural amino acids has also been proven to improve selectivity in many cases. To give more opportunities to optimize recognition sequences, Drag and coworkers used unnatural amino acids to produce hybrid combinatorial substrate libraries (HyCoSuL) (Kasperkiewicz et al., 2014; Poreba et al., 2014, 2017). Selective ABPs for neutrophilic serine proteases were developed by the transformation of certain substrates into selective ABPs with substitution of P1 amino acid by a DPP warhead amino acid surrogate and the addition of a recognition tag (Kasperkiewicz et al. 2014, 2015, and 2017). Figure 18: Sequence determination by PS-SCL and HyCoSuL. All sublibraries have one fixed amino acid at P1, while each sublibrary one more at P2, P3, or P4, respectively. A mixture of amino acids occupies the other positions to produce the sublibrary. The optimum substrate sequence is defined by evaluating activity experiments, measured by the fluorescent 7-amino-4-carbamoyl-methyl coumarin (ACC) realize. Substrate sequence turns in an ABP by replacing ACC with an appropriate reactive group and adding a suitable recognition tag. (Adapted by permission from Chakrabarty et al., 2018). 44

77 Finally, selectivity may be achieved at the detection stage, using antibodies specific for the protease. If there is no specific ABP for a given protease, a general ABP can be used in combination with a specific antibody. This way, Sieber and Cravatt used immobilized antibodies to capture proteases labeled by the FP-Ph (an analogue to biotin-fp general serine hydrolase ABP) (Figure 19A). The detection improved 30x compared to SDS- PAGE analysis (Sieber et al., 2004). More recently, an ELISA-type method called enzyme-linked activity-sorbent assay (ELASA) was developed to overcome the crossreactivity of an ABP targeting MALT1 with cathepsin B (Figure 19B) (Eitelhuber et al., 2015). The ABP/enzyme conjugates are enriched on streptavidin-coated 96-well plates following by target-specific antibody incubation. Another HRP-conjugated secondary antibody amplifies the signal. Figure 19: Increasing selectivity analysis using antibodies. A, Proteases labeled with the same ABP come detectable by different antibodies. B, In an ELASA, proteases/biotinylated ABP conjugates are captured to streptavidincoated plates (one well is represented in Figure), and a primary antibody targets the given protease, while a secondary antibody amplifies the signal. (Adapted by permission from Chakrabarty et al., 2018). Visualization One of the most popular detection tags is biotin due to easy gel-based detection and purification of targeted enzymes. Low permeability is a disadvantage of biotinylated ABPs, in the case of intracellular proteases. Permeability can be altered with the introduction of alkyl moieties between biotin and detection sequence. Another way to overcome the low cell permeability is the tandem labeling of two-steps ABPs. 45

78 Fluorophores are also popular tags, given their compatibility with experiments in lysates, cell culture, and whole animals. The benefits and disadvantages of standard tags are summarised in Table II. TABLE II. Pros and cons of common detection tags. Detection Tag Pros Cons Biotin Easy to handle without special equipment Targets can be purify Labeling of cell-surface peptidases on intact cells without contamination by intracellular peptidases Two step (gel and blot) protocol Low solubility Can not label intracellular peptidases Endogenously biotinylated peptidases noise Fluorescent Real-time scanning and quantitation in gel Labeling of intracellular peptidases Better sensitivity over biotin Special equipment required Poor solubility due to hydrophobic properties Difficult to isolate targets (only if there are antibodies to fluorophore) Expensive starting materials HA-tag (High-affinity antibodies) Minimized noise Isolation of targets and identification by MS Lack of permeability Radioactivetag Unambiguous signal-to-noise ratio Simple gel processing Better sensitivity over biotin Dangerous and difficult to handle radioactive materials Cannot be used to directly isolate targets 46

79 Quenched activity-based probes (qabps) The popularity of fluorophores for detection tags, since the origins of ABPP (Greenbaum et al., 2002; Jessani et al., 2002), is due to their versatility. They can be used in gel-based methods and in vivo imaging experiments. The commercially available and inexpensive dyes as fluorescein- and rhodamine-type dyes are suitable for detection tags in gel-based techniques. Rapid photobleaching is the major disadvantage of these types of dyes, while cyanine- and BODIPY-dyes represent better photostability than fluorescein- and rhodamine-type dyes. The use of fluorophores requires extensive washing steps to reduce the background fluorescence of unreacted ABPs. Thus, for realtime imaging has been developed a new subcategory of ABPs, the quenched activitybased probes (qabps) (Figure 20). qabps contain a quencher bound to a leaving group on the warhead. After the covalent modification of the target protease and the quencher expellation, the qabp/enzyme conjugate emits a fluorescent signal. The first qabps were developed for cysteine proteases and used successfully in real-time in situ and in vivo experiments (Blum et al., 2002 and 2007). Figure 20: A qabp example: structure and mechanism. After the quencher (Q) removal, the fluorophore (F) emits, and the ABP/protease (E) complex becomes detectable and suitable for real-time imaging. P4-P3-P2-P1 represents the linker/recognition sequence. The use of qabps enables fluorescence microscopy studies without the need for longterm probe washout periods or extensive washing after permeabilization of fixed cells, which is often required using non-quenched ABPs. Except for the microscopy detection, the irreversible binding to proteases labeled by the qabp allows the monitoring of fluorescent SDS-PAGE by scanning the gel in a flat-bed laser scanner. 47

80 Phosphonate inhibitors, ABPs and qabps The a-aminoalkylphosphonic acids are structurally analogous to a-amino acids, obtained by isosteric substitution of carboxylic acid by a tetrahedral phosphonic acid functionality (Figure 21A). Many aminoalkylophisphohonic acids and derivatives of natural or synthetic origin exhibit a variety of biological properties and have been used as enzyme inhibitors and potent antibiotics. The absolute configuration of the stereogenic a-carbon attached to phosphorus affects biological activity (Drag et al., 2003). For example, (R)-phospholeucine is a more potent leucine aminopeptidase inhibitor than the S enantiomer, and (S,R)-alafosfalin is a more powerful antibacterial agent than the rest of (S,S), (R,S), and (R,R) diastereoisomers (Figure 21B) Figure 21: a-aminophosphonic acid structure compared to amino acids and examples. A, Structure of a-aminophosphonic acid compared to a-amino acids. B, Structures of (R)-phospholeucine and (S, R)-alafosfalin. Phosphoamino acids are abbreviated H-Xaa P -(OH)2, corresponding to the three-letter amino acid abbreviation nomenclature, where Χaa is the corresponding amino acid residue. The index 2 at the hydroxyl group refers to two functional -OH groups instead of one in regular amino acids. N-protecting group is denoted on the right to the three-letter abbreviation, while protecting groups or esterified moieties on P-OH are indicated after the oxygen of the hydroxyl group. Side-chain protecting groups are displayed in parentheses after the three-letter abbreviation (Figure 22). 48

81 Figure 22: Nomenclature for the abbreviation of a-aminophosphonic acid compared to a-amino acids and example. Synthetic approaches have been developed for the synthesis of symmetrical diester phosphonates (Demmer et al., 2011), mostly inspired by the pioneering Arbuzov and Michaelis-Becker reactions (Bhattacharya and Thyagarajan, 1981; Arbuzov, 1906; Michaelis and Kaehne, 1898; Michaelis and Becker, 1897). In the field of serine protease inhibitors, the most valuable and convenient method to produce phosphonates as amino acid surrogates is a three-component amidoalkylation (Scheme I), first described by Oleksyszyn et al. (1979) (reaction in acetic acid at reflux) and modified by Joossens et al. (2004) (in dichloromethane using copper triflate as a catalyst). Thus, numerous amino acid surrogates may be derived and used for SP inhibitors discovery. As mentioned above, peptidyl diphenyl a-aminoalkylphosphonic esters (in short: diphenyl phosphonates, DPP) are selective and potent mechanism-based serine protease inhibitors (for example, described by Oleksyszyn and Powers, 1989; Boduszek et al., 1994; Oleksyszyn et al., 1994; Bertrand et al., 1996; Belyaev et al., 1999; Nishiyama et al., 2002; Mucha and Kafarski, 2002; Grembecka et al., 2003; Joossens et al., 2004). More recently discovered DPP inhibitors and ABPs are reviewed by Maślanka and Mucha (2019). It must be noted that proteases with similar catalysis modes, like cysteine and threonine proteases, are not inhibited by DPPs. First developed as SP inhibitors by Oleksyszyn and Powers (Oleksyszyn and Powers, 1989), DPPs are less active than fluorophosphates but reactive enough to capture selectively and irreversibly 49

82 the active site Ser 195 hydroxyl group of SP. DPPs surpass the previously discovered potent fluorophosphate inhibitors because they are more stable, no toxic, and more specific. Scheme I: Synthesis of amino phosphonic acid symmetrical esters by threecomponent amidoalkylation. R1 and R2 may be alkyl or aryl, substituted or not, while R3 heteroatom, alkyl, or aryl moiety, substituted or not. First performed in refluxed AcOH, more recently in DCM with a catalytic amount of Cu(OTf)2. DPPs do not react with low-molecular nucleophiles, which explains the stability in biological media and, therefore, the nontoxicity in companion with their specificity for SP. DPPs are very stable in buffer solution and human plasma, while the reactivation of inhibited enzymes is very slow and sometimes exceeds the month (Oleksyszyn and Powers, 1989 and 1991; Oleksyszyn et al., 1994). The proposed mechanism of action (Scheme II) starts with the nucleophilic attack of the active site Ser 195 hydroxyl group to the phosphorus to form a pentacoordinate intermediate, followed by a phenoxy group expulsion, which results in a stable tetravalent phosphorylated derivative. During an aging progress, the second phenoxy group withdrawal results in an enzyme phosphomonoester complex (Oleksyszyn et al., 1994). Scheme II: Mechanism of irreversible inhibition of SP by DPPs. 50

83 Structure-activity relationships The choice of the amino acid DPP surrogate is determined by the S1 preference of SP. For example, trypsin-like proteases prefer Arg or Lys DPP analogues. Moreover, the structure and conformation of DPP that occurs P1 affect the reactivity. Peptidyl DPPs with (R) configuration of a-c of aminoalkyl phosphonate are more effective than those with (S) configuration (Oleksyszyn and Powers, 1991; Walker et al., 2000). (R) Configuration of phosphonates corresponds to (S) of L-amino acids. However, the diastereoisomers produced by the three-component amidoalkylation are rarely separated before examining their activity, and usually, the epimer mixture is used. The length of the peptide sequence seems to affect both the selectivity and the potency of DPPs inhibitors. Penta- and tripeptidyl phosphonates were more potent inhibitors than the monopeptidyl phosphonates in an inhibition study of chymotrypsin (Oleksyszyn and Powers, 1989 and 1991). Brown et al. (2011) demonstrated a clear correlation between potency and peptidyl length by increasing with a tripeptide an S1A protease inhibitor against membrane-type serine protease 1 (MTSP1) and thrombin inhibitor. Modifications on the a-carbon side chain and/or a substitution on the aryl phosphonate leaving group also affect potency and selectivity (depending on the SP). Modifications on the aryl leaving group may modulate the phosphorus electrophilic properties by withdrawing/donating effects (Boduszek et al., 1994b). Other modifications, such as p- SMe substitution, improve contacts within the active site upon the initial binding (Sieńczyk and Oleksyszyn, 2006). Boc N-terminus protected derivatives were more potent inhibitors in a study examining the potency of inhibitors to human and bovine thrombin, human factor XIIa, human plasma kallikrein, and bovine trypsin than Z-protected (Oleksyszyn et al., 1994). In the same study, the deprotection of the N-terminus affected the potency of inhibitors significantly. In some cases, potency and selectivity increased, to others minimized. Taking together the kind of peptidyl amine protection, even the lack of amine protection may differ the desired selectivity and potency between the SP. Finally, the conversion of DPP inhibitors to ABPs with fluorophores or biotin seems that do not affect the stability and the potency of DPPs in vivo or lysates (Abuelyaman et al., 1994 and 1997; Woodard et al., 1994). 51

84 STATE-OF-THE-ART KLKs constitute the largest family of serine proteases encompassing 15 highly conserved genes and encoded proteins (KLK1-15). Multiple KLKs are co-expressed in normal tissues and are coordinatively deregulated in various diseases suggesting that they act in proteolytic cascades referred to as the KLK activome. Specific KLKs participate in various (patho)physiological processes, including skin desquamation, semen liquefaction, multiple types of cancer, neurodegenerative, metabolic, autoimmune, and other diseases (Sotiropoulou and Pampalakis, 2012; Sotiropoulou et al., 2009). Further, KLKs participate in inflammatory processes and in the function of the immune system (Sotiropoulou and Pampalakis, 2010). Given their important roles in (patho)physiology, KLKs have been investigated as drugs, e.g., pharmaceutical proteins or virally-mediated KLK expression, or drug targets (Prassas et al., 2015; Sotiropoulou and Pampalakis, 2012). Activity-based probes (ABPs) are small organic molecules used to map various enzymatic activities (serine proteases, oxidases, etc.), an approach known as ABP profiling (Schreiber et al., 2015). They bind to enzymes via a covalent bond formed between an electrophile on the ABP and the active-site nucleophile on the enzyme, such as the catalytic serine for serine proteases (Sanman and Bogyo, 2014). Therefore, only catalytically competent proteases bind to the ABP irreversibly. It should be mentioned that often drugs in development and clinical testing fail. An important reason could be that the drug is designed to target an active enzyme based on its aberrant overexpression in a disease state. Nevertheless, the enzyme may be in an inactive form, e.g., due to inefficient activation or inhibition by endogenous inhibitors. The same problem must be considered for the evaluation of assays based on abundance or expression measurements of protein targets and/or biomarkers. ABPs can find numerous analytical applications in basic biochemical and biomedical research but also in clinical molecular diagnosis and clinical practice, like fluorescenceguided surgery (FGS) (Yim et al., 2018; Mochida et al., 2018; Walker et al., 2017), analysis of enzymatic activities in tissue specimens (Pampalakis et al., 2017; Withana et al., 2016), in vivo imaging (Gaikwad et al., 2018; Edgington-Mitchell et al., 2017; Fernández and Vendrell, 2015), chemical proteomics (Yang and Liu, 2015; Jeffery and Bogyo, 2003), Western-blot-like assays (Edgington-Mitchell et al., 2017; Yang and Liu, 2015), combination with immunoassays, e.g., ELISA (Oikonomopoulou et al., 52

85 2008), and delineation of drug targets (Chen et al., 2018; Gerry and Schreiber, 2018; Arrowsmith et al., 2015). Due to the important role of proteases and proteolytic pathways in normal physiology and disease, ABPs have been mainly developed for proteases such as cathepsins, caspases, metalloproteases, etc. (Sanman and Bogyo, 2014). However, until now, no ABP has been reported to be specific for individual kallikrein-related peptidases (KLKs). The great advantage of using ABPs is that they allow for real-time monitoring of changes (qualitative and quantitive) in enzymatic activities rather than total protein or mrna abundance. ABPs can be used to profile enzyme activities in vivo (Speers et al., 2003; Edgington and Bogyo, 2013). A revolutionized application of ABPs is in oncological surgery for complete surgical tumor dissection due to accurate imaging of the actual tumor margins and localization of remaining tumor microfoci (Cutter et al., 2012). Finally, ABPs can be easily commercialized not only for therapeutic/diagnostic applications but also as research tools, as demonstrated by the prototype ABP developed by Liu et al. (1999) to target serine hydrolases. This ABP has been commercialized by Santa Cruz Biotechnology ( ) as a new research reagent to identify active enzymes that react with organophosphates or active serine hydrolases. Currently, no specific KLK ABPs have been synthesized despite their importance in various pathophysiological conditions. A non-specific organophosphonate probe has been used in an ELISA format to quantify the active KLK6 in cerebrospinal fluid (Oikonomopoulou et al., 2008). In the latter study, a KLK6-specific antibody was used for capturing and an ABP for detection. However, it should be mentioned that a single antibody cannot guarantee the specificity of the assay since the KLK family consists of 15 highly homologous proteins. A new combined click-chemistry ABP approach was designed in which the reactive group was separated from the detection tag in two different molecules. The advantage relies on the fact that the large ABP molecule may have limited active site accessibility, thus reacting very slowly, or may have limited cellular permeability, while the smaller molecules could easily overcome these issues (Gillet et al., 2008). After probing the active enzyme, the conjugation of these molecules was conducted with Cu(I)-based azide-alkyne click chemistry. KLK7 was used to set up the assay, although the probe used was not specific for KLK7 but was a 53

86 general organophosphonofluoridate (Gillet et al., 2008). Finally, ABPs have never been used as therapeutic agents before. Previous attempts to synthesize or identify natural small molecule KLK7 inhibitors have been carried out (Reviewed in Masurier et al., 2018; Sotiropoulou and Pampalakis, 2012). Cyclic depsipeptides isolated from Chondromyces crocatus bacterium can inhibit KLK7 activity but not selectively (Krastel et al., 2013). Other natural KLK7 inhibitors are the isocoumarin derivatives that can also inhibit KLK5 (Teixeira et al., 2011). The 1-acyl-1,2,4-triazole derivatives are synthetic, covalent but reversible, and are not selective inhibitors for KLK7. Although these inhibitors bind covalently to the catalytic Ser, the acylation is reversible and can be hydrolyzed spontaneously after 6 hours (Tan et al., 2013a). 3-carboxylate coumarin derivatives are KLK5, KLK7, KLK14, and matriptase inhibitors. Specifically, KLK5, KLK14, and matriptase are inhibited reversibly, while KLK7 is inhibited irreversibly. These inhibitors can reduce the epidermal overproteolysis in skin biopsy sections from transgenic KLK5 mice (Tan et al., 2015). A quinazolinone derivative has been identified as a reversible inhibitor of KLK7 using virtual screening. Although this appeared to be specific for KLK7 compared to other proteases tested (KLK5, KLK14, matriptase), it has not been tested in vivo or in vitro (Tan et al., 2013b). Other reversible inhibitors of KLK7 include pyrido-imidazodiazepinone derivatives (Arama et al., 2015), 1,3,6-trisubstituted 1,4- diazepan-7-ones (Murafuji et al., 2018a; Murafugi et al., 2018b), and isomannide derivates (Barros et al., 2017; Oliveira et al., 2014; Freitas et al., 2012). Certain brintonamides from the marine cyanobacterium can inhibit KLK7 but also all other proteases tested (chymase, caspase 14, and chymotrypsin) (Al-Awadhi et al., 2018). Other heterocyclic inhibitors have also been described in the patent literature (Linschoten, 2011; Flohr et al., 2010). One of these inhibitors was tested in vivo in transgenic KLK7 mice and improved transepidermal water loss and skin morphology (Linschoten, 2011). Other inhibitors were tested in irritant contact dermatitis and found to suppress the ear inflammatory swelling. In allergic contact dermatitis, they improved skin redness (Flohr et al., 2010). Peptide-based inhibitors have also been described for KLK7 (de Veer et al., 2017; Chen et al., 2016; Jendry and Beck-Sickinger et al., 2016). Finally, mixed alkyl aryl phosphonates have been developed as qabps for serine proteases, but no imaging experiments with probes are published to date (Serim et al., 2015). 54

87 SPECIFIC AIMS OF THE STUDY The main aim of this study is the development and evaluation of inhibitors and ABPs specific and selective for KLKs, especially KLK6 and KLK7, with potential diagnostic and therapeutic applications as theranostic agents. Initially, we designed and synthesized candidate inhibitors and ABPs for KLK6 and KLK7. To achieve specificity and selectivity, diphenyl phosphonate inhibitors and ABPs were synthesized. DPP inhibitors have advantageous features. First, their synthesis is easy and allows comprehensive structural modification and diversification. Accordingly, the reactivity and specificity of these bioactive molecules can be easily tuned by appropriate modifications or substitutions of the side chains and the leaving groups. In addition, the phosphonates target serine proteases selectively and leave other oxygen and sulfur nucleophiles intact. Convenient synthesis, lack of toxicity, and promising pharmacokinetic properties render them very attractive drug candidates. Further, the generated synthetic KLK7-ABP-inhibitor was preclinically validated for its putative therapeutic effect in an established mouse model (Spink5 -/- ) that recapitulates Netherton syndrome, a rare but severe (potentially lethal) skin disease characterized by excessive epidermal desquamation and constitutive inflammation. Additionally, this model is used in part for atopic dermatitis. Specifically, the inhibitor was validated by topical administration onto the skin of Spink5 -/- Klk5 -/- mice, in which it is known that the activity of the KLK7 protease is sustaining pathological inflammation. Another challenge was to develop a diagnostic assay to determine the levels of KLK7 in biological and/or clinical specimens. The expression and activity of KLK7 are aberrant in certain cancers, and the potential use of KLK7 as a biomarker has been proposed, except for the therapeutical opportunities. For example, in melanoma, aberrant KLK7 expression switches to a more malignant phenotype, probably due to altered melanoma invasion by KLK7 (Haddada et al., 2018). The researchers suggested that KLK7 inhibition may be combined with melanoma chemotherapy. Thus, the use of selective ABPs that detect active KLK7 at an early stage of melanoma may provide a new biomarker of melanoma progression. Therefore, developing an ABP-based ELISA for potential routine clinical validation of active KLK7 levels in biological and/or clinical specimens emerged as an additional target of this dissertation. 55

88 Finally, it was considered that the development of a KLK7 qabp might serve more advanced clinical applications such as real-time visualization of KLK7 positive tumors during operations or diagnostic, non-invasive examinations. 56

89 MATERIALS AND METHODS 57

90

91 Materials Chemicals - Reagents All chemical reagents and solvents (except the listed above) were obtained from Sigma- Aldrich or Merck and used without further purification. Silica gel chromatography was performed using glass columns packed with silica gel 60 ( mesh). Analytical thin-layer chromatography was performed on TLC silica gel 60 F254 (Merck) plates, and compounds were visualized under UV light at 254 nm and/or ninhydrin (Kaiser test). Cyanine5 NHS ester abcam QSY TM 21 NHS ester Invitrogen H-L-Val-2-chlorotrityl resin CBL Patras (donation) Fmoc-L-His(Clt)-OH CBL Patras (donation) Fmoc-L-Ile-OH CBL Patras (donation) Fmoc-L-Val-OH CBL Patras (donation) Antibodies The anti-klk7 was obtained from R&D (AF2624) and was a goat polyclonal antibody or was provided by Professor Eleftherios P. Diamandis (Mount Sinai Hospital, Toronto, Canada) and was a rabbit polyclonal antibody. Equipment The nuclear magnetic resonance spectra ( 1 H NMR, 13 C NMR, 31 P NMR, and 19 F-NMR) were recorded on a Bruker AVANCE III 600 Bruker Avance III 600 (600 MHz, 1 H; 151 MHz 13 C; 243 MHz 31 P) spectrometer. Chemical shifts are reported in parts per million (ppm) relative to a tetramethylsilane internal standard. Electrospray ionization mass spectra (ESI-MS) were recorded on an AmaZon SL instrument of Bruker Daltonics or a TSQ 7000 spectrometer (Electrospray Platform LC of Micromass) coupled to a MassLynx NT 2.3 data system. Analytical and semi-preparative RP-HPLC was performed using a RP-column Waters SunFire TM C μm, 4.6x100 mm on a SHIMADZU LC-20 AD instrument. 59

92 Methods Live subject statement All experiments were performed in compliance with the relevant laws and institutional guidelines. Animal experiments were carried out in the approved EL13-BIOexp-04 facilities of the University of Patras and the protocol was approved by the local committee (Veterinary Department of Regional Units of Achaia, Region of Western Greece; Dr. Ariadni Giannouli was the responsible veterinarian for our institution). After informed written consent, skin biopsies were obtained from NS patients and healthy donors in Aghia Sofia Children s Hospital (Athens, Greece). Mice All mice were of the C57BL/6 background. Spink5 -/- mice were kindly provided by Professor Andrew McKenzie (MRC Laboratory of Molecular Biology, Cambridge, UK) (Hewett et al., 2005) Previously, we described the generation and genotyping of Klk5 -/- mice (Furio et al., 2015). All experiments with mice were approved by the stateappointed Committee and the University Ethics Committee and were performed in concert with the EU and National legislation. Mice treatment with inhibitor The genotype of the double knockout Spink5 -/- Klk5 -/- mice was confirmed by PCR (Klk5 -/- : forward 5 -GCAGCTAGAGTTAAGAGCTC-3 and reverse 5 -GGTCAGAA CTGTGTAGGC -3 for wt or 5 -GACCACCTCATCAGAAGCAG-3 for knockout allele; Spink5 -/- : forward 5 -GAGTCTTGAGACAATAGT-3 and reverse 5 -GTAGGA GAGTTCTGTAAG-3 ) in independent duplicate experiments. On P3, 20 μl of 1 mm inhibitor in 45% isopropanol, 6% propylene glycol and 1.2% DMSO were applied on the right flank and allowed to evaporate. Then, 20 μl of solvent control were applied on the left flank and allowed to evaporate. Mice were treated in the same manner daily until P7 when they were photographed to assess the extent of macroscopic desquamation, then, mice were decapitated, and skin tissue was excised for RNA extraction. 60

93 Mice treatment with 12-O-tetradecanoylphorbol 13-acetate Mice were shaved and 24 hours later 100 μl of M TPA in acetone was applied on their right flank. Acetone alone was applied on the left flank as negative control. TPA application was repeated once 24 hours later and mice were sacrificed 24 hours after the second application, skin biopsy was taken, embedded in OCT (optimal cutting temperature) and stored at -80 o C until sectioned with a cryotome. Mouse samples. The generation of Spink5 -/- Klk5 -/- mice has been described previously (Zingkou et al., 2020a). Approximately 10 mg of skin tissue was pulverized under liquid N2 with a pestle and mortar and RIPA lysis buffer was added (25 mm Tris-HCl, ph 7.6, 150 mm NaCl, 1% NP-40, 1% sodium deoxycholate and 0.1% SDS), then, incubated on ice for 30 min, centrifuged at 4000 rcf at 4 C for 10 min and finally supernatants were collected, and protein concentration was determined by Bradford assay. Clinical specimens Biopsies were taken from a healthy volunteer and two patients with Netherton syndrome at Aghia Sofia Children s Hospital (Athens, Greece), embedded in OCT (optimal cutting temperature) and stored at -80 o C until cryosectioned. All human subjects provided written consents. RNA extraction and RT-qPCR Mice tissues were pulverized with a pestle and mortar under liquid N2. RNA was extracted with Nucleospin RNA (Macherey-Nagel). The quality of RNA was checked with agarose gel electrophoresis and the concentration was determined based on the absorbance at 260 nm. Total RNA (1 μg) was reversed-transcribed with the Superscript First Strand Synthesis System (Invitrogen). A total of 20 ng of cdna were used for real-time PCR using SYBR Green (Kapa SYBR FAST One-Step Universal) and primers described previously (Furio et al., 2015). The housekeeping gene Hprt1 was used for loading control. 61

94 Activography Activography was conducted as described (Pampalakis et al., 2017a; Zingkou et al., 2018). Briefly, cryosections of 5 μm were fixed in acetone for 10 min, rehydrated in PBS for 5 min and the endogenous peroxidase was quenched with 3% H2O2 in PBS for 10 min. Then, the sections were blocked in PBS containing 0.3% BSA and 0.1% Triton X-100 for 5 min, washed with PBS and incubated for 2 hours at room temperature with 20 μm ABP in PBS. Finally, sections were washed with PBS and incubated with streptavidin-hrp polymer in PBS (1:500 dilution) for 1 hour at room temperature and developed with metal enhanced DAB substrate (Thermo Fisher) and counterstained with haematoxylin. Western blotting Tissue extracts were resolved on SDS-PAGE and proteins were transferred on PDVF membranes. Membranes were blocked with 5% non-fat dry milk in PBS for 40 min at room temperature, washed twice with PBS and incubated with anti-klk7 antibody (1:2,000 in PBS containing 1% non-fat dry milk and 0.05% Tween-20) for 16 hours at 4 o C. The membranes were washed three times in PBS containing 0.05% Tween-20 and incubated for 1 hour with secondary anti-rabbit antibody (1:2,000 in PBS containing 1% non-fat dry milk and 0.05% Tween-20). Finally, the membranes were washed four times with PBS containing 0.05% Tween-20 and specific bands were identified with ECL. Western blot with ABP Enzymes were reacted with the ABP for 2 hours, resolved on SDS-PAGE, then the proteins were transferred on PVDF membranes. Membranes were blocked with 3% BSA in PBS for 40 min at room temperature, washed twice with PBS and incubated for 1 hour at room temperature with streptavidin-hrp polymer (1:2,000) and subsequently washed four times with PBS containing 0.05% Tween-20. Specific bands were identified with ECL. 62

95 Western blots with qabp Recombinant KLK7 or mouse skin extracts (25 μg total protein), expressing Klk7, were resolved in a 12% SDS-PAGE and transferred onto a PVDF membrane. The membrane was blocked with 5% non-fat dry milk in PBS for 1 hour at room temperature, then, incubated for 16 hours at 4 o C with the primary antibody abcam (ab 96710) at 1:2500 dilution for detection of the recombinant KLK7 or the antibody from R&D (AF2624), at 1:200 dilution, for detection of Klk7 in mouse skin extracts. Then, secondary antibodies were added, i.e., an anti-rabbit (Amersharm Biosciences, NA934) 1:2000 for KLK7 or an anti-goat (R&D, HAF017) 1:1000 for mouse Klk7 for 1 hour at room temperature. Finally, the immunospecific bands were visualized with enhanced chemiluminescence (Thermo scientific). The R&D antibody could detect both the human KLK7 and the mouse Klk7 orthologue proteins in contrast An abcam antibody that only detected the human KLK7. Gel zymography The compounds were reacted with the enzymes at room temperature for 2 hours, then mixed with zymogram loading buffer without mercaptoethanol, incubated at 37 o C for 15 min and resolved on 12% SDS-PAGE containing 0.1% casein or gelatin substrates. Gels were washed twice with 50 mm Tris-HCl ph 7.5, 5 mm CaCl2, 2.5% Triton X- 100 for 15 min, then 15 min with 50 mm Tris-HCl, ph 7.5, 5 mm CaCl2, 0.1% Triton X-100, and finally incubated in the latter buffer for 24 hours and stained with Coomassie G-250. Proteolytic bands appear white against a blue background. Enzyme-linked immunosorbent assay (ELISA) for active KLK7 Each well of a 96-well plate was incubated for 16 hours at 4 o C with 500 ng of anti- KLK7 antibody in 100 μl of Phosphate Buffered Saline (PBS) as coating buffer (ph 7.4) Several dilutions of KLK7 and Biotin-X-X-Phe-Phe P -(OPh)2 (6.3 μm) were allowed to react for 16 hours at room temperature. The plate was washed two times with PBS (200 μl/well) and the blocking of remaining protein-binding sites in the coated wells was achieved by adding 200 μl/well blocking buffer [1% Bovine Serum Albumin (BSA) in PBS] for 1 hour at room temperature. Then, the plate was washed four times with PBS (200 μl/well) followed by the addition of the biotin-x-x-phe-phe P - (OPh)2/KLK7 reaction mixture incubated for 16 hours at room temperature. The plate 63

96 was washed 2 times with PBS and 100 μl of freshly prepared solution of streptavidin peroxidase polymer (1 ng/μl) were added to each well and incubated for 1 hour at room temperature followed by washing with PBS+0.005% Tween-20 (200 μl/well, 4 times). The plate was washed two times with 200 μl/well of 100 mm citrate buffer (ph 6.0) and color development was achieved in the dark with 100 μl/well solution of 2 mg/ml ortho-phenylenediamine and 1μl/ml H2O2 30% in citrate buffer 100 mm for 4 min. 100 μl/well stop solution (2M H2SO4) was added and the absorbance at 492 nm was measured with the Infinite F50 Tecan instrument. Bioinformatic tools Alignment was carried out with Clustal Omega ( clustalo/). IC50 determination KLK7 inhibition study was carried out in assay buffer (100 mm Tris-HCl, ph 7.8, 100 mm NaCl, 10 mm CaCl2, 0.005% Triton X-100). KLK7 (6 nm) was incubated with the inhibitor (50 nm to 10 μm) for 16 hours at room temperature in the assay buffer. Then, the BODIPY-FL casein substrate (Molecular Probes) was added at 30 μg/ml and fluorescence was measured (λexc=485, λem=530). After 3 hours the fluorescence was measured again. Data were inserted into the available online program Very Simple IC50 Tool ( to fit and calculate the IC50. Expression and purification of recombinant KLK7 The cdna encoding the mature (active) KLK7 was amplified by RT-PCR from total RNA extracted from normal keratinocytes using the following primers: 5 - GGCACTCGAGAAAAGAA TTATTGATGGCGCCCA-3 (forward) and 5 - GGCAGAATTCGCGTTAGCGATG CTTTTTCA-3 (reverse). Subsequently, the PCR-amplified fragment was cloned into the ppic9 vector between the XhoI and EcoRI sites (underlined). 10 μg of the ppic9/klk7 construct were linearized with SalI and used to transform the Pichia pastoris strain KM71 spheroplasts, prepared as described (Sotiropoulou et al., 2003). Recombinant yeast colonies were selected based on their growth in the absence of histidine. The colonies were grown in larger liquid cultures (500 ml) and the production of KLK7 was induced with 1% CH3OH. Then, the 64

97 supernatants containing the secreted KLK7 were collected by centrifugation, dialyzed against 10 mm sodium acetate buffer ph 5.3, and purified by strong cation exchange chromatography (Bio-Scale Mini Macro-prep High S, BioRad) in an FPLC system (NGC Quest 10, BioRad). Labelling of chymotryptic proteases with the qabp. A stock solution of 100 mm qabp in DMSO was prepared. Then, chymotrypsin or recombinant KLK7 were allowed to react with 1 mm qabp in a 20 μl in PBS for 1 h at 37 o C. Each reaction was stopped by addition of Laemmli loading buffer. Samples were then boiled, resolved on a 12% SDS-PAGE and scanned for fluorescence by a Phosphorimager (FUJIFILM fluorescent image analyzer, model FLA-3000). Detection of active Klk7 in mouse skin extracts. 80 μg of total proteins extracted from murine total skin were pretreated with 100μM qabp-klk7 for 16 hours at room temperature, then fluorescence was measured by a Perkin-Elmer fluorimeter at excitation/emission wavelengths of 633/670 nm. Autofluorescence intensity of qabp was almost zero indicating that the addition of quencher successfully blocked the fluorescence emitted by the Cy5. 65

98

99 RESULTS 67

100

101 CHAPTER 1: DESIGN, SYNTHESIS, AND VALIDATION OF NOVEL KLK7- ABP-INHIBITORS Design of KLK7 inhibitors and ABPs Although there have been several attempts to generate KLK7 inhibitors (Masurier et al., 2018; Sotiropoulou et al., 2012; Murafuji et al., 2017; Teixeira et al., 2016; Oliveira et al., 2014; Tan et al., 2013b; Tan et al., 2015) present, there are no available specific KLK7 inhibitors. The main drawback of all the above studies was either the lack of specificity or that none of these compounds has ever been pharmacologically evaluated in preclinical models. Only recently, a strong peptide-based and selective KLK7 inhibitor was developed based on the modified peptide substrate H2N-Lys-His-Leu- Tyr-pNA (de Veer et al., 2017). Thus, the goal of this dissertation became the development of an activity-based probe (ABP) that (a) will selectively bind to active KLK7 and (b) will inhibit its enzymatic activity in a manner that it can ideally be used for both diagnostic and therapeutic approaches as a theranostic agent. As previously discussed, the ABPs for serine protease may be peptidyl-based or otherwise. Our efforts focus on designing peptidyl-based ABPs. Since there were not ABPs for KLK7 available, two significant issues we have taken into account. First, all the peptidyl-based known ABPs for serine proteases are aminoalkyl phosphonates derivatives. It seems that the motif for all these ABPs requires the replacement of the C-carboxyl end of peptides with diaryl phosphonates, as has been discussed in detail in the Introduction. Moreover, diphenyl phosphonates are stable in aqueous environments and bind irreversibly to the serine protease hydroxyl group (Serim et al., 2013; Pan et al., 2006; Powers et al., 2002 and others). On the other hand, the peptide sequence specific for KLK7 had to be defined. For the latter case, we adopted a new strategy. Specifically, for the first time, we have mined/exploited MEROPS (Rawlings et al., 2018) ( database on protease substrate specificity to identify potentially specific substrates for KLK7. The data in the MEROPS database are based on protease mapped cleavage sites in various proteins, peptides, and synthetic substrates (Rawling et al., 2018). The MEROPS search for KLK7 substrate specificity revealed that KLK7 could cleave after the Phe-Phe motif (Figure 23). 69

102 Figure 23: KLK7 and related peptidases substrate specificity matrix. Representative results of KLK7 and related proteins (KLK6, thrombin, pancreatic elastase, chymotrypsin) substrate specificity from MEROPS. With red box, the Phe- Phe P2-P1 motif specific for KLK7 is highlighted. Data retrieved in Reciprocal analysis showed that the ability of KLK7 to cleave after Phe-Phe is rather specific. This information was used to rationally design an inhibitor and a theranostic ABP (Figure 24) that has an α-aminomethyl phosphonate reactive group (warhead) and carries a modified Phe-Phe as a recognition sequence. The N-terminus is either free, protected (inhibitor only), or attached to a biotin derivative (true ABP). Initially, we synthesized and evaluated the Boc-protected peptidyl phosphonate Boc- Phe-Phe P -(OPh)2. After the evaluation of the inhibitor, the N-terminus was deprotected to investigate the necessity of amino protection. 70

103 Figure 24: Structure of the designed KLK7 inhibitor and ABP. Biotin derivative is the biotinamidohexanoyl-6-aminohexanoyl group, which offers the detection tag biotin and a long enough spacer to separate the label from the warhead and the active site. Finally, to produce the ABP, the inhibitor was tagged with a biotin moiety using biotin- X-X-NHS (biotinamidohexanoyl-6-aminohexanoic acid N-hydroxysuccinimide ester, B3295 Sigma-Aldrich) at the amino terminus (detection tag) to facilitate detection. Moreover, for initial optimization, the carbon length at P1-like position was varied in analogues Boc-Phe-Phg P -(OPh)2 and Boc-Phe-Hph P -(OPh)2 using phenylglycine (Phg) and homophenylalanine (Hph) instead of Phe, respectively (Figure 25). Figure 25: Designed inhibitors with various carbon side chain lengths at P1. Phenylglycine (Phg) and homophenylalanine (Hph) analogues were designed to examine the influence of side-chain length on activity and selectivity. 71

104 Next, the inhibitor Boc-Phe-Phe P -(OCH2CF3)2 was designed by replacing the aryl with 2,2,2-trifluoroethyl groups (Figure 26) and taking into account that replacement of the aryl ester rings with 2,2,2-trifluoroethyl esters enhance the solubility in aqueous media (Skoreński et al., 2013). The DPPs have relatively poor solubility in aqueous media that may limit their efficiency in biological systems and in vivo. Moreover, the fluorine atoms enhance the electrophilicity of the phosphorus atom (in comparison to simple ethyl esters) enough to be more susceptible to nucleophilic attack by the catalytic serine residue of the serine protease. Also, the 2,2,2-trifluoroethyl group should represent a good leaving group to assist in the formation of the protease-inhibitor adduct. Therefore, the 2,2,2-trifluoroethyl-phosphonates may exhibit faster reaction rates than the DPPs. Figure 26: The chemical structure of Boc-Phe-Phe P -(OCH2CF3)2. Synthesis of KLK7 inhibitors and ABPs Synthesis of Boc-Phe-Phe P -(OPh)2 and Biotin-X-X-Phe-Phe P -(OPh)2 In general, diaryl esters of 1-aminoalkanephosphonic acids (4) (Scheme III) can be synthesized by the reaction of triaryl phosphites with the appropriate aldehydes and benzyl carbamates. This three-component amidoalkylation that resembles the Kabachnik-Fields reaction was described by Oleksyszyn et al. (1979), and it is known as the Oleksyszyn reaction. The diphenyl phosphonate amino acids are produced as racemic mixtures due to a-c stereogenicity (Oleksyszyn et al., 1994; Bertrand et al., 1996; Jackson et al., 1998; Wang et al., 1992; Hamilton et al., 1993; Oleksyszyn et al., 1979). The reaction takes place in glacial acetic acid, and the reaction mixture is heated at 80 o C. Trialkyl phosphites do not react, under these conditions, to give dialkyl esters. 72

105 A slight modification described by Joossens et al. (2004) resulted in higher yields by substituting acetic acid with dichloromethane as a solvent and using copper triflate as a catalyst at room temperature. In this dissertation, both the Oleksyszyn and Joossens procedures were employed to synthesize the desired diphenyl phosphonates 4 (DPP). Scheme III. General synthesis of diaryl esters of 1-aminoalkanephosphonic acids. R is alkyl or aryl group, substituted or not. The Ar (aryl) group may be substituted or not. At the outset, the inhibitor Boc-Phe-Phe P -(OPh)2 was synthesized (Scheme IV). For this, the bezyloxycarbonyl N-protected phenylalanine-like DPP 7 (Z-Phe P -(OPh)2) was produced according to the literature by α-amidoalkylation reaction of triphenyl phosphate 5 with benzyl carbamate 1 and phenylacetaldehyde 6 (Oleksyszyn et al., 1979) but only in 28% yield. In dichloromethane and copper triflate as a catalyst, a higher yield (56%) was achieved at room temperature. Then, the DPP 7 was deprotected with 1,4-cyclohexadiene and 10% palladium on carbon catalyst in ethanol (yield 17%) (Felix et al., 1978). However, better yield (97%) and purity were obtained when we used triethylsilane (TES) and 10% palladium on carbon in MeOH or MeOH/CHCl3 (9:1) as a solvent (Mandal and McMurray, 2007). The resulting N-deprotected phosphonate H2N-Phe P -(OPh)2 (8) was crystallized from methanol/diethyl ether or purified by column chromatography and coupled with Boc-Phe-OH in dichloromethane using 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium tetra fluoroborate (TBTU) and 1-hydroxybenzotriazole (HOBt) as a coupling reagent in the presence of diisopropylethyl amine (DIPEA). The amine 8, as the mother compound 7, is a racemic mixture. TBTU was chosen because it is very effective, and couplings normally proceed with little or no racemization. Moreover, addition of 1-hydroxybenzotriazole prevents racemization completely (Knorr et al., 1989). The desired Boc-protected phosphonic dipeptide Boc-Phe-Phe P -(OPh)2 (9) (yield 50%) was purified by column 73

106 chromatography and characterized with 1 H, 13 C, 31 P NMR and ESI-MS before use in bioassays. A small amount of 9 was deprotected in 50% trifluoroacetic acid in dichloromethane to yield 10 that was biotinylated with biotin-x-x-nhs and HOBt as an additive (Baumeister et al., 2005) in DMSO generating biotin-x-x-phe-phe P -(OPh)2 (11) (yield 52%). Scheme IV: Inhibitor and ABP synthesis with the motif -Phe-Phe P -(OPh)2. 74

107 Synthesis of Boc-Phe-Phg P -(OPh)2 and biotin-x-x-phe-phg P -(OPh)2 Similarly, starting with benzaldehyde 12 instead of phenylacetaldehyde, Boc-Phe-Phg P - (OPh)2 (15) and biotin-x-x- Phe-Phg P -(OPh)2 (17) were synthesized (Scheme V). Scheme V: Inhibitor and ABP synthesis with the motif -Phe-Phg P -(OPh)2. 75

108 Synthesis of Boc-Phe-Hph P -(OPh)2 For synthesis of Boc-Phe-Hph P -(OPh)2 (Scheme VI), cinnamaldehyde 18 was used for the α-amidoalkylation. Catalytic transfer hydrogenation of the DPP homophenylalanine analogue 19 with TES and Pd-C led to the benzyloxycarbonyl deprotection and, also, to the reduction of the double bond (Mandal and McMurray, 2007). Scheme VI: Synthesis of inhibitor Boc-Phe-Hph P -(OPh)2. Synthesis of Boc-Phe-Phe P -(OCH2CF3)2 As mentioned, the three-component amidoalkylation does not occur when we use alkyl phosphites. However, it should be noted that in the case of bis(2,2,2-trifluoroethyl) phosphites this may not be entirely true since Sorenski et al. (Sorenski et al., 2013) reported the synthesis of peptidyl derivatives of bis(2,2,2-trifluoroethyl) esters of α- aminophosphonic acids starting from tris(2,2,2-trifluoroethyl)posphite 23, prepared from PCl3 and trifluoroethanol (TFE), but in low yield (18% for the Z-Phe P - (OCH2CF3)2, 25) (Scheme VII). 76

109 Scheme VII: Synthesis of inhibitor Boc-Phe-Phe P -(OCH2CF3)2. The synthesis started from previously synthesized 7 in order to prepare 25. Other cited methods for the preparation of 25 are indicated by grey. Another method with a slightly higher yield (31%) was suggested, starting from bis(2,2,2-trifluoroethyl) ester of phosphonic acid 24, also prepared from PCl3 and TFE. The yields of both methods were not satisfactory. Thus, the desired Z-Phe P -(OCH2CF3)2 (25) was obtained via transesterification from Z-Phe P -(OPh)2 (7). Two methods to achieving transesterification were investigated. First, the classical approach using TFE and metallic Na performed and, on the other hand, using TFE, KF, and 18-crown-6 ether as a catalyst. Both of them give us good yields (63% and 75%, respectively), in contrast to reports (Sorenski et al., 2013). Deprotection of 25 occurred with TES, and 10% Pd-C in MeOH/CH3Cl (Mandal and McMurray, 2007), and the 77

110 resulting N-deprotected phosphonate H2N-Phe P -(OCH2CF3)2 (26) was coupled with Boc-Phe-OH in DCM using TBTU/HOBt as coupling reagent in the presence of DIPEA. Boc-protected phosphonic dipeptide Boc-Phe-Phe P -(OCH2CF3)2 (27) was purified by column chromatography, and its structure was confirmed by NMR and MS. 78

111 Evaluation of KLK7 inhibitors and ABPs Inhibition and specificity of inhibitors Boc-Phe-Phe P -(OPh)2 (9), H2N-Phe-Phe P - (OPh)2 (10) and activity-based probe biotin-x-x-phe-phe P -(OPh)2 (11) After the synthesis, it was examined whether the designed inhibitor Boc-Phe-Phe P - (OPh)2 (9) is active or not against KLK7. Gel zymography confirmed our prediction that the diphenyl phosphonate with motif -Phe-Phe- is a KLK7 inhibitor (Figure 27). Specificity was tested with gel zymography against trypsin, elastase (ELA), KLK6, and KLK13. The results indicated that Boc-Phe-Phe P -(OPh)2 is active only against KLK7. Figure 27: Inhibition of KLK7 by inhibitor 9 and specificity against other serine proteases. Gel zymography (casein) demonstrating that Boc-Phe-Phe P -(OPh)2 (9) can only inhibit the activity of KLK7. Protein sizes are given in kda. Furthermore, the specificity was also checked with an enzyme kinetic assay that showed that inhibitor 9 did not inhibit the activity of trypsin and KLK6 (Table III) as determined by the hydrolysis of the trypsin-like specific fluorescent substrate Z-Phe- Arg-MCA. The inhibitor was preincubated with the enzymes for 2 hours. 79

112 TABLE III. Lack of inhibition of trypsin and KLK6 by Boc-Phe-Phe P -(OPh)2 (9). Data were expressed as the change in fluorescence signal over 3 min. Aprotinin was used as a positive control. Sample ΔF/Δt Trypsin Trypsin + Boc-Phe-Phe P -(OPh)2 (2 hours) Trypsin + aprotinin 0 KLK KLK6 + Boc-Phe-Phe P -(OPh)2 (2 hours) KLK6 + aprotinin Figure 28: Inhibition of KLK7 by inhibitors 9 and 10. Casein gel zymography shows that H2N-Phe-Phe P -(OPh)2 (10) inhibits KLK7 activity to the same extent as the Boc-Phe-Phe P -(OPh)2 (9). The concentration of inhibitors was 200 μm. No inhibitor was added in lane 1. Protein sizes are given in kda. To determine whether the N-terminus protection is essential for inhibition, the Bocprotective group was removed (as shown in Scheme IV), and the free amino-terminated 80

113 inhibitor H2N-Phe-Phe P -(OPh)2 (10) was tested against KLK7 for inhibition with gel zymography. As shown in Figure 28, compound 10 inhibited KLK7 activity approximately to the same extent as the Boc-Phe-Phe P -(OPh)2 (9). Similarly, the activity-based probe biotin-x-x-phe-phe P -(OPh)2 (11) only detected the active KLK7 and not the trypsin or the KLK6 in Western-type blotting (Figure 29). Figure 29: Detection of active KLK7 with ABP biotin-x-x-phe-phe P -(OPh)2 (11) in the Western-like blotting assay. A, Detection of KLK7. B, The ABP does not react with KLK6 and trypsin. 81

114 Biochemical evaluation of the Boc-Phe-Phg P -(OPh)2 (15), Boc-Phe-Hph P -(OPh)2 (21), and activity-based probe biotin-x-x-phe-phg P -(OPh)2 (17) For optimization, we examined the influence of side-chain length at P1-like position. We synthesized the analogues Boc-Phe-Phg P -(OPh)2 (15, Scheme V) and Boc-Phe- Hph P -(OPh)2 (21, Scheme VI). The two analogues have Phenylglycine (Phg) and homophenylanine (Hph) instead of Phenylalanine at P1, respectively. The analogues 15 and 21 were tested with gelatin zymography for specific inhibition of KLK7. However, as shown in Figure 30, no inhibition of KLK7 activity of KLK7 was observed. Figure 30. KLK7 inhibition by inhibitor 9 compared to 15 and 21. Casein gel zymography demonstrating efficient inhibition of KLK7 proteolytic activity by the Boc-Phe-Phe P -(OPh)2 (9) inhibitor. Boc-Phe-Phg P -(OPh)2 (15), and Boc-Phe- Hph P -(OPh)2 (21) could not inhibit KLK7. In each lane 65 ng of active KLK7 were loaded. Finally, evaluation of the ABP biotin-x-x-phe-phg P -(OPh)2 (17) showed that 17 can also detect KLK7 but with significantly reduced signal relative to biotin-x-x-phe-phe P - (OPh)2 (11) (Figure 31). 82

115 KLK7 65 ng (17) 50 μm (11) 50 μm No labelling kda kda (kdakda ( N Figure 31: Comparison of detection efficiency of the active rklk7 with the ABPs biotin-x-x-phe-phg P -(OPh)2 (17) and biotin-x-x-phe-phe P -(OPh)2 (11) by Western blotting. The biotin-x-x-phe-phe P -(OPh)2 (11) shows a significantly enhanced signal in Western blot-like assay compared to biotin-x-x-phe-phg P -(OPh)2 (17) (upper). The membrane was stripped and stained with anti-klk7 antibody (AF2624, R&D) as a loading control (lower). In all experiments, 65 ng of KLK7 were used. Protein sizes are shown in kda. IC50 determination For the IC50 determination, KLK7 was incubated with the inhibitor in various concentrations (ranging from 50 nm to 10 μm) for 16 hours at room temperature in the assay buffer. Then, the BODIPY-FL casein substrate (Molecular Probes) was added and fluorescence was measured (λexc=485 nm, λem=530 nm). After 3 hours, the fluorescence was measured again. Data were inserted into the available online program Very Simple IC50 Tool ( for fitting and calculation of the IC50. The IC50 for Boc-Phe-Phe P -(OPh)2 was calculated to be 1.91 μm, a very satisfactory value, using BODIPY-fluorescently quenched casein as a substrate. Analysis of clinical specimens with activography ABPs have been used to map various enzymatic activities (example given in Sanman and Bogyo, 2014; Yang and Liu, 2015; Kryziak et al., 2012; Stubbs, 2014). However, 83

116 they have not been adopted in routine clinico-chemical analysis. In our laboratory, a new technique called Activography was developed as a diagnostic histochemical method (Pampalakis et al., 2017). With Activography, the active enzymes are detected in tissue sections and the spatial distribution is depicted. A major advantage is that the use of sophisticated instrumentation is not required. Instead, it works with routinely used chromogenic substrates to detect the precise location of active enzymes. Thus, it can be easily adopted by clinical laboratories. The technique has high selectivity and specificity in contrast to in situ zymography. In this case, the ABP 11, has high specificity for KLK7. Thus it may enable the development of a specific activography for clinical applications. The method is analytically described in chapter Materials and Methods. Figure 32: Tissue localization of active KLK7 by activography using the synthesized KLK7 ABP 11. As expected, normal healthy skin was stained only at the superficial stratum corneum. In contrast, samples from NS patients were stained at the regions of stratum corneum rupture (red asterisks. Patient 1) or all over the stratum corneum when this was destroyed (Patient 2). Further staining was evident at the interface of stratum corneum with stratum granulosum (separated by a green dashed line). Red dashed line indicates the epidermal-dermal junction. Due to large acanthosis (thickening of living epidermal layer) the epidermal-dermal junction is not shown in NS samples. 84

117 Activography was conducted on cryosections from skin biopsies obtained from a healthy human donor and two Netherton syndrome patients with ABP 11. As shown in Figure 32, active KLK7 is detectable only at the stratum corneum of healthy epidermis, however, in the NS epidermis, it is highly up-regulated at positions of stratum corneum rupture and at the junction of stratum granulosum (last epidermal living layer) and stratum corneum. Activography was applied to investigate the expression of active Klk7 in mouse skin induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), a classical chemical irritant and tumour promoter. These findings suggest that TPA highly induces the expression of the Klk7 protein. Details are given in a followed subchapter (Figure 42B). Development of a specific ELISA for the quantified detection of active KLK7 Based on the procedure described in the Methods section, an ELISA was developed to determine the levels of active KLK7 in biological or clinical specimens with the new ABP biotin-x-x-phe-phe P -(OPh)2. For this, a rabbit polyclonal anti-klk7 antibody was used as a capturing antibody to capture the KLK7-ABP adduct. The reaction was developed with streptavidin-hrp (HPR, horseradish peroxidase) polymer assisted oxidation of ortho-phenylenediamine by H2O2 (Figure 33). Briefly, biotin-x-x-phe-phe P -(OPh)2/KLK7 incubated reaction mixtures in several concentrations of the KLK7 were added to a 96-well plate coated with anti-klk7 and left for incubation for 16 hours at room temperature. Then, streptavidin peroxidase polymer was added in each well and incubated for 1 hour at room temperature. Colour development was achieved in the dark with OPD and H2O2 30%. The reaction was terminated with 2 M H2SO4, and the absorbance (optical density at 492 nm) was measured immediately. The linear regression of absorbance vs. active KLK7 concentration is shown in Figure 34. It is easily observed that the ABP 11 can be used to design ELISA-type assays that will facilitate the detection of active KLK7 quantitatively in clinical specimens, as the R 2 has a very satisfactory value. Other ELISA formats to improve the detection limit could incorporate other detection systems, e.g., fluorescence such as time-resolved fluorescence. Alternatively, the KLK7-ABP could be immobilized on the ELISA plate, and the antibody could be used for detection. 85

118 Figure 33: Schematic design of the ELISA developed for the detection of active KLK7. An anti-klk7 rabbit polyclonal was used as the capturing antibody and the ABP biotin- X-X-Phe-Phe P -(OPh)2 specific for active KLK7 for detection. Figure 34: Representative analysis of active KLK7 with ELISA. Quantification of active KLK7 protease using the ELISA described in Figure 33, shows linear correlation of KLK7 concentration with the determined activity. 86

119 Evaluation of inhibitor 9 and ABP 11 in vivo on a preclinical mouse model of Netherton syndrome Netherton syndrome patients exhibit increased epidermal expression of KLK5 and KLK7. Deletion of Klk5 gene on Spink5-null background (a mouse model of NS) rescues neonatal lethality (Furio et al., 2015). However, although the Klk5 -/- Spink5 -/- mice are normal at birth and up to P3, they develop severe scaling and inflammation and succumb on P7. It was reported that the triple knockout Klk7 -/- Klk5 -/- Spink5 -/- mice completely rescues the NS symptoms and the mice live for at least 6 weaks (Kasparek et al., 2017). Further, in the Tg-KLK5 mouse that displays NS symptoms, increased Klk7 proteolytic activities have been found (Furio et al., 2014). Collectively, the mouse models (Tg-KLK7, Tg-KLK5, Klk5 -/- Spink5 -/-, Klk7 -/- Klk5 -/- Spink5 -/- ) used provide proof-of-principle for the development of KLK5/KLK7 inhibitors for the treatment of NS and other inflammatory diseases such as atopic dermatitis. Figure 35: Sequence alignment of human KLK7 and mouse Klk7 sequences. Sequence alignment of human KLK7 and mouse Klk7 sequences reveals the high identity and positivity, especially in the crucial residues of the active site and oxyanion hole. 87

120 To test the inhibitor Boc-Phe-Phe P -(OPh)2 and the ABP biotin-x-x-phe-phe P -(OPh)2 in vivo on mouse model of NS, first we examined they would react with the mouse Klk7 as well KLK7. As shown in Figure 35 human KLK7 and mouse Klk7 show 76% identity and 86% positivity, and especially, the residues that determine the substrate specificity are highly conserved. Therefore, it is expected that both the inhibitor and ABP would react with the mouse Klk7 as well. To verify that biotin-x-x-phe-phe P -(OPh)2 can indeed bind to mouse Klk7, immunodepletion experiments with skin extracts from Spink5 -/- mice were conducted. Briefly, Spink5 -/- extracts were incubated with an anti-klk7 specific antibody and immunodepleted by binding onto protein G beads and precipitation by centrifugation. The immunodepleted extracts were reacted with 50 μm biotin-x-x-phe-phe P -(OPh)2 and analyzed with Western blotting assay in parallel with no immunodepleted extracts. As shown in Figure 36, pre-incubation of extracts with KLK7 antibody significantly suppressed the biotin-x-x-phe-phe P -(OPh)2 (11) signal, indicating that the ABP 11 indeed binds to the mouse Klk7. Figure 36: Immunodepletion experiment shows that the KLK7 ABP 11 can bind to mouse Klk7 protein. Skin extracts from Spink5 -/- were subjected to immunoprecipitation with anti-klk7 antibody to remove the KLK7 protein and then reacted with ABP 11. A control sample was not subjected to immunoprecipitation. As shown, the KLK7-specific band is observed in the non-immunoprecipitated sample but is almost absent after immunoprecipitation, indicating that the ABP 11 can bind to mouse Klk7 protein. 88

121 Moreover, the binding to mouse Klk7 in skin extracts from Spink5 -/- Klk5 -/- mice obtained on P3 was tested. On P3, the Spink5 -/- Klk5 -/- mice develop symptoms of desquamation and inflammation, associated with increased epidermal Klk7 expression and chymotrypsin activity (Zingkou et al., 2020), and about 70% of them succumb 7-8 days after birth. Extracts were incubated with 50 μm biotin-x-x-phe-phe P -(OPh)2 and analyzed with Western blot. As shown in Figure 37A, Klk7 is highly expressed in Spink5 -/- Klk5 -/- skin as expected. No other bands were detected, indicating that biotin- X-X-Phe-Phe P -(OPh)2 (11) successfully detects active Klk7 in this mouse model without binding to other endogenous proteins (Figure 37B). Figure 37. Detection of Klk7 in Spink5 -/- Klk5 -/- mouse skin extracts by ABP 11. A, Detection of Klk7 in Spink5 -/- Klk5 -/- mouse skin extracts by Western blotting using an anti-klk7 specific antibody (AF2624, R&D). B, The biotin-x-x-phe-phe P -(OPh)2 (11) detects only the active form of the Klk7 protease in the same. The nonspecific band of ~75 kda detected in the absence of ABP is likely due to endogenous biotinylated proteins. The sizes of proteins are given in kda. Next, we tested the cytotoxicity and in vivo irritation of inhibitor 9 and ABP 11. For evaluation of cytotoxicity IMR-90 human fibroblasts were cultured in RMPI supplemented with 10% FBS. Twenty-four hours before the assay, the cells were split and transferred in a 96-well plate to achieve 50% confluency. After 24 hours, the medium was replaced, then, compounds 9 and 11 were added at the indicated concentrations and incubated for 24 hours. Solvent-treated cells were used as control. Finally, cells were washed with PBS, and cytotoxicity was assessed with crystal violet. 89

122 As shown in Figure 38, inhibitor Boc-Phe-Phe P -(OPh)2 (9) and ABP biotin-x-x-phe- Phe P -(OPh)2 (11) showed no cytotoxicity at concentrations up to 20 μm, a concentration up to 10 times higher than the IC50. Figure 38: Cytotoxicity tested in normal human fibroblasts treated with inhibitor 9 and ABP 11. Inhibitor Boc-Phe-Phe P -(OPh)2 (9) and ABP biotin-x-x-phe-phe P - (OPh)2 (11) do not show cytotoxicity in fibroblasts. For in vivo irritation testing, the inhibitor Boc-Phe-Phe P -(OPh)2 (9) and ABP biotin-x- X-Phe-Phe P -(OPh)2 (11) were applied at concertation of 1 mm on the skin of wt or Klk5 -/- mice. The assay was conducted with the standard protocol for testing chemicals ( with a slight modification. Specifically, the substances were not removed after 4 h application. The rationale for testing the compounds on Klk5 -/- background is that it requires a combination of KLK5 and KLK7 inhibitors for the successful treatment of NS. Scoring was based on the following criteria: 90 Erythema and Eschar Oedema Formation Score Formation No erythema No oedema 0 Very slight erythema (barely Very slight oedema (barely 1 perceptible) perceptible) Well defined erythema Slight oedema (edges of the area 2 well defined by definite raising) Moderate to severe erythema Moderate oedema (raised 3 approximately 1 mm) Severe erythema (beef redness) Severe erythema (raised more than 1mm and extending beyond the area of exposure) 4

123 TABLE IV. Inhibitor 9 and ABP 11 are not irritants on the mice's skin. Erythema and eschar score formation after applying inhibitor Boc-Phe-Phe P -(OPh)2 (9) or ABP biotin-x-x-phe-phe P -(OPh)2 (11) suggests that do not provoke irritation even in prolonged application times. Erythema and Eschar Score after (hours) Genotype Substance wt Boc-Phe-PheP-(OPh)2 (9) biotin-x-x-phe-phe P -(OPh)2 (11) Klk5 -/- Boc-Phe-PheP-(OPh)2 (9) biotin-x-x-phe-phe P -(OPh)2 (11) TABLE V. Inhibitor 9 and ABP 11 are not provoking oedema on the mice's skin. Oedema score formation after applying Boc-Phe-Phe P -(OPh)2 (9) or biotin-x-x-phe- Phe P -(OPh)2 (11) remains to zero even in prolonged application times. Oedema Score after (hours) Genotype Substance wt Boc-Phe-PheP-(OPh)2 (9) biotin-x-x-phe-phe P -(OPh)2 (11) Klk5 -/- Boc-Phe-PheP-(OPh)2 (9) biotin-x-x-phe-phe P -(OPh)2 (11) As shown in Table IV and Table V, the inhibitor Boc-Phe-Phe P -(OPh)2 (9) and ABP biotin-x-x-phe-phe P -(OPh)2 (11) do not display acute skin irritation and corrosion on the skin in both wt and Klk5 -/- mice. Thus, they can be used for the pharmacological assessment of their efficiency in preclinical models. Moreover, the application of the inhibitor Boc-Phe-Phe P -(OPh)2 (9) on mouse skin resulted in the reduction of macroscopic desquamation by approximately 50% (Figure 39) in Spink5 -/- Klk5 -/- mice. 91

124 Figure 39: Effect of KLK inhibitor 9 treatment on Spink5 -/- Klk5 -/- mice skin. Macroscopic images of the Spink5 -/- Klk5 -/- mice treated with the KLK7 inhibitor 9. The area included inside the blue line is the area that received the treatment. On the left side of the mice, solvent control was added, and on the right, the inhibitor. The lower graph shows the quantification of desquamation. Specifically, the function of the KLK7-specific inhibitor 9 was validated in the Spink5 - /- Klk5 -/- mouse model that we have established. Spink5 -/- mice were not used since they 92

125 die within 5 h after birth. Deletion of Klk5 rescues neonatal lethality of Spink5 -/- mice (Furio et al., 2015). However, Spink5 -/- Klk5 -/- develop desquamating symptoms and inflammation on P3 and finally succumb 7-8 days after birth (Kasparek et al., 2017). Klk7 expression is induced in 7 days old Spink5 -/- Klk5 -/- as well as chymotryptic epidermal activity. Spink5 -/- Klk5 -/- were treated daily with 1 mm inhibitor after P3 (when first macroscopic symptoms of desquamation appear). On the left flank, mice were treated with solvent control (45% isopropanol, 6% 1,2 propanediol, 1.2% DMSO in water) and on the right with inhibitor. As shown in Figure 39, we observed a significant reduction in the desquamation of mice. However, we could not rescue the lethality, and mice treated with inhibitor still died after P7, probably because desquamation was only inhibited in a small area of the mouse skin. Finally, to provide a clear rationale for the theranostic action of the biotin-x-x-phe-phe P -(OPh)2 (11), the ABP was applied under the same conditions on the skin of Spink 5-/- Klk 5-/- mice. The biotin-x-x-phe-phe P -(OPh)2 (11) was able to inhibit the macroscopic desquamation as expected (Figure 40). Solvent ABP 11 Figure 40 Effect of KLK ABP 11 treatment on Spink5 -/- Klk5 -/- mice skin. Macroscopic images of the Spink5 -/- Klk5 -/- mice treated with the ABP 11. The area included inside the blue line is the area that received the treatment. On the left side of the mice, solvent control was added and on the right the ABP. 93

126 Figure 41: Suppression of inflammatory cytokines expression after inhibitor 9 application. Cytokine expression was quantified with RT-qPCR. Blue graph solvent treatment, Red bar inhibitor treatment. The expression data per individual mouse is given in Appendix Figure 142. Data shown are median±s.e.m (n=4 per genotype). Further, the application of the inhibitor Boc-Phe-Phe P -(OPh)2 (9) on mouse skin resulted in the suppression of inflammatory cytokines expression (Figure 41). We investigated the expression of the proinflammatory cytokines: Tslp, Tnfα, Il-1b, Il-18, Il-17α, and Il-23. The cytokines were selected since they drive the inflammatory phenotype of Spink5 -/- mice and also the delayed desquamation development of Spink5 - /- Klk5 -/- mice (Kasparek et al., 2017; Zingkou et al, 2020). Tslp is an important mediator between inflammation and induction of itching. Tslp is important for atopic dermatitis and is a strong inducer of asthma in atopic dermatitis. Therefore, our study sets the basis for the development of a new approach to treating atopic dermatitis, which is characterized by intolerable itch. In the same context, anti-tnfa based therapeutics have been applied for the treatment of moderate to severe atopic dermatitis, further supporting our rationale for the development of KLK7 specific therapeutics as an alternative and precise approach. 94

127 A TPA - + B Epidermis -TPA kda wt1 wt2 wt1 wt Dermis Epidermis +TPA Dermis Figure 42: Expression of Klk7 is induced by TPA-treatment. A, Expression of Klk7 is induced after TPA application. Upper, Western blot; Lower, Membrane stained with Ponseau S. B, The activity of Klk7 is induced by TPA as determined by activography with the ABP biotin-x-x-phe-phe P -(OPh)2 (11). In control skin (upper), active KLK7 is almost undetectable except for hair follicles. In TPA-treated skin, active KLK7 is found spread throughout the epidermis. The red dashed line indicates the epidermal-dermal junction. As mentioned, it is expected the inhibitor 9 and ABP 11 would react with mouse Klk7 theoretically in a similar way to the KLK7 as well. Thus, the ABP biotin-x-x-phe- Phe P -(OPh)2 (11) was used to investigate the expression of active Klk7 in mouse skin induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), a classical chemical irritant and tumour promoter. We found that TPA highly induces the expression of Klk7 protein (Figure 42A). In accordance, activography conducted with the biotin-x-x-phe-phep- (OPh)2 (11) showed increased staining in TPA-treated skin compared to untreated (Figure 42B). 95

128

129 CHAPTER 2: DESIGN, SYNTHESIS, AND EVALUATION OF KLK7 qabp Design of KLK7 qabp Cy5-Phe-PheP-(OEt)(Tya-QSY21) For the design of the quenched active-based probe (qabp) Cy5-Phe-Phe P -(OEt)(Tya- QSY21) (Figure 43), which is theoretically ideal for the in vivo detection and monitoring of the KLK7 activity, we extended the core motif -Phe-Phe P - with a fluorophore and a suitable quencher. Figure 43: Structure and mechanism of the qabp Cy5-Phe-Phe P -(OEt)(OTya- QSY21). The fluorophore Cy5 emits after the expallation of the quencher QSY21 attached to leaving aryloxy group. The qabp could become fluorescent only after the removal of the quencher by the protease, so the quencher must be attached to the leaving group, in this case, on an aryl moiety. Mixed phosphonates are designed for the synthesis of qabps (Serim et al., 2015; Oresic Bender et al., 2015) because only one quencher must be attached to an aryl moiety of ABP, which is the preferred leaving group. So the need for an alkyl group as an ester component is obvious and ensures that the proper aryl moiety with the attached quencher will leave after covalent enzyme modification. For that reason, the qabp must be a mixed, alkyl/aryl phosphonate ester. The fluorescence quencher QSY21 and the leaving group are released upon a nucleophilic attack to the phosphorus of the qabp by Ser195. Thus, the attached to qabp fluorophore Cy5 emits at λem 665 nm (excitation at λex 647 nm) and could be applied for real-time imaging, allowing the in vivo visualization and localization of active KLK7 by fluorescent microscopy. 97

130 Synthesis of qabp Cy5-Phe-Phe P -(OEt)(Tya-QSY21) For the synthesis of qabp, we had to synthesize a mixed alkyl/aryl phosphonate ester, suitable for elongation with the chromophore and the quencher. As an aryl spacer between the quencher and the phosphonate, 4-(2-aminoethyl)phenol 28 was chosen, known as tyramine (Tya). The fluorophore and his quencher are anchored to Phe-Phe P core on the N-terminus and the amino group of Tya, respectively. For the synthesis, first, the amino group of tyramine was protected with the phthalimido (Pth) group (Scheme VIII), which is compatible with the Boc-protection of the N-terminus of peptidyl DPP. Scheme VIII: Protection of tyramine with phthalic anhydride. The transesterification of Z-Phe P -(OPh)2 (7) or Boc-Phe-Phe P -(OPh)2 (9) to the corresponding diethyl esters Z-Phe P -(OEt)2 (30) or Boc-Phe-Phe P -(OEt)2 (32) was achieved (Scheme IX). The transesterifications of 7 and 9 occurred with ethanol (EtOH), KF, and the use of 18-crown-6 ether as a catalyst. Good yields were achieved (49% and 58%, respectively). Therefore the stage was set for the synthesis of the Z- Phe P -(OEt)(OTya-Pht) (44) and Boc-Phe-Phe P -(OEt)(OTya-Pht) (46) via the intermediates phosphonic acid chlorides 31 and 33 formations. We used the mild chlorinating agent oxalyl chloride (C2O2Cl2) to efficiently yield monochlorinated products 31 and 33 (Foust et al., 2017). The starting materials 30 and 32 were consumed, as indicated on TLC analysis. Unfortunately, the next step failed or had a negligible yield. Τhis is assumed to be due to the very low solubility of Pht-Tya-OH (29) in the common organic solvents. 98

131 Scheme IX: Synthetic routes for the synthesis of Cy5-Phe-Phe P -(OEt)(OTya- QSY21) using Boc/Pth for the orthogonal amine protection. Red arrows indicate reactions that failed to proceed. Light blue structures represent compounds not synthesized. 99

132 According to procedures described in Scheme IX, the difficulties in synthesizing the desired qabp led us to reconsider a new approach by introducing a slight little but essential variation. Boc-group for protection of the tyramine amino group was used instead of phthalimido-group and orthogonal Fmoc protection for the N-terminus. The amino protection of tyramine (Scheme X) gave the Boc-Tya-OH (34), which is very soluble to common organic solvents, a valuable and desirable feature. Scheme X: Protection of tyramine with di-tert-butyl dicarbonate (Boc)2O. Starting from diethyl ester Z-Phe P -(OEt)2 (30), the intermediate phosphonic acid chloride 31 was produced again using oxalyl chloride, which reacted with Boc-Tya-OH (34) in toluene with triethylamine to produce Z-Phe P -(OEt)(OTya-Boc) (35) in high yield (Scheme XI). Deprotection of 35 occurred with TES and 10% Pd-C in MeOH/CH2Cl2 and the resulting N-deprotected phosphonate H2N-Phe P -(OEt)(OTya- Boc) (36) was coupled with Fmoc-Phe-OH in DCM using TBTU/HOBt as a coupling reagent in the presence of DIPEA. The desired Fmoc-protected phosphonic dipeptide Fmoc-Phe-Phe P -(OEt) (OTya-Boc) (39a) was purified by column chromatography. The Fmoc group is widely applied in solid-phase peptide synthesis. However, it is not used workaday in solution synthesis due to the difficult removal of the dibenzofulvene byproducts, which may cause side reactions during deprotection. The problem has been solved by partitioning the side products in AcCN/Hex system (Takahashi, 2010). In our case, the desired N-terminus free H2N-Phe-Phe P -(OEt)(OTya-Boc) (40) was not obtained because the phosphonic ester was eliminated, probably by the diethylamine used for the Fmoc removal, resulting H2N-Phe-Phe P -(OH)(OTya-Boc). To overcome this obstacle, Z-Phe-OH (38) was prepared (Scheme XII) by reaction of Z-OSu with phenylalanine (Paque 1982). 100

133 Scheme XI: Synthetic route for the synthesis of Cy5-Phe-Phe P -(OEt)(OTya- QSY21) using Fmoc/Boc or Z/Boc orthogonal amine protection. 101

134 Scheme XII: Synthesis of Z-Phe-OH (37). Coupling of N-deprotected phosphonate H2N-Phe P -(OEt)(OTya-Boc) (36) with Z-Phe- OH (38) in DCM using TBTU/HOBt as a coupling reagent in the presence of DIPEA resulted in the desired Z-protected phosphonic dipeptide Z-Phe-Phe P -(OEt)(OTya-Boc) (39b) that was purified by column chromatography. Removal of Z with TES and 10% Pd-C in MeOH gave the desired H2N-Phe-Phe P -(OH)(OTya-Boc) (40). Cyanine 5- NHS ester (Cy5-NHS) reacted with 40 in DMSO to give Cy5-Phe-Phe P -(OPh)(Tya- Boc) (41), which purified with semi-preparative HPLC. 41 treated with 50% TFA/DCM to remove Boc-group giving Cy5-Phe-Phe P -(OEt)(Tya-NH2) (42). Finally, the reaction of QSY 21 succinimidyl ester (QSY21-NHS) with 42 in DMSO gave the qabp Cy5- Phe-Phe P -(OEt)(OTya-QSY21) (43) (Scheme XIII). Compound 43 was purified by semi-preparative HPLC and lyophilization and isolated as a dark blue solid. The qabp was produced and used as a mixture of diastereomers, as indicated from NMR, HPLC, and MS analysis. 102

135 Scheme XIII: Extended structure of Cy5-Phe-Phe P -(OEt)(OTya-QSY21). With pink color represented the fluorophore Cy5, and with blue color the quencher QSY

136 Evaluation of qabp Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43). First, the stability of purified qabp Cy5-Phe-PheP-(OEt)(OTya-QSY21) (43) was examined in PBS, a standard working buffer. The results represented in Figure 44 indicate that the qabp 43 is very stable, even at prolonged times (72 hours) mau Detector A Ch1:660nm A % B.Conc.(Method) min mau Detector A Ch1:660nm B.Conc.(Method) % B min 0 mau Detector A Ch1:660nm 110 B.Conc.(Method) % C min 0 Figure 44: Stability of qabp Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43) in PBS. A, Analytical RP-HPLC of purified qabp Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43). B, Analytical RP-HPLC of qabp 43 (0.1 mm in PBS) incubated at 37 o C for two hours. C, Analytical RP-HPLC of qabp 43 (0.1 mm in PBS) stored at ambient temperature in the dark for three days. Solvents: A: water + 0.1% TFA, B: acetonitrile + 0.1% TFA. Gradient: 20% B for 5 min, then 20% to 100% B in 40 min. 104

137 The synthesized qabp 43 was tested for labeling and activity in vitro using the prototype enzyme chymotrypsin. As shown in Figure 45A, the qabp 43 could bind to chymotrypsin, and the fluorescence emitted by the chymotrypsin-qabp adduct was detected by scanning the SDS-PAGE gel with a Phosphorimager. No background fluorescence was detected. Figure 45: Evaluation of labeling and quenching action of qabp Cy5-Phe-PheP- (OEt)(OTya-QSY21) (43). A, Detection of chymotrypsin-abp adduct by SDS-PAGE. Chymotrypsin reacted with qabp at 1 mm for 1 hour at 37 o C. B, Active human recombinant KLK7 produced in Pichia pastoris. The detection was carried out by Western blotting with anti-klk7 antibody (Abcam, ab96710). C, Detection of active recombinant KLK7 with qabp. Reactions in the absence of the qabp served as negative controls. 105

138 Then, the qabp was tested against human KLK7. Active recombinant KLK7 was expressed in the methylotrophic yeast Pichia pastoris. Briefly, the cdna encoding the mature (active) KLK7 was amplified from normal human keratinocytes by RT-PCR and cloned into the ppic9 yeast expression vector, in frame with the yeast secretion signal known as the α-factor. The ppic9/klk7 expression construct was linearized by digestion with SalI and used to transform P. pastoris spheroplasts (Sotiropoulou et al., 2003). Stably transformed clones were selected based on their ability to grow in the absence of histidine, and the addition of methanol induced the production of KLK7. KLK7 was purified from the yeast supernatant by strong cation exchange chromatography (Bio-Scale Mini Macro-prep High S, Bio-Rad) by an FPLC system (NGC Quest 10, Bio-Rad). We observed that KLK7 is widely clipped, probably through self-cleavage at position 104 (Figure 45B) as previously described (Yu et al., 2015). In Figure 45C, it is shown that the qabp 15 selectively detects the active form of KLK7 and not the cleaved/clipped inactive form detected by a KLK7-specific antibody. The strong upper band of ~38 kda likely corresponds to the glycosylated form of KLK7. It is not observed following purification assumingly due to highly efficient autocatalytic cleavage, which accounts for the low yield during KLK7 purification. These premilitary tests indicate that qabp 43 is suitable for the purpose that was designed and will be a successful tool for in vivo imaging. 106

139 CHAPTER 3. DESIGN, SYNTHESIS, AND EVALUATION OF KLK6 INHIBITORS AND ABP Design of KLK6 ABP For the design of KLK6 ABP, the substrate specificity matrix for KLK6 was retrieved, and other trypsin-like KLKs (KLK5, KLK8), as well as other serine proteases (Figure 46). The optimum substrate sequence P4-P1 for KLK6 is Ser-Gly-Gly-Arg, but, as we mentioned elsewhere, the best substrate sequence is not always the best for selectivity. In contrast, the same sequence may also preferable by other SP. Since the number of trypsin-like enzymes is much higher than the chymotrypsin-like, to increase the possibility of success in a specific sequence, we extended the peptidyl sequence from two residues to four. We focus on designing a sequence that could be more specific for KLK6 and less for the KLK5 and KLK8 that have similar specificity profiles and similar distribution. As shown in Figure 46, the His-Ile- motif at P4-P3 positions is unique for the KLK6. The further reciprocal analysis confirmed that His-Ile-Val-Arg is KLK6 specific substrate relative to other proteases, especially KLK5 and KLK8. To develop an ABP, we turn the Arg residue to the corresponding diphenyl phosphonate surrogate and used it as a warhead. For the detection tag, we choose biotin-dpeg 4, a biotin discrete polyethylene glycol moiety (dpeg). This dpeg spacer imparts a high degree of water solubility to the biotin label. The PEG spacer dramatically reduces aggregation and precipitation of the modified molecule, a problem with molecules that have been biotinylated with other biotin derivatives used. Synthesis of KLK6 ABP Synthesis of biotin-dpeg 4-His(Clt)-Ile-Val-OH We synthesized Fmoc-His(Clt)-Ile-Val-Resin according to standard solid phase peptide synthesis protocols (SPPS) (Scheme XIV). SPPS enjoys numerous benefits compared to peptide synthesis in solution. Mainly, the workup is very simple and short and gives pure peptides in high yield. Briefly, Fmoc-Ile-OH was coupled to the attached on 2-chlorotrityl chloride resin Val (49) to give the dipeptide 50 using TBTU/HOBt as coupling reagent in the presence of 107

140 DIPEA. Deprotection of Fmoc-group with 20% piperidine in DMF gave the dipeptide 51, which coupled with Fmoc-His(Clt)-OH to provide the tripeptide Fmoc-His(Clt)-Ile- Val- attached to the resin (52). For the side protection of His, we choose the chlorotrityl group, preferred for the synthesis of side-protected peptides. KLK6 Substrate specificity A Amino acid P4 P3 P2 P1 P1' P2' P3' P4 Gly Pro Ala Val Leu Ile Met Phe Tyr Trp Ser Thr Cys Asn Gln Asp Glu Lys Arg His B KLK5 Substrate specificity Amino acid P4 P3 P2 P1 P1' P2' P3' P4' Gly Pro Ala Val Leu Ile Met Phe Tyr Trp Ser Thr Cys Asn Gln Asp Glu Lys Arg His KLK8 substrate specificity Amino acid P4 P3 P2 P1 P1' P2' P3' P4' Gly Pro Ala Val Leu Ile Met Phe Tyr Trp Ser Thr Cys Asn Gln Asp Glu Lys Arg His Figure 46. Substrate specificity matrixes indicate the recognition sequence for KLK6 ABP design. Substrate specificity matrixes of (A) KLK6 and (B) related KLKs (KLK5 and KLK8) reveal that the motif His-Ile is unique for KLK6. Data retrieved from MEROPS. 108

141 Scheme XIV: Synthesis of biotin-dpeg 4-His(Clt)-Ile-Val-OH (56). 109

142 For the bound to the side protected Arg-like DPP, the tripeptide must be also side protected. To check up the stability of the side-protected tripeptide in the cleavage mixture and the efficacy of the cleavage in mild acidic conditions, the tripeptide 52 was treated with AcOH/TFE/DCM 2:2:3 to give N- and side-protected tripeptide 53. This result was satisfactory enough to proceed in the next step, namely the biotinylation of the tripeptide. The tripeptide 52 was treated with 20% piperidine to give free amine peptide 54 attached to the resin (Scheme XIV). For the biotinylation, we used the activated as a 2,3,5,6-tetra-fluorophenyl ester (TFP) biotin derivative with four ethylene glycol groups as a spacer (biotin-dpeg 4-TFP ester). TFP is hydrolyzed more slowly than the NHS ester in aqueous media and is more reactive towards amines than NHS esters. The coupling gave the biotinylated peptide attached to the resin (55), which was cleaved with 20% TFE/DCM to provide the side-protected free carboxyl peptide 56, after purification by reverse phase semi-preparative HPLC. During the following steps (mentioned below, Scheme XV), we noted the incomplete deprotection of His residue. To discern if observed only in the final side deprotection or also occurs in the previous stage, biotin-dpeg 4-His(Clt)-Ile-Val-OH (56) was treated with 1% triethylsilane in 50% TFA/DCM. Unexpectedly, the chlorotrityl protecting group appeared too resistant to that mixture, and others attempts with other reaction mixtures such as Reagent B, theoretically suitable for the deprotection of acid-labile protecting groups, also led to incomplete deprotection and/or side-products formation. Synthesis of Z-Arg P -(OPh)2 (67), H2N-Arg P -(OPh)2 (69) and biotin-dpeg 4-His- Ile-Val-Arg P -(OPh)2 (71) The synthetic pathway for the preparation of Arg diphenyl phosphonate ester inhibitors and, finally, the biotinylated probe is described in Scheme XV. Initially, 4-amino-1- butanol (H2N-Bu-OH, 58) was reacted with Boc anhydride to give Boc-Bu-OH (59). Several attempts to oxidize the alcohol 59 to the corresponding aldehyde 60 by typical procedures using sulfur trioxide pyridine complex (SO3.Py), DMSO/oxalyl chloride (Swern oxidation), or pyridinium chlorochromate (PCC) failed since we also proved that the aldehyde 60 cyclized easily (Joossens et al., 2004). 110

143 Scheme XV. Synthesis of Z-Arg P -(OPh)2 (67), H2N-Arg P -(OPh)2 (69) and biotindpeg 4-His-Ile-Val-Arg P -(OPh)2 (71). The red arrow indicates a reaction that failed to proceed. Light grey structures represent compounds not synthesized. 111

144 To avoid this problem, phthalimide (Pht) protection was used for the amine instead of t-butyloxy carbonyl (Boc) protection. The alcohol 58 was treated with phthalic anhydride to give the N-protected amino-alcohol 62 (Jackson et al., 1998) followed by oxidation with PCC (Tojo and Fernández, 2006) to give the aldehyde 63. The diphenyl phosphonate ester Z-Orn P (Pht)-(OPh)2 (64) was obtained as usual by treating the aldehyde 63 with triphenyl phosphite and benzyl carbamate in acetic acid at C (43%) or in dichloromethane with cooper triflate as catalyst (58%). The phthalimido protecting group was removed with hydrazine in hot i-proh solution, and the sidechain unblocked derivative Z-Orn P -(OPh)2 (65) was produced. The transformation of the ornithine analogue 65 to the arginine one 66 occurs by treatment with the guanidinylation reagent 1,3-di-Boc-2-methylisothiourea (N,N -Bis(tertbutoxycarbo nyl)-s-methylisothiourea). The Z-Arg P (Boc)2-(OPh)2 (66) side chain deprotection with 50% TFA/DCM resulted in the inhibitor Z-Arg P -(OPh)2 (67), while N-terminus deprotection with TES and 10% Pd-C resulted in the intermediate H2N-Arg P (Boc)2- (OPh)2 (68). The unprotected, free amino, arginine-like DPP inhibitor H2N-Arg P - (OPh)2 (69) was obtained by the reaction of 68 with 50% TFA in DCM. The side-chain protected Arg phosphonate 68 was coupled with biotinylated tripeptide 56 in DCM using TBTU/HOBt as a coupling reagent in the presence of DIPEA to yield the side chains protected ABP biotin-dpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70). The reaction progress was monitored by ESI-MS, and the usual workup for coupling reactions was performed, followed by precipitation of peptide by ether. Product 70 did not precipitate, and it was thought that the protected ABP was still in the ether mother liquor. Indeed, taking an ESI-MS spectrum of the ether residue after evaporation was found that the product is soluble in ether, a fact rare but usual for lipophilic peptides. Finally, treatment of 70 with 1% TIS in 50% TFA/DCM or Reagent B provided the ABP biotin-his-ile-val-arg P -(OPh)2 (71) as a mixture with Clt-protected His analogue and other by-products, probably due to the incomplete removing of Clt-group and/or Clt-reactivity. The incomplete removal of Clt-group and/or Clt-reactivity is indicated from the ESI- MS spectra of the reaction mixture of deprotection (Appendix Figure 143). At 25 min peaks appear at (i) m/z corresponding to ABP 71 biotin-dpeg 4-His-Ile-Val- Arg P -(OPh)2 I ([M+H] + ), (ii) m/z corresponding to Clt-deprotected and partially Boc-deprotected by-product II (biotin-dpeg 4-His-Ile-Val-Arg P (Boc)- 112

145 (OPh)2, [M+H] + ) and (iii) m/z corresponding to Boc-deprotected and Cltprotected by-product III (biotin-dpeg 4-His(Clt)-Ile-Val-Arg P -(OPh)2, [M+H] + ) (Figure 47). After 15 min (40 min total), the deprotection of Arg moiety has been complete, but the percentage of III seemed to be raised. Moreover, 60 min from the reaction start, the percentage of III is even more elevated. We assumed that the scavengers are insufficient, and Clt-group re-attack the molecule at His residue or other sites, e.g., Arg. Considering the solubility problems on the workup of 70 and the data obtained from the final deprotection to give the desired ABP 71, we optimized the yield in the synthesis of 71 using semi-preparative reverse phase HPLC for the purification of crude 70, without any other workup procedure, followed by lyophilization. We also decided to stop the final side deprotection of 70 at 30 min and use semi-preparative reverse phase HPLC for the purification and isolation of ABP 71. Figure 47: Partially deprotected side-products during deprotection of biotindpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2. 113

146 Evaluation of KLK6 inhibitors and ABPs As a preliminary test, it was decided to evaluate inhibitors Z-Arg P -(OPh)2 (67) and H2N-Arg P -(OPh)2 (69) against trypsin and KLK6 (Figure 48). Both exhibited strong inhibitory activity against KLK6. The two compounds could effectively also inhibit trypsin, indicating a lack of selectivity, a fact expected due to just one position of recognition sequence occupied. The elongation of the peptidyl sequence may tune the selectivity to the desired selective KLK6 inhibition. Z-Arg P -(OPh)2 seems to possess more potent inhibitory activity according to what was mentioned in the Introduction, namely that amine protection may be beneficial or not to inhibitory potency. Figure 48: Gelatin zymography shows the inhibitory activity of Z-Arg P -(OPh)2 (67) and H2N-Arg P -(OPh)2 (69) against rklk6 and trypsin. A, gelatin zymography of rklk6 and trypsin; B, gelatin zymography of rklk6 and trypsin in the presence 100 μμ H2N-Arg P - (OPh)2; C, gelatin zymography of rklk6 and trypsin in the presence 100 μμ Z-Arg P -(OPh)2; Μ: prestained protein marker BlueStar PLUS (Nippon Genetics), 1: rklk6 (1 μg), 2: trypsin (10 ng). 12% acrylamide gel was used containing 0.1% gelatin, and it was stained with Coomassie blue G-250. Adapted from Christina Giannakopoulou M.Sc dissertation, Patras,

147 Simple amino acid phosphonate surrogates of Arg have been tested as inhibitors in many cases (Jackson et al., 1998; Sieńczyk and Oleksyszyn, 2006). Given that selectivity is enhanced with recognition sequence elongation, the selectivity is accepted to be very low. However, Z-phosphono-arginine (Z-Arg P -(OPh)2, 67) and the arginine aromatic analogue 4-amidinophenylglycine Cbz-(4-AmPhGly) P (OPh)2 (sic) (Figure 49) have been tested against many serine proteases as a single molecule. Cbz-(4- AmPhGly) P (OPh)2 also used at P1 to peptidyl phosphonate inhibitors, many of them potent and selective (Oleksyszyn et al., 1994; Jackson et al., 1998; Sieńczyk and Oleksyszyn, 2006). Figure 49: Structures of Z-Arg p -(OPh)2 (67) and Cbz-(4-AmPhGly) P (OPh)2, phosphonate analogues of Arg. Next, kinetic studies were performed to examine the inhibition against KLK6 and trypsin. As we have mentioned, the inhibition of SP with phosphonates is two-step progress (Figure 50A). The first is reversible, and it depends on the affinity of the inhibitor to the enzyme active site. The second is irreversible, and the nucleophilic attack of Ser 195 to phosphonate warhead results in a covalent adduct. The reversible step is characterized by the KI (KI=koff/kon) and measures the ability of the inhibitor to interact with the enzyme. The kinact characterizes the irreversible step. The ratio kinact/ki denotes the ability of a covalent inhibitor to interact with and neutralize a target enzyme. For the determination of kinact/ki the equations described in Figure 50B and 50C is used. 115

148 Figure 50: Determination of potencies (kinact/ki values) for irreversible inhibitors. A, The two-step mechanism of inhibition for irreversible inhibitors are determined by KI and kinact. The protein is symbolized as P, and the inhibitor as I. The KI constant determines the first reversible step. KI value depicts the inhibitor concentration required to achieve half of the maximum rate for protein-inhibitor complex formation. The second step, describing the maximum rate of the covalent bond formation, is depicted with kinact constant B, The equation used to determine Kobs, where At is the absorbance, A0 is the absorbance at t=infinite, A1 is a total absorbance change between absorbance in time zero and infinite. C, The equation displays the relation between Kobs and inhibitor concentration [I]. [S] is the substrate concentration, Km the Michaelis-Menten constant. The enzyme kinetic experiment results are summarized in Figures 51 (for inhibitor 67) and Figure 52 (for inhibitor 69). The inhibitory potency of Z-Arg P -(OPh)2 (67) against rklk6 was examined using BAEE as substrate and measured over time the inhibition reaction rates in various inhibitor concentrations. The rklk6 concentration was 12 nm, and the substrate concertation 250 μm. To the rklk6/baee reaction mixtures, added inhibitors in various concertations to achieve 10, 50, 100, 200, 300, and 500-fold excess of Z-Arg p -(OPh)2 (67), and the reaction rate was monitored at A254 for 15 min, at a Perkin Elmer spectrophotometer Lambda 25. The hyperbolic curves obtained were fitted to the equation represented in Figure 50B and the kobs rate was obtained for each individual inhibitor concentration. The slope of the plot of kobs against the various inhibitor concertation was used to determine kinact/ki from the equation represented in Figure 50C. Data analysis was performed using OriginLab 2019 software. The calculated value of kinact/ki was M -1 s -1 (Figure 51). 116

149 Figure 51: Determination of kinetic constants for the irreversible inhibitor Z- Arg P -(OPh)2 (67) against rklk6 with BAEE substrate. A, diagram of the change of A254 over time. The different hyperbolic curves correspond to background reaction of rklk6 (without inhibitor) (black), the reaction of rklk6 mixed with 10-fold (red), 50-fold (blue), 100-fold (green), 200-fold (purple), 300-fold (yellow), and 500-fold inhibitor (turquoise). B, plot of Kobs, the pseudo-first order rate constant for the binding of Z-Arg P -(OPh)2 to KLK6 against different inhibitor concentrations. The kinact/ki ratio was calculated from the slope of the line and is M -1 s -1. The substrate concentration was 250 μμ, and the protein concentration was 12 nm. Adapted from Christina Giannakopoulou M.Sc dissertation, Patras Figure 52: Determination of kinetic constants for the irreversible inhibitor H2N- Arg P -(OPh)2 (69) against rklk6 with BAEE substrate. A, Kinetics of A254 change. Different hyperbolic curves correspond to the background reaction of rklk6 (without inhibitor) (black), the reaction of rklk6 mixed with 100- fold (red), 500-fold (blue), 1,000-fold (green), and 5,000-fold inhibitor (purple). B, Plot of Kobs, the pseudo-first-order rate constant for binding of Z-Arg P -(OPh)2 to KLK6 against different inhibitor concentrations. The kinact/ki ratio was calculated from the slope of the line and is 65 M -1 s -1. The substrate concentration was 250 μμ, and the protein concentration was 12 nm. Adapted from Christina Giannakopoulou M.Sc dissertation, Patras,

150 The same method was used to calculate the kinact/ki ratio for H2N-Arg p -(OPh)2 (69). Gel zymography indicated that 69 is a weaker inhibitor than 67, and we decide to increase the inhibitor excess to 100-fold, 1,000-fold, 2,000-fold, and 5,000-fold The kinact/ki ratio was computed to 65 M -1 s -1 (Figure 52). The results indicate that Z-Arg P -(OPh)2 (67) is a potent KLK6 inhibitor, and the kinact/ki ratio value is comparable to those published from others KLK6 inhibitors. Considering these premilitary studies, we proceed to design and synthesize the KLK6 ABP biotin- His-Ile-Val-Arg P -(OPh)2 (70) by tuning the selectivity of 67 with peptidyl recognition sequence elongation. 118

151 EXPERIMENTAL PROCEDURES AND DATA 119

152

153 Experimental procedures and data General experimental procedures General Procedure 1 Amidoalkylation of triphenyl phosphite in acetic acid. Benzyl carbamate (1 eq.), triphenyl phosphite (1 eq.), and the appropriate aldehyde (1.5 eq.) added to glacial acetic acid ( ml/mmol aldehyde). The stirring solution was refluxed for 2-3 h until benzyl carbamate was consumed as indicated by TLC. Acetic acid was removed in vacuo, and the oily residue was dissolved in chloroform. Then, a 4-fold volume of methanol was added and left for crystallization at -20 o C overnight to give the DPP as a racemic mixture. When the precipitation was insufficient, the product was purified. General Procedure 2 Amidoalkylation of triphenyl phosphite in dichloromethane. Aldehyde (1 eq.), triphenyl phosphite (1 eq.), and benzyl carbamate (1 eq.) were dissolved in DCM (2 ml/mmol aldehyde), and Cu(OTf)2 (0.1 eq.) was added. The mixture was stirred at room temperature until benzyl carbamate was consumed. Then DCM was evaporated in vacuo, and MeOH was added. The resulting solution was kept at 4 C until the precipitation of diphenyl phosphonates was complete. When the precipitation was insufficient, the product was purified. General Procedure 3 Z-deprotection via catalytic transfer hydrogenation with 1,4-cyclohexadiene. The Z-protected DPP (1 eq.) was dissolved in absolute ethanol (4 ml/mmol DPP) under a nitrogen atmosphere. An equal weight of 10% Pd-C was added, followed by the addition of 1,4-cyclohexadiene (10 eq.). The reaction proceeded for a minimum of 2 hours, and the mixture was filtered (celite), celite was washed with dichloromethane, and the solvents were removed under reduced pressure. The resulting crude amines were used directly in the next step without further purification. 121

154 General Procedure 4 Z-deprotection via catalytic transfer hydrogenation with triethylsilane. To the mixture of Z-protected DPP (1 eq.) and 10% Pd-C (20% by weight) in MeOH or MeOH/CH3Cl 9:1 (2-3 ml/mmol) was added triethylsilane (10 eq.) dropwise under nitrogen atmosphere. When the reaction was complete, the mixture was filtered through celite, and solvents were evaporated in vacuo. The crude amines were used without further purification or purified on a silica gel column (Hexanes/Ethyl acetate 80% to 60%). General Procedure 5 Amino acid coupling in solution To the stirring solution of the appropriate amino diphenyl phosphonate (1 eq.) in DCM (2-3 ml/mmol), Boc-Phe-OH (1.1 eq) was dissolved, followed by the addition of TBTU (1.1 eq), HOBt (1.1), and DIPEA (3 eq). The mixture was allowed to stir at ambient temperature, and DIPEA was added if necessary to maintain alkaline ph. When the DPP was consumed, the mixture was mildly concentrated under reduced pressure, ethyl acetate (20 ml/mmol) was added, the mixture was washed with H2O (4x), NaHCO3 5% (3x), H2O, 10% citric acid (3x), H2O and brine, and dried over Na2SO4. The solvents were removed in reduced pressure, and the crude peptide was triturated with diethyl ether (-20 o C) or purified in column chromatography (Hexanes/Ethyl acetate 80% to 60%). General Procedure 6 Boc deprotection The Boc-protected peptidyl DPP was dissolved in 50% TFA in DCM (2-5 ml) and was allowed to stir at room temperature for 2-3 hours. Toluene (2-5 ml) was added and the solvents removed in vacuo (3 times), and the oily residue washed with cold ether several times. The deprotected DPP was used without further purification unless else is indicated. 122

155 Experimental procedures and analytical data of synthesized compounds Βenzyl (1-(diphenoxyphosphoryl)-2-phenylethyl)carbamate Z-Phe P -(OPh)2 (7) Synthesized according to General Procedure 1 (yield 28%) and General Procedure 2 (yield 56%) using 2- phenylacetaldehyde (6) as starting material and received as a yellowish solid. Rf : 0.58 (Hexanes/EtOAc, 6:4) 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 18Η), 7.08 (d, J = 7.9 Hz) 5.24 (d, J = 10.2 Hz, 1H), 5.03 (s, 2H), (m, 1H), (m, 1H), (m, 1H) (Figure 53). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 54). ESI-MS: m/z calcd for [M+Na] + C28H26NNaO5P found (100%), calcd for [M+K] + C28H26KNO5P found , calcd for [2M+Na] + C56H52N2NaO10P found (Figure 55). Diphenyl (1-amino-2-phenylethyl)phosphonate H2N-Phe P -(OPh)2 (8) Synthesized according to General Procedure 3 (yield 17%) and General Procedure 4 (yield 97%) and received as a colorless oil. Rf : 0.24 (Hexanes/EtOAc, 6:4). Tert-butyl (1-((1-(diphenoxyphosphoryl)-2-phenylethyl)amino)-1-oxo-3- phenylpropan-2-yl)carbamate Boc-Phe-Phe P -(OPh)2 (9) Synthesized according to General Procedure 5 and received as a white solid (yield 50%). Rf : 0.56 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 19H), 6.99 (dd, J = 7.3 Hz, J = 1.9 Hz; 1H), 6.75 (d, J = 9.5 Hz, 1H), (m, 1H), (m, 1H), 4.30 (m, 123

156 1H), (m, 1H), 3.02 (td, J = 14.4 Hz, J = 10.1 Hz, 1H), (m, 1H), 2.71 (m, 1H), 1.37 (s, 9H) (Figure 56). 13 C NMR (151 MHz, 298 K, CDCl3): 171.0, 150.3, 150.0, 149.9, 136.5, 136.4, 135.9, 135.7, 135.7, 129.8, 129.8, 129.7, 129.7, , 129.3, 129.2, 128.6, 128.5, 128.5, 127.1, 127.0, 126.8, 125.5, 125.4, 125.3, 120.7, 120.7, 120.6, 120.6, 120.5, 120.5, 120.4, 120.4, 47.6, 47.3, 46.5, 46.3, 35.8, 28.2 (Figure 57). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 58). ESI-MS: m/z calcd for [M+Na] + C34H37N2NaO6P ; found (Figure 59) Diphenyl (1-(2-amino-3-phenylpropanamido)-2-phenylethyl)phosphonate H2N-Phe-Phe P -(OPh)2 (10) Synthesized according to General Procedure 6 (colorless oil, quant.). Rf : on the spot (Hexanes/EtOAc, 6:4). ESI-MS: m/z calcd for [M+H] + C29H29N2O4P found (Figure 60). Diphenyl (5-benzyl-4,7,14,21-tetraoxo-25-((3aS,4R,6aR)-2-oxohexahydro-1Hthieno[3,4-d]imidazol-4-yl)-1-phenyl-3,6,13,20-tetraazapentacosan-2-yl)phosphonate Biotin-X-X-Phe-Phe P -(OPh)2 (11) To an ice bath cooled stirred solution of 10 (5 mg, 8.1 μmol) in DMSO (0.4 ml), a solution of biotin-x-x-nhs (5.5 mg, 10 μmol) in DMSO (0.1 ml) was added, followed 124

157 by the addition of HOBt (0.68 mg, 5 μmol) and DIPEA (4 μl, 20 μmol) and the reaction mixture left to warm at room temperature overnight and monitored with TLC. When the reaction was completed, the mixture was diluted with dichloromethane (15 ml) and washed with water. The aqueous phase was washed with dichloromethane (15 ml). The combined organic phases were washed sequentially with aqueous citric acid (10%, 20 ml x 3), aqueous NaHCO3 (5%, 20 ml x 3), H2O (20 ml) and brine (20 ml), dried (Na2SO4), filtered, and concentrated in vacuo, to give, after purification by column chromatography (silica gel, Chloroform/Methanol 95:5 to 90:10), the desired biotinylated ABP biotin-x-x-phe-phe P -(OPh)2 (11) as a pale white solid (4 mg, yield 52%). Rf : 0.24 (CHCl3/MeOH, 9:1). 1 H NMR (600 MHz, 298 K, CD3OD): δ (m, 19H), 7.04 (d, J = 7.2 Hz, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 2H), (m, 8H), (m, 2H), (m, 4H), (t, J = 6.9 Hz, 2H), (m, 7), (m, 14H) (Figure 61). 31 P NMR (243 MHz, 298 K, CD3OD): δ 17.20, (Figure 62). ESI-MS: m/z calcd for [M+Na] + C51H65N6NaO8PS found (Figure 63). Benzyl ((diphenoxyphosphoryl)(phenyl)methyl)carbamate Z-Phg P -(OPh)2 (13) Synthesized according to General Procedure 2 using benzaldehyde (12) as starting material (white solid, yield 60%). Rf : 0.26 (Hexane/EtOAc, 6:4); 0.86 (CHCl3/MeOH, 95:5). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 18H), 6.84 (d, J = 8.1 Hz, 2H), 5.82 (bd, J = 6.4 Hz, 1H), 5.58 (dd, J = 22.2 Hz, J = 9.7 Hz, 1H), 5.15 & 5.06 (d, J = 12.1 Hz, 2H) (Figure 64). 31 P NMR (243 MHz, 298 K, CD3Cl3): δ (major), (Figure 65). ESI-MS: m/z calcd for [M+Na] + C27H24NNaO5P found (100%), calcd for [M+K] + C27H24KNO5P found , calcd for [2M+Na] + C54H48N2NaO10P found (Figure 66). 125

158 Diphenyl (amino(phenyl)methyl)phosphonate H2N-Phg P -(OPh)2 (14) Synthesized according to General Procedure 4 (colorless oil). Rf : 0.12 (Hexanes/EtOAc, 6:4); 0.6 (CHCl3/MeOH, 95:5). Tert-butyl (1-(((diphenoxyphosphoryl)(phenyl)methyl)amino)-1-oxo-3- phenylpropan-2-yl)carbamate Boc-Phe-Phg P -(OPh)2 (15) Synthesized according to General Procedure 4 (white solid, yield 85% for two steps). Rf : 0.45 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 21H), 5.87 (m, 1H), 4.89 (m, 1H), 4.43 (m, 1H), (m, 2H), 1.37 (s, 9H) (Figure 67). 13 C NMR (151 MHz, 298 K, CDCl3): δ 170.7, 150.3, 150.0, 149.9, 149.8, 133.6, 129.7, 129.5, 129.2, 129.1, 128.8, 128.7, 128.6, 128.4, 128.2, 126.8, 125.3, 125.2, 125.1, 120.5, 120.4, 120.2, 51.1, 51.0, 49.9, 28.1 (Figure 68). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 69). ESI-MS: m/z calcd for [M+Na] + C33H35N2NaO6P found (Figure 70). Diphenyl ((2-amino-3-phenylpropanamido)(phenyl)methyl)phosphonate H2N-Phe-Phg P -(OPh)2 (16) Synthesized according to General Procedure 5 (colorless oil, yield 70%). Rf : 0.06 (Hexanes/EtOAc, 6:4). ESI-MS: m/z calcd for [M+H] + C28H28N2O4P found (Figure 71). 126

159 Diphenyl (4,7,14,21-tetraoxo-25-((3aR,4R,6aS)-2-oxohexahydro-1H-thieno[3,4- d]imidazol-4-yl)-1,5-diphenyl-3,6,13,20-tetraazapentacosan-2-yl)phosphonate Biotin-X-X-Phe-Phg P -(OPh)2 (17) To an ice bath cooled stirred solution of 16 (1.8 mg, 2.9 μmol) in DMSO (0.2 ml), a solution of biotin-x-x-nhs (2 mg, 3.5 μmol) in DMSO (0.1 ml) was added, followed by the addition of HOBt (0.81 mg, 2 μmol) and DIPEA (4 μl, 7μmol) and the reaction mixture left to warm at room temperature overnight. The reaction was monitored with TLC. When the reaction was completed, the mixture was diluted with dichloromethane (10 ml) and wash with water. The aqueous phase was washed with dichloromethane (10 ml). The combined organic phases washed sequentially with aqueous citric acid (10%, 3 x 15 ml), aqueous NaHCO3 (5%, 3 x 15 ml), H2O (15 ml), and brine (15 ml), dried (Na2SO4), filtered, and concentrated in vacuo, to give, after purification by column chromatography (silica gel, Chloroform/Methanol 95:5 to 90:10), the desired biotinylated ABP biotin-x-x-phe-phg P -(OPh)2 (17) as a pale white solid (1.8 mg, yield 65%). Rf : 0.38 (CHCl3/MeOH, 9:1). 1 H NMR (600 MHz, 298 K, CDCl3): δ 7.59 (d, J = 7.5, 1H), (m, 15H), 7.05 (d, J = 8.6, 1H), 7.01 (d, J = 8.5, 1H), 6.93 (d, J = 8.5, 1H), 6.88 (d, J = 8.6, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 7H), (m, 6H), (m, 20H) (Figure 72). 31 P NMR (243 MHz, 298 K, CD3OD): δ 14.36, (Figure 73). ESI-MS: m/z calcd for [M+Cl] - C50H63ClN6O8PS found , calcd for [M+Na] + C50H63N6NaO8PS found (Figure 74). 127

160 (E)-benzyl (1-(diphenoxyphosphoryl)-3-phenylallyl)carbamate Z-Hph P -(OPh)2 (19) Synthesized according to General Procedure 1 using cinnamaldehyde (13) as starting material (white solid, yield 61%). Rf : 0.39 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 20H), 6.75 (dd, J = 15.2 Hz, J = 3.3 Hz, 1H), 6.32 (ddd, J = 15.8 Hz, J = 12.4, J = 6.2, 1H), 5.51 (br s, 1H), 5.27 (brs, 1H), 5.16 (m, 2H) (Figure 75). 31 P NMR (243 MHz, 298 K, CDCl3): δ (Figure 76). Diphenyl (1-amino-3-phenylpropyl)phosphonate H2N-Hph P -(OPh)2 (20) Synthesized according to General Procedure 4 (colorless oil, 27%). Rf : 0.4 (Hexanes/EtOAc, 6:4) ESI-MS: m/z calcd for [M+H] + C21H23NO3P found (Figure 77). Tert-butyl (1-((1-(diphenoxyphosphoryl)-3-phenylpropyl)amino)-1-oxo-3- phenylpropan-2-yl)carbamate Boc-Phe-Hph P -(OPh)2 (21) Synthesized according to General Procedure 4 (white solid, yield 64%). Rf : 0.24 (Hexanes/EtOAc, 6:4) 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 18H), 6.76 (d, J = 5.7, 2H), (m, 1H), 4.97 (b, 1H), 4.23 (m, 1H), (m, 1H), (m, 2H), (m, 2H), (m, 2H), 1.41 (s, 9H) (Figure 78). 128

161 31 P NMR (243 MHz, 298 K, CDCl3): δ 21.12, (Figure 79). ESI-MS: m/z calcd for [M+Na] + C35H39N2NaO6P ; found (Figure 80). Benzyl (1-(bis(2,2,2-trifluoroethoxy)phosphoryl)-2-phenylethyl)carbamate Z-Phe P -(OCH2CF3)2 (25) A. TFE/Na. Na (23 mg, 0.41 mmol, 2 eq.) in TFE (2 ml) was stirred until consumed. Then, 7 (100 mg, mmol, 1 eq.) was added, and the mixture was left to stir overnight. AcOH was added, and the solvents were removed in vacuo on a rotavap. The residue was taken in CHCl3 (10 ml), and the solution was washed with water (10 ml), 2 N NaOH (10 ml), water (10 ml), dried over Na2SO4, and concentrated in vacuo to give 25 as a white solid (77 mg, yield 75%); B. TFA/KF/18-crown-6. The stirred mixture of DPP 7 (100 mg, mmol, 1 eq), potassium fluoride dihydrate (192 mg, 2.05 mmol, 10 eq.), and a catalytic amount of 18-crown-6 (5 mg) in trifluoroethanol (2 ml) was heated to reflux for 10 min and then left to cool in ambient temperature overnight. The solvent was removed in vacuo, and water (20 ml) was added, followed by extraction with ethyl acetate (3 x 10 ml). The combined organic extracts were washed with 1 N NaOH (3 x 10 ml), water (10 ml), and brine (10 ml), dried over Na2SO4, and concentrated in vacuo to afford the diethyl phosphonate 30 as a white solid (65 mg, yield 64%). Rf : 0.67 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 8H), 7.21 (d, J = 7.1, 2H), (m, 2H) 4.98 (d, J = 9.3 HZ, 1H), (m, 4H), (m, 1H), (m, 1H) (Figure 81). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 82). 19 F NMR (565 MHz, 298 K, CDCl3): δ (t, J = 7.9, 3F), (t, J = 7.4, 3F) (Figure 83). ESI-MS: m/z calcd for [M+Na] + C20H20F6NNaO5P found (100%); calcd for [2M+Na] + C40H40F12N2NaO10P found (Figure 84). 129

162 Bis(2,2,2-trifluoroethyl) (1-amino-2-phenylethyl)phosphonate H2N-Phe P -(OCH2CF3)2 (26) Synthesized according to General Procedure 4 (colorless oil, used without purification to next step). Rf : 0.27 (Hexanes/EtOAc, 6:4) ESI-MS: m/z calcd for [M+Na] + C12H14F6NaO3P found (Figure 85). Tert-butyl (1-((1-(bis(2,2,2-trifluoroethoxy)phosphoryl)-2-phenylethyl)amino)-1- oxo-3-phenylpropan-2-yl)carbamate Boc-Phe-Phe P -(OCH2CF3)2 (27) Synthesized according to General Procedure 4 (white solid, yield 50% for two steps). Rf : 0.51 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 9H), 7.10 (d, J = 7.2 Hz, 1H), 7.03 (d, J = 7.0 Hz, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 2H), (m, 2H), (m, 4H), 1.37 (s, 9H) (Figure 86). 31 P NMR (243 MHz, 298 K, CDCl3): δ (minor), (major), (major) (Figure 87). ESI-MS: m/z calcd for [M+Na] + C26H31F6N2NaO6P found (Figure 88). 2-(4-hydroxyphenethyl)isoindoline-1,3-dione HO-Tya-N-Pht (29) The stirred mixture of tyramine (329 mg, 2 mmol, 1 eq.) and phthalic anhydride (296 mg, 2 mmol, 1 eq.) in aq AcOH (2.5 ml 1 M) was heated to reflux overnight. Water was added, and the product was precipitated, filtered, and washed with water. The residue was solved in MeOH, dried over Na2SO4, and concentrated in vacuo to give the phthalimido-protected tyramine 29 as a brown solid (480 mg, yield 90%). 130

163 Rf : 0.5 (CHCl3/MeOH, 95:5). 1 H NMR (600 MHz, 298 K, DMSO-d6): δ 7.77 (s, 4H), 6.91 (d, J = 8.4 Hz, 2H), 6.57 (d, J = 8.4 Hz, 2H), 3.74 (t, J = 7.0 Hz, 2H), 2.76 (t, J = 7.0 Hz, 2H) (Figure 89). ESI-MS: m/z calcd for [M+Na] + C16H14NNaO found (100%), calcd for [2M+Na] + C32H26N2NaO found (Figure 90). Benzyl (1-(diethoxyphosphoryl)-2-phenylethyl)carbamate Z-Phe P -(OEt)2 (30) The stirred solution of DPP 7 (487 mg, 1 mmol, 1 eq), potassium fluoride dihydrate (940 mg, 10 mmol, 10 eq.), and a catalytic amount of 18-crown-6 (20 mg) in EtOH (5 ml) was heated to reflux for 10 min and then left to cool in ambient temperature overnight. The solvent was removed in vacuo, and water (20 ml) was added, followed by extraction with ethyl acetate (3 x 10 ml). The combined organic extracts were washed with 1 N NaOH (3 x 10 ml), water (10 ml), and brine (10 ml), dried over Na2SO4, and concentrated in vacuo to afford the diethyl phosphonate 30 as colorless oil (190 mg, yield 49%). Rf : 0.18 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 10H), 5.07 (d, J = 9.8 Hz, 1H), 4.99 (s, 2H), (m, 1H), (m, 4H), (m. 1H), (m, 1H), 1.29 (t, J = 7.0 Hz, 3H), 1.23 (t, J = 7.0 Hz, 3H) (Figure 91). 13 C NMR (151 MHz, 298 K, CDCl3): δ 155.7, 136.6, 136.5, 136.3, 129.2, 128.4, 128.1, 127.9, 126.8, 66.9, 62.8, 62.7, 62.5, 62.5, 49.1, 48.1, 36.0, 16.4, 16.3 (Figure 92). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 93). ESI-MS: m/z calcd for [M+Na] + C20H26NNaO5P , found , calcd for [2M+Na] + C40H52N2NaO10P found (100%) (Figure 94). Benzyl (1-(chloro(ethoxy)phosphoryl)-2-phenylethyl)carbamate Z-Phe P -(OEt)Cl (31) To a stirred solution of diethyl phosphonate 30 (194 mg, 0.5 mmol, 1 eq.) in DCM (0.5 ml), a DMF drop was added. The solution cooled to 0 o C, and oxalyl chloride (0.127 ml, 1.5 mmol, 3 eq.) was added dropwise. The mixture was warmed to ambient temperature, and the reaction was monitored with TLC. When 30 was consumed (16 131

164 hours), the solvent was removed in vacuo, DCM added (2 x 5 ml), and evaporated. The residue was used directly to the following reaction without further purification. Rf : 0.26 (CHCl3/MeOH, 9:1). Tert-butyl (1-((1-(diethoxyphosphoryl)-2-phenylethyl)amino)-1-oxo-3- phenylpropan-2-yl)carbamate Boc-Phe-Phe P -(OEt)2 (32) The stirred solution of DPP 9 (15 mg, mmol, 1 eq), potassium fluoride dihydrate (24 mg, 0.25 mmol, 10 eq.), and a catalytic amount of 18-crown-6 (2 mg) in EtOH (2 ml) was heated to reflux for 10 min and then left to cool in ambient temperature overnight. The solvent was removed in vacuo, and water (10 ml) was added, followed by extraction with ethyl acetate (3 x 10 ml). The combined organic extracts were washed with 1 N NaOH (3 x 10 ml), water (10 ml), and brine (10 ml), dried over Na2SO4, and concentrated in vacuo to afford the diethyl phosphonate 32 as colorless oil (7 mg, yield 58%). Rf : 0.13 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 10H), (m, 1H), 4.99 (m, 1H), (m, 1H), 4.28 (br s, 1H), (m, 4H), (m, 1H), (m, 3H), 1.37 (s, 9H), 1.28 (t, J = 13.8 Hz, 3H), 1.24 (t, J = 13.8 Hz, 3H) (Figure 95). 31 P NMR (243 MHz, 298 K, CDCl3): δ (minor), (major), (Figure 96). ESI-MS: m/z calcd for [M+Na] + C26H37N2NaO6P found (100%), calcd for [M+K] + C26H37KN2O6P + 543,20 found (Figure 97). Tert-butyl 4-hydroxyphenethylcarbamate HO-Tya-NH-Boc (34) To a stirred solution of tyramine (274 mg, 2 mmol, 1 eq.) in dioxane/water (1:1, 10 ml), sodium carbonate (212 mg, 2 mmol, 1 eq.) was added in one portion. The mixture was cooled at 0 o C, and di-tert-butyl dicarbonate (0.5 ml, 2.2 mmol, 1.1 eq.) was added. The 132

165 reaction mixture was left to warm at an ambient temperature one hour later, and ethyl acetate (20 ml) was added. The mixture was washed with 5% aqueous citric acid (2 x 15 ml), water (15 ml), 5% NaHCO3 (15 ml), and brine (15 ml). The organic layer was dried over Na2SO4, concentrated in vacuo, and the crude product was purified by column chromatography on silica gel (hexanes/ethyl acetate 20%-50%) to give the desired Bocprotected tyramine 34 as a colorless oil converted to white solid over several days (460 mg, yield 97%). Rf : 0.23 (Hexanes/EtOAc, 6:4); 0.44 (CHCl3/MeOH, 9:1). 1 H NMR (600 MHz, 298 K, CDCl3): δ 6.99 (d, J = 8.2, 2H), 6.79 (d, J = 8.4, 2H), 4.70 (s, 1H), (m, 2H), (m, 2H), 1.45 (s, 9H) (Figure 98). ESI-MS: m/z calcd for [M+Na] + C13H19NNaO , found (100%) (Figure 92). Benzyl (1-((4-(2-tert-butyl carbonyl aminoethyl)phenoxy)(ethoxy)phosphoryl)-2- phenylethyl)carbamate Z-Phe P -(OEt)(OTya-Boc) (35) To a stirred solution of chloride 31 (290 mg, 0.76 mmol, 1 eq.) in toluene (2 ml), HO-Tya-Boc (450 mg, 1.9 mmol, 2.5 eq.), and triethylamine (0.264 ml, 1.9 mmol, 2.5 eq.) were added. The mixture was stirred at ambient temperature overnight. Then diethyl ether (5 ml) and brine (10 ml) were added. The organic layer was washed with 5% NaHCO3 (4 x 5 ml), dried (Na2SO4), filtered in celite, and the solvents were removed at reduced pressure. The crude product was purified in column chromatography (Hexanes/Ethyl acetate 80% to 60%) to afford 35 as a white solid (50 mg, 11%). Rf : 0.33 (Hexanes/EtOAc, 1:1). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 10H), (m, 4H), 5.16 (t, J = 10.8, 1H), 5.03 & 4.99 (d, JAB = 24.8, 2H), (m, 2H), (m, 3H), (m, 1H), (m, 2H), 1.45 (s, 9H), (m, 3H) (Figure 100). 133

166 13 C NMR (151 MHz, 298 K, CDCl3): δ 155.8, 155.7, 136.2, 130.1, 129.9, 129.3, 129.3, 128.5, 128.4, 128.1, 128.0, 127.9, 127.8, 126.9, 120.6, 120.4, 79.3, 67.1, 67.0, 63.7, 63.6, 63.5, 49.6, 48.5, 48.3, 41.7, 36.0, 35.4, 28.4, 16.3, 16.2 (Figure 101). 31 P NMR (243 MHz, 298 K, CDCl3): δ 20.84, (Figure 102). ESI-MS: m/z calcd for [M+Na] + C31H39N2NaO7P found (100%), calcd for [M+K] + C31H39N2KO7P found (Figure 103). Tert-butyl 4-(((1-amino-2- phenylethyl)(ethoxy)phosphoryl)oxy)phenethylcarbamate H2N-Phe P -(OEt)(OTya-Boc) (36) To the mixture of Z-Phe P -(OEt)(OTya-Boc) (35) (50 mg, 86 μmol, 1 eq.) and 10% Pd-C (10 mg, 20%) in MeOH (0.5 ml) was added triethylsilane (140 μl, 860 μmol, 10 eq.) dropwise under nitrogen atmosphere. When the reaction was complete, the mixture was filtered through celite, and solvents evaporated in vacuo. The crude oil was used without further purification. Rf : 0.08 (Hexanes/EtOAc, 6:4). ESI-MS: m/z calcd for C23H34N2O5P + [M+H] , found (Figure 104). N-(Carbobenzyloxy)-L-phenylalanine Ζ-Phe-ΟΗ (38) To a stirred solution of L-phenylalanine (330 mg, 2 mmol) and sodium bicarbonate (168 mg, 2 mmol, 1 eq.) in acetone/water (1:1, 6 ml) N-(Benzyloxycarbonyloxy)- succinimide (500 mg, 2 mmol, 1 eq.) was added. The reaction mixture was left overnight at ambient temperature. Acetone was removed in vacuo, and ph was adjusted to 2.5 with 1 N HCl. The mixture was extracted with DCM (3 x 2 ml), and the combined organic layers washed with water (5 ml), dried over Na2SO4, and concentrated in a rotavap. The desired 38 afforded as a white solid after crystalization (420 mg, 70%). Rf : 0.56 (CHCl3/MeOH, 9:1). 134

167 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 8H), 7.17 (d, J = 7.0 Hz, 2H), 5.28 (d, J = 8.0 Hz, 1H), (m, 2H), (m, 1H), (m, 1H) (m, 1H) (Figure 105). Tert-butyl 4-(((1-(2-fluorenylmethyloxycarbonylamino-3-phenylpropanamido)-2- phenylethyl)(ethoxy)phosphoryl)oxy)phenethylcarbamate Fmoc-Phe-Phe P -(OEt)(OTya-Boc) (39a) To the stirring solution of the amine H2N-Phe P -(OEt)(OTya-Boc) (36) (26 mg, 0.06 mmol, 1 eq.) in DCM (0.5 ml), Fmoc-Phe-OH (28 mg, mmol, 1.2 eq) was added, followed by the addition of TBTU (55 mg, mmol, 2.4 eq), HOBt (20 mg, mmol, 2.4 eq.), and DIPEA (30 μl, 0.18 mmol, 3 eq). The mixture was allowed to stir at ambient temperature, and DIPEA was added if necessary to maintain alkaline ph. When the amine 36 was consumed, the mixture was concentrated, ethyl acetate (10 ml) was added, and the mixture was washed with H2O (4x), NaHCO3 (5%, 3x), H2O, aqueous citric acid (10%, 3x), H2O and brine. The solvents were removed in reduced pressure, and the crude peptide was purified in column chromatography (Hexanes/Ethyl acetate 80% to 60%) to afford 39a as a white solid (20 mg, 40%). Rf : 0.22 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 2H), (m, 2H) (m, 2H), (m, 16H), (m, 1H), (m, 1H), (m, 2H), (m, 6H), (m, 3H), (m, 5H), 1.44 (s, 9H), (m, 3H) (Figure 106). 13 C NMR (151 MHz, 298 K, CDCl3): δ 170.5, 170.4, 155.8, 149.0, 148.9, 148.7, 148.6, 143.7, 141.2, 136.0, 135.9, 130.0, 129.9, 129.2, 129.1, 128.7, 128.6, 128.5, 128.4, 128.3, 127.8, 127.7, 127.0, 126.9, 125.0, 124.9, 120.7, 120.6, 120.5, 120.4, 120.3, 120.2, 119.9, 67.2, 67.1, 63.8, 63.7, 63.6, 53.4, 47.0, 41.7, 35.7, 35.4, 29.7, 28.4, 16.3, 16.2, 16.1, 0.9 (Figure 107). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), 20.21, (Figure 108). 135

168 ESI-MS: m/z calcd for [M+Na] + C47H52N3NaO8P , found , calcd for [(M+2H)/2] found (100%) (Figure 109). Tert-butyl 4-(((1-(2- benzyloxycarbonylamino-3-phenylpropanamido)-2- phenylethyl)(ethoxy)phosphoryl)oxy)phenethylcarbamate Z-Phe-Phe P -(OEt)(OTya-Boc) (39b) To the stirring solution of the amine H2N- Phe P -(OEt)(OTya-Boc) (36) (38 mg, mmol, 1 eq.) in 1 ml DCM Z-Phe-OH (62 mg, mmol, 1.2 eq) was dissolved, followed by the addition of TBTU (78 mg, mmol, 2.4 eq), HOBt (27 mg, mmol, 2.4 eq.), and DIPEA (44 μl, mmol, 3 eq). The mixture was allowed to stir at ambient temperature, and DIPEA was added if necessary to maintain alkaline ph. When the DPP amine 36 was consumed, the mixture was concentrated, ethyl acetate (10 ml) was added, and the mixture was washed with H2O (4 x 10 ml), NaHCO3 (5%, 3 x 10 ml), H2O (10 ml), aqueous citric acid (10%, 3 x 10 ml), H2O (10 ml) and brine (10 ml). The organic layer dried (Na2SO4), and the solvents were removed in reduced pressure. The crude peptide was purified in column chromatography (hexanes/ethyl acetate 80% to 60%) to give 39b as a white solid (30 mg, 47% for two steps). Rf : 0.54 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 19H), 6.98 (d, J = Hz, 1H), (m, 1H), (m, 2H), 4, (m, 1H), (m, 1H), (m, 1H), ( (m, 2H), (m, 3H), (m, 5H), 1.45 & 1.44 (isomers) (s, 9H) (Figure 110). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), 20.37, (Figure 111). ESI-MS: m/z calcd for [M+Na] + C40H48N3NaO8P + 752,31 found (100%), calcd for [M+K] + C40H48KN3O8P + 768,28 found (Figure 112). 136

169 Tert-butyl 4-(((1-(2-amino-3-phenylpropanamido)-2-phenylethyl)(ethoxy) phosphoryl)oxy)phenethylcarbamate H2N-Phe-Phe P -(OEt)(OTya-Boc) (40) To the mixture of Z-Phe-Phe P -(OEt)(OTya-Boc) (39b) (20 mg, 27 μmol, 1 eq.) and 10% Pd-C (4 mg, 20%) in MeOH (0.5 ml) was added triethylsilane (44 μl, 270 μmol, 10 eq.) dropwise under nitrogen atmosphere. When the reaction was complete, the mixture was filtered through celite, and solvents evaporated in vacuo. The crude oil was used without further purification. Rf : 0.08 (hexanes/etoac, 6:4). ESI-MS: m/z calcd for [M+H] + C32H43N3O6P , found (Figure 113). 1-(6-((1-((1-((4-(2-((tert-butoxycarbonyl)amino)ethyl)phenoxy)(ethoxy) phosphoryl)-2-phenylethyl)amino)-1-oxo-3-phenylpropan-2-yl)amino)-6- oxohexyl)-3,3-dimethyl-2-((1e,3e,5e)-5-(1,3,3-trimethylindolin-2-ylidene)penta- 1,3-dien-1-yl)-3H-indol-1-ium Cy5-Phe-Phe P -(OEt)(OTya-Boc) (41) To a solution of 40 (8 mg, 13 μmol, 1 eq.) in 150 μl DMSO, a solution of Cy5-NHS (10 mg, 15.6 μmol, 1.2 eq.) in 150 μl DMSO was added, followed by the addition of 11 μl DIPEA (8.5 μmol, 5 eq.). The reaction was monitored with HPLC till 40 was consumed. After 16h, purification by HPLC (semi-preparatory reverse phase C18 column, CH3CN/H2O + 0.1% TFA, 20% for 5 min; 20:80 to 100% over 40 min, 1 ml/min) followed by lyophilization, afforded pure product 41 as a blue powder (3.7 mg, yield 25% for two steps). tr: peak 1: min (70.66% B), peak 2: min 71.15% (stereoisomers) (Figure 114). 137

170 ESI-MS: calcd for [M] + C64H79N5O7P + : found (100%), calcd for [M+Na] 2+ /2 C64H79N5NaO7P found (Figure 115). Both HPLC peaks give the same ESI-MS. 1-(6-((1-((1-((4-(2-aminoethyl)phenoxy)(ethoxy)phosphoryl)-2-phenylethyl)amino)-1- oxo-3-phenylpropan-2-yl)amino)-6-oxohexyl)-3,3-dimethyl-2-((1e,3e,5e)-5-(1,3,3- trimethylindolin-2-ylidene)penta-1,3-dien-1-yl)-3h-indol-1-ium Cy5-Phe-Phe P -(OEt)(OTya-NH2) (42) To a stirred solution of 41 (2 mg, 1.7 μmol, 1 eq.) in 0.1 ml DCM added dropwise 0.1 ml TFA. After 2 h, toluene was added (3 0.3 ml), and the mixture was co-evaporated in vacuo on a rotavap to dryness. The crude amorphous solid was used in the next step without further purification. tr: peak 1: 23.08min (56.10% B); peak 2: min (56.57% B) (stereoisomers) (Figure 116). ESI-MS: m/z calcd for [M] + C59H71N5O5P found , calcd for [(M+H)/2] found (100%) (Figure 117). 1-(6-((1-((1-(ethoxy(4-(2-(1-((2-((E)-3-(indolin-1-ium-1-ylidene)-6-(indolin-1-yl)-3H- xanthen-9-yl)phenyl)sulfonyl)piperidine-4-carboxamido)ethyl)phenoxy)phosphoryl)- 2-phenylethyl)amino)-1-oxo-3-phenylpropan-2-yl)amino)-6-oxohexyl)-3,3-dimethyl-2- ((1E,3E,5E)-5-(1,3,3-trimethylindolin-2-ylidene)penta-1,3-dien-1-yl)-3H-indol-1-ium Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43) To a solution of 42 (2 mg, 1.7 μmol, 1 eq.) in DMSO (50 μl), a solution of QSY21- NHS (1.6 mg, 1.91 μmol, 1.1 eq.) in DMSO (50 μl) was added, followed by the addition of DIPEA (1.5 μl, 8.5 μmol, 5 eq.). The reaction was monitored with HPLC till 42 was consumed. After 16 hours, purification by HPLC (semi-preparatory reverse phase C18 column, CH3CN/H2O + 0.1% TFA, 20% for 5 min; 20:80 to 100% over 40 min, 1 ml/min) followed by lyophilization, afforded pure product 43 as a dark blue powder (1.9 mg, yield 65% for two steps). 138

171 tr: peak 1: min (69.48% B), peak 2: min (69.95% B) (stereoisomers) (Figure 118). ESI-MS: m/z calcd for [M] 2+ /2 C100H105N8O9PS found (100%), calcd for [M+H] 3+ / found (Figure 119). Fmoc-His(Clt)-Ile-Val-chlorotrityl resin (52) Synthesized on a H-L-Val-2- chlorotrityl resin (200 mg, 0.7 mmol/g). Each coupling performed in DMF with Fmoc- amino acids (2 eq.) and TBTU/HOBt (3 eq.) as coupling reagent in the presence of DIPEA (6 eq.). Each coupling was tested with the Kaiser test. Fmoc-deprotection was performed with 20% piperidine in DMF. Fmoc-His(Clt)Ile-Val-OH (53) The mixture of Fmoc-His(Clt)-Ile-Val-chlorotrityl resin (52) (33 mg) in AcOH/TFE/DCM (2:2:3, 2 ml) was stirred for 2 h, then filtered and diluted with 30 ml Hex, and the solvents were removed in vacuo. The residue was triturated with cold ether and left at -20 o C to precipitate 53 as a white solid (9 mg, yield 69%) Rf : 0.46 (Tol/MeOH/AcOH, 7:1.5:1.5). 139

172 1 H NMR (600 MHz, 298 K, CDCl3): δ 7.88 (s, 1H), 7.78 (d, J = 7.3 Hz, 2H) 7.59 (d, J = 7.9 Hz, 2H), (m, 14H), (m, 5H), (m, 1H), (m, 2H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 2H), (m, 3H), (m, 9H) (Figure 120). 5-(sec-butyl)-8-((1-((2-chlorophenyl)diphenylmethyl)-1H-imidazol-4-yl)methyl)- 2-isopropyl-4,7,10,26-tetraoxo-30-((4R)-2-oxohexahydro-1H-thieno[3,4- d]imidazol-4-yl)-13,16,19,22-tetraoxa-3,6,9,25-tetraazatriacontan-1-oic acid Biotin-dPEG 4-His(Clt)Ile-Val-OH (56) Deprotection of the synthesized 52 with 20% piperidine in DMF gave the N-deprotected peptide resin. A mixture of biotin-dpeg 4-TFP ester (100 mg, 0.15 mmol, 2eq.), HOBt (42 mg, 0.15 mmol, 2 eq.) and DIPEA (36 μl, 0.21 mmol, 6 eq.) in DMSO was added and left overnight. The mixture was filtered, and the resin was washed with DMF (3 times), DCM (3 times), and isopropanol (3 times). To a round bottom flask with the dried resin, a mixture of trifluoroethanol in DCM (20%) was added, the mixture was stirred for 1 h, filtered, and diethyl ether was added. The desired protected biotinylated peptide 56 has participated as a white solid (76 mg, yield 49% overall for 6 steps). Rf : 0.16 (CHCl3/MeOH, 9:1). 140

173 tr: min (48.10% B) (C18 column, solvent A: H2O + 0.1% TFA, solvent B CH3CN + 0.1% TFA, 20% B for 5 min; 20:80 to 100% over 40 min, 1 ml/min) (Figure 121). 1 H NMR (600 MHz, 298 K, CDCl3): δ 8.10 (bs, 1H), 7.75 (bs, 1H), 7.68 (bs, 1 H), (m, 14 H), 6.90 (d, J = 7.6 Hz, 1H), 6.85 (bs, 1H), 6.64 (s, 1H), 6.37 (bs, 1H), 5.83 (bs, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 2H), (m, 2H), (m, 13H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 1H), (m, 2H), (m, 1H), (m, 2H), (m, 2H), (m, 1H), (m, 1H), (m, 9H), (m, 3H), (m, 9H) (Figure 122). 13 C NMR (151 MHz, 298 K, CDCl3): δ , 174.8, 173.5, 173.4, 171.9, 171.6, 171.6, 171.2, 164.9, 164.5, 140.3, 140.1, 140.0, 138.0, 136.8, 135.5, 132.2, 130.5, 130.0, 128.3, 128.1, 127.2, 125.2, 119.7, 75.5, 70.6, 70.4, 70.3, 70.2, 70.1, 70.0, 69.9, 69.8, 67.4, 67.2, 62.0, 61.2, 61.0, 60.4, 60.3, 58.9, 57.9, 57.8, 55.5, 55.3, 53.7, 40.4, 40.3, 39.2, 39.1, 37.0, 36.8, 36.5, 36.4, 35.7, 35.6, 30.8, 30.7, 30.2, 28.2, 28.1, 28.0, 27.9, 25.4, 24.9, 19.2, 19.1, 18.0, 17.9, 15.7, 15.4, 11.3, 10.9 (Figure 123). ESI-MS: m/z calcd for [M+H] + C57H78ClN8O11S found (100%), calcd for [M+Na] + C57H77ClN8NaO11S found , calcd for [(M+Na+H)/2] found (Figure 124). Tert-butyl (4-hydroxybutyl)carbamate Boc-Bu-OH (59) To a stirred solution of 4-aminobutan-1-ol (0.3 ml, 2.87 mmol) in DCM (3 ml), Boc anhydrite (0.63 ml, 287 mmol, 1 eq) was added, and the mixture was stirred at 0 o C for 30 min and 2 h at ambient temperature. A portion of 1 N HCl was added (3 ml), and the organic layer was washed with 1 N HCl (2 ml), 10% NaHCO3 (2 ml), and brine/water 1:1 (2 ml), dried over Na2SO4, and the solvents were removed in vacuo to give 59 as colorless oil (400 mg, yield 74%). Rf : 0.17 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ 3.63 (t, J = 6.0 Hz, 2 H), 3.12 (t, J = 6.6 Hz, 2 H), (m, 4H), 1.41 (s, 9H) (Figure 125). 141

174 2-(4-hydroxybutyl)isoindoline-1,3-dione Pth-Bu-OH (62) The mixture of 4-aminobutan-1-ol (0.46 ml, 5 mmol) and phthalic anhydride (740 mg, 5 mmol, 1 eq.) was heated for 30 min in an open flask to 145 o C. Water vapor was expelled with a stream of nitrogen. The reaction residue dried on a vacuum pump to give the protected amine 62 as a colorless oil turned in a white solid after several days (770 mg, yield 70%). Rf : 0.55 (CHCl3/MeOH, 95:5). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 4H), 3.73 (t, J = 7.2 Hz, 2H), 3.69 (t, J = 6.4 Hz, 2H), 2.27 (brs, 1H), 1.78 (quint, J = 7.4 Hz, 2H), 1.61 (quint, J = 6.5 Hz, 2H) (Figure 126). 4-(1,3-dioxoisoindolin-2-yl)butanal Pth-Pr-CHO (63) To a stirred solution of 62 (2,250 mg, mmol) in DCM (40 ml) with molecular sieves (2,000 mg), pyridinium chlorochromate (6,450 mg, 30 mmol, 3 eq.) was added. The reaction was monitored with TLC, and when 62 was consumed, the mixture was filtered in silica gel, washed with EtOH, and solvents removed in vacuo to give 4-phthalimidobutanal 63 as a colorless oil (1,292 mg, yield 58%). Rf : 0.66 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ 9.77 (s, 1H), 7.84 (dd, J = 5.3 Hz, J = 3.0 Hz, 2H), 7.72 (dd, J = 5.3 Hz, J = 3.0 Hz, 2H), 3.74 (t, J = 6.8 Hz, 2H), 2.53 (t, J = 7.2 Hz, 2H), (m, 2H) (Figure 127). Benzyl (4-(1,3-dioxoisoindolin-2-yl)-1-(diphenoxyphosphoryl)butyl)carbamate Z-Orn P (Pht)-(OPh)2 (64) Synthesized according to General Procedure 1 and General Procedure 2 using 4- phthalimidobutanal 63 as starting material (white solid, yield 43% and 58%, respectively). 142

175 Rf : 0.26 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ (m, 2H), (m, 2H), (m, 13H), 7.09 (d, J = 8.0 Hz, 2H) 5.23 (d, J = 10.2 Hz, 1H), (m, 2H), (m, 1H), (m, 2H), (m, 1H, (m, 1H), (m, 2H) (Figure 128). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 129). ESI-MS: m/z calcd for [M+H] + C32H29N2NaO7P found , calcd for [M+Na] + C32H29N2NaO7P found (100%), calcd for [2M+Na] + C64H58N4NaO14P found (Figure 130). Benzyl (4-amino-1-(diphenoxyphosphoryl)butyl)carbamate Z-Orn P -(OPh)2 (65) To a stirring solution of phthalimido-protected Z- Orn P (Pht)-(OPh)2 (64) (30 mg, mmol) in hot isopropanol (0.5 ml, 60 o C), hydrazine (5 μl, mmol, 3 eq.) in isopropanol (0.1 ml) was added dropwise via a syringe. After 2 hours, the mixture was filtered, the solvent was evaporated, and CHCl3 (10 ml) was added. The chloroform layer was washed with brine (4 x 10 ml), dried over Na2SO4, and concentrated in vacuo. The oily residue was used for the following reaction without further purification (20 mg, yield 77%). Rf : 0.08 (Hexanes/EtOAc, 6:4). ESI-MS: m/z calcd for [M+H] + C24H28N2O5P found (Figure 131). Benzyl (4-(bis-butyloxycarbonyl)-amino-1-(diphenoxyphosphoryl)butyl)carbamate Z-Arg P (Boc)2-(OPh)2 (66) To a solution of N,N -Bis(tert-butoxycarbonyl)-S-methylisothiourea (119 mg, 0.41 mmol) in DMF (1.5 ml) was added Z-Orn P -(OPh)2 (65) (185 mg, 0.41 mmol, 1 eq.) and DMAP (52 mg, 0.45 mmol, 1.1 eq.). The mixture was stirred overnight until isothiuria was consumed. The mixture was diluted with EtOAc (50 ml), washed with 10% aqueous citric acid (3 x 10 ml), 5% NaHCO3 (3 x 10 ml), water (10 ml), and brine (10 143

176 ml), dried over Na2SO4, concentrated in vacuo, and purified by column chromatography (Hexane/EtOAc, pure Hex to 6:1) to give the desired Z-Arg P (Boc)2-(OPh)2 as a colorless oil (195 mg, yield 68%). Rf : 0.36 (Hexanes/EtOAc, 6:4). 1 H NMR (600 MHz, 298 K, CDCl3): δ 8.36 (br s, 1H), (m, 13H), 7.08 (d, J = 8.0 Hz, 2H), 5.59 (d, J = 10.1 Hz, 1H), (m, 2H AB), (m, 1H), (m, 2H), (m, 1H), (m, 4H), 1.49 (s, 9H), 1.46 (s, 9H) (Figure 132). 31 P NMR (243 MHz, 298 K, CDCl3): δ (major), (Figure 133). ESI-MS: m/z calcd for [M+H] + C35H46N4O9P found (100%), calcd for [M+Na] + C35H45N4NaO9P found (Figure 134). Benzyl (1-(diphenoxyphosphoryl)-4-guanidinobutyl)carbamate Z-Arg P -(OPh)2 (67) Synthesized according to General Procedure 6 using 66 as starting material (colorless oil, quant.). ESI-MS: m/z calcd for [M+H] + C25H30N4O5P found (Figure 135). Diphenyl (1,4-(bis-(tert-butyloxycarbonyl)guanidino)-diaminobutyl)phosphonate H2N-Arg P (Boc)2-(OPh)2 (68) Synthesized according to General Procedure 4 using Z-Arg P (Boc)2-(OPh)2 (66) as starting material and used without further purification (oil). Rf : on spot (Hexanes/EtOAc, 6:4). tr: min (38.73% B) (C18 column, solvent A: H2O + 0.1% TFA, solvent B CH3CN + 0.1% TFA, 20% B for 5 min; 20:80 to 100% over 40 min, 1 ml/min) (Figure 136). 144

177 ESI-MS: m/z calcd for [M-Boc+H] + C22H32N4O5P found , calcd for [M+H] + C27H40N4O7P found (100%) (Figure 137). Diphenyl (1,4-diaminobutyl)phosphonate H2N-Arg P -(OPh)2 (69) Synthesized according to General Procedure 6 using 68 as starting material (colorless oil, quant.) Rf : on the spot (Hexanes/EtOAc, 6:4) ESI-MS: m/z calcd for [M-Cl] - C17H23ClN4O3P found (Figure 138). Diphenyl (15-(((2-chlorophenyl)diphenylmethyl)-1H-imidazol-4-yl)methyl)-1- amino-12-(sec-butyl)-1-imino-9-isopropyl-8,11,14,17,33-pentaoxo-37-((4r)-2- oxohexahydro-1h-thieno[3,4-d]imidazol-4-yl)-20,23,26,29-tetraoxa- 2,7,10,13,16,32-hexaazaheptatriacontan-6-yl)phosphonate Biotin-dPEG 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70) To solution of biotin-dpeg 4-His(Clt)Ile-Val-OH (56) (6 mg, 5.4 μmol, 1.1. eq.) in DCM (0.3 ml) was added H2N-Arg P (Boc)2-(OPh)2 (68) (2.7 mg, 4.5 μmol, 1 eq.), TBTU (4.1 mg, 10.8 μmol, 2.4 eq.), HOBt (1.44 mg, 10.8 μmol, 2.4 eq.) and DIPEA (2μL, 13.5 μmol, 3 eq.). The mixture stirred overnight at ambient temperature, concentrated in vacuo. Semipreparative RP-HPLC and lyophilization of appropriate fragments gave the desired of biotin-dpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70) as a white solid (3 mg, yield 40% for two steps). 145

178 tr : min (55.87% B) (C18 column, solvent A: H2O + 0.1% TFA, solvent B CH3CN + 0.1% TFA, 20% B for 5 min; 20:80 to 100% over 40 min, 1 ml/min). ESI-MS: m/z calcd for [M+H] + C84H115ClN12O17PS found , calcd for [(M+2H)/2] , found (Figure 139). Diphenyl (15-((1H-imidazol-4-yl)methyl)-1-amino-12-(sec-butyl)-1-imino-9-isopropyl- 8,11,14,17,33-pentaoxo-37-((4R)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)- 20,23,26,29-tetraoxa-2,7,10,13,16,32-hexaazaheptatriacontan-6-yl)phosphonate Biotin-dPEG 4-His-Ile-Val-Arg P -(OPh)2 (71) Biotin-dPEG 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70) was dissolved in Reagent B (TFA/phenol/water/TIPS, 88:5:5:2) and stirred for 2 hours. Purification by semipreparative RP-HPLC and lyophilization gave the desired fully deprotected ABP 71. ESI-MS: m/z calcd for [M+H] + C55H86N12O13PS found , calcd for [(M/2)+H] found (Figure 140). 146

179 Spectra and data of all synthesized compounds Ar a,b * *Solvent impurities * * Figure 53: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OPh)2 (7). Figure 54: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OPh)2 (7). 147

180 Figure 55: ESI-MS of compound Z-Phe P -(OPh)2 (7). 7 5a,b Ar Ar Ar Ar 6 2a,b Ar 3 DCM MeOH 2b a 5a 5b * *accidental contaminants of our CDCl 3 Figure 56: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OPh)2 (9). 148

181 Figure 57: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OPh)2 (9). Figure 58: 31 P NMR (243 MHz, 298 K, CDCl3)of compound Boc-Phe-Phe P -(OPh)2 (9). 149

182 Figure 59: ESI-MS of compound Boc-Phe-Phe P -(OPh)2 (9). Figure 60: ESI-MS of crude compound H2N-Phe-Phe P -(OPh)2 (10) a,b 1 Ar Ar H 2 O MeOH Ar 4a,b Ar Ar a 6 6 2b 4a 4b * * * * *DIPEA Figure 61: 1 H NMR (600 MHz, 298 K, CD3OD) of compound biotin-x-x-phe-phe P - (OPh)2 (11). 150

183 Figure 62: 31 P NMR (243 MHz, 298 K, CD3OD) of compound biotin-x-x-phe-phe P - (OPh)2 (11). Figure 63: ESI-MS of compound biotin-x-x-phe-phe P -(OPh)2 (11). 151

184 Ar Ar Ar Ar Ar * *Solvent contaminants Figure 64: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phg P -(OPh)2 (13). Figure 65: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phg P -(OPh)2 (13). 152

185 Figure 66: ESI-MS of compound Z-Phg P -(OPh)2 (13). Ar Ar Ar 6 Ar 5 Ar 5 *Solvent contaminants * * * Figure 67: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15). 153

186 Figure 68: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15). Figure 69: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phg P -(OPh)2 (15). 154

187 Figure 70: ESI-MS of compound Boc-Phe-Phg P -(OPh)2 (15). Figure 71: ESI-MS of crude compound H2N-Phe-Phg P -(OPh)2 (16) a,b 1 Ar Ar Ar Ar Ar a, b 5 Figure 72: 1 H NMR (600 MHz, 298 K, CD3OD) of compound biotin-x-x-phe-phg P - (OPh)2 (11). 155

188 Figure 73: 31 P NMR (243 MHz, 298 K, CDCl3) of compound biotin-x-x-phe-phg P - (OPh)2 (17). Figure 74: ESI-MS of compound biotin-x-x-phe-phg P -(OPh)2 (17). 156

189 *Solvent contaminants Ar Ar Ar Ar Ar 5 * * * Figure 75: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Hph P -(OPh)2 (19). Figure 76: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Hph P -(OPh)2 (19). 157

190 Figure 77: ESI-MS of crude compound H2N-Hph P -(OPh)2 (20). 8 6a,b 5 7 Ar Ar 3 Ar 8 Ar *Solvent contaminants * Ar a, b * * Figure 78: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Hph P -(OPh)2 (21). 158

191 Figure 79: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Hph P -(OPh)2 (21). Figure 80 ESI-MS of compound Boc-Phe-Hph P -(OPh)2 (21). 159

192 S77C Ar Ar 4 1 2a,b 3 Ar 3 *Solvent contaminants 4 NH 1 3 2a 2b * * * Figure 81: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25). Figure 82: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25). 160

193 Figure 83: 19 F NMR (565 MHz, 298 K, CDCl3) of compound Z-Phe P -(OCH2CF3)2 (25). Figure 84: ESI-MS of compound Z-Phe P -(OCH2CF3)2 (25). Figure 85: ESI-MS of crude compound H2N-Phe P -( OCH2CF3)2 (26). The sample was taken before the end of the reaction. The reaction was left to proceed until the starting material 25 was consumed. 161

194 6 4a,b 3 Ar 1 2a,b 5b Ar 5a 6 Ar DCM *Solvent contaminants ** Ethyl acetate NH 1 3 5a 5b NH ** 2a,b 4a,b ** * ** * * Figure 86: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P - (OCH2CF3)2 (27). Figure 87: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P - (OCH2CF3)2 (27). 162

195 Figure 88: ESI-MS of compound Boc-Phe-Phe P -(OCH2CF3)2 (27) , Figure 89: 1 H NMR (600 MHz, 298 K, DMSO-d6) of compound HO-Tya-N-Pht (29) 163

196 Figure 90: ESI-MS of compound HO-Tya-N-Pht (29). Ar 4 5, a 1b * * *accidental contaminants of our CDCl 3 Figure 91: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30). 164

197 Figure 92: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30). Figure 93: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)2 (30). 165

198 Figure 94: ESI-MS of compound Z-Phe P -(OEt)2 (30). 4a,b a,b 6 5 * *accidental contaminants of our CDCl 3 Ar DCM 7,7 NH 3 NH 1 6 2a,b 4a,b Figure 95: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OEt)2 (32). 166

199 Figure 96: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Boc-Phe-Phe P -(OEt)2 (32). Figure 97: ESI-MS of compound Boc-Phe-Phe P -(OEt)2 (32). 167

200 DCM Figure 98: 1 H NMR (600 MHz, 298 K, CDCl3) of compound HO-Tya-NH-Boc (34). Figure 99: ESI-MS of compound HO-Tya-NH-Boc (34). 168

201 10 Ar *accidental contaminants of our CDCl 3 4 * 6 3 2, 9 5 8, 1b 1a 7 * Figure 100: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya- Boc) (35). Figure 101: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya- Boc) (35). 169

202 Figure 102: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe P -(OEt)(OTya- Boc) (35). Figure 103: ESI-MS of compound Z-Phe P -(OEt)(OTya-Boc) (35). 170

203 Figure 104: ESI-MS of crude compound H2N-Phe P -(OEt)(OTya-Boc) (36). Ar Ar Ar a,b Figure 105: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe-OH (38). 171

204 1 * *accidental contaminants of our CDCl Ar Ar Ar 9a,b 8 Ar 6 7a,b Ar Ar NH NH NH, 8, 10, 11 5, 6 2, 7a 3, 7b, 9a,b * * Figure 106: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a). Figure 107: 13 C NMR (151 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a). 172

205 Figure 108: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Fmoc-Phe-Phe P - (OEt)(OTya-Boc) (39a). Figure 109: ESI-MS of compound Fmoc-Phe-Phe P -(OEt)(OTya-Boc) (39a). 173

206 impurity * 1 Ar ΝΗ ΝΗ DCM ΝΗ 6 2, 7a 3, 7b, 9a, 9b Acetone EtOAc 4 *accidental contaminants of our CDCl 3 Figure 110: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Phe-Phe P - (OEt)(OTya-Boc) (39b). Figure 111: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Phe-Phe P - (OEt)(OTya-Boc) (39b). 174

207 Figure 112: ESI-MS of compound Z-Phe-Phe P -(OEt)(OTya-Boc) (39b). Figure 113: ESI-MS of crude compound H2N-Phe-Phe P -(OEt)(OTya-Boc) (40). mau Detector A Ch1:660nm B.Conc.(Method) % min Figure 114: Analytical HPLC of Cy5-Phe-Phe P -(OEt)(OTya-Boc) (41) 175

208 Figure 115: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-Boc) (41). mau Detector A Ch1:254nm B.Conc.(Method) % min Figure 116: Analytical HPLC of Cy5-Phe-Phe P -(OEt)(OTya-NH2) (42). Peak 1 Peak 2 Figure 117: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-NH2) (42). 176

209 mau Detector A Ch1:660nm 35 B.Conc.(Method) % min Figure 118: Analytical RP-HPLC of Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43). 0 Peak 1+2 Figure 119: ESI-MS of compound Cy5-Phe-Phe P -(OEt)(OTya-QSY21) (43). Ar 3 Ar Ar 9a,b 10 Ar 11 3 Ar Ar a, b Figure 120: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Fmoc-His(Clt)-Ile-Val- OH (53). 177

210 1750 mau Detector A:220nm B.Conc.(Method) % min Figure 121: Analytical RP-HPLC of biotin-dpeg 4-His(Clt)Ile-Val-OH (56) a,b Ar 10 Ar Ar Ar 3 ΝΗ ΝΗ 10 ΝΗ ΝΗ ΝΗ 17, 4, 8, , 13, 14, Figure 122: 1 H NMR (600 MHz, 298 K, CDCl3) of compound biotin-dpeg 4- His(Clt)Ile-Val-OH (56). 178

211 Figure 123: 13 C NMR (151 MHz, 298 K, CDCl3) of compound biotin-dpeg 4- His(Clt)-Ile-Val-OH (56). Figure 124: ESI-MS of compound biotin-dpeg 4-His(Clt)-Ile-Val-OH (56). 179

212 Figure 125: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Boc-Bu-OH (59) Ar 3 4 Ar Figure 126: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Pht-Bu-OH (62). 180

213 4 2 Ar Ar Figure 127: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Pth-Pr-CHO (63). DCM 6 Pth Ar Ar Ar Pth Ar a,b 5 Figure 128: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Orn P (Pht)-(OPh)2 (64). 181

214 Figure 129: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Orn P (Pht)-(OPh)2 (64). Figure 130: ESI-MS of compound Z-Orn P (Pht)-(OPh)2 (64). Figure 131: ESI-MS of compound Z-Orn P -(OPh)2 (65). 182

215 Ar Ar Ar Ar DCM 2 NH NH 1 5 NH 3, 4 Figure 132: 1 H NMR (600 MHz, 298 K, CDCl3) of compound Z-Arg P (Boc)2-(OPh)2 (66). Figure 133: 31 P NMR (243 MHz, 298 K, CDCl3) of compound Z-Arg P (Boc)2-(OPh)2 (66). 183

216 Figure 134: ESI-MS of compound Z-Arg P (Boc)2-(OPh)2 (66). Figure 135: ESI-MS of compound Z-Arg P -(OPh)2 (67). mau Detector A Ch1:214nm Detector A Ch2:254nm 1750 B.Conc.(Method) % min Figure 136: Analytical RP-HPLC of H2N-Arg P (Boc)2-(OPh)2 (68). Figure 137: ESI-MS of compound H2N-Arg P (Boc)2-(OPh)2 (68). 184

217 Figure 138: ESI-MS of compound H2N-Arg P -(OPh)2 (69). Figure 139: ESI-MS of biotin-dpeg 4-His(Clt)-Ile-Val-Arg P (Boc)2-(OPh)2 (70). Figure 140: ESI-MS of crude biotin-dpeg 4-His-Ile-Val-Arg P -(OPh)2 (71). 185

218

219 DISCUSSION 187

220

221 Proteases are controlled at multiple levels that include their synthesis as inactive zymogens, their activation that may take place by other proteases in a cascade manner or by autoactivation, and finally, inhibition of their activity by complex formation with endogenous inhibitors or by limited proteolysis by other proteases or autocatalytically that yield truncated or clipped inactivated proteins. Other factors like the ph, ionic strength, etc., can also alter the activity of proteases. Thus, only a fraction of a given protease is present in its active form in a biological or clinical specimen. Nevertheless, the functional roles of a given protease are mediated by its active form. Similarly, in disease states, it is the active form of an involved protease that is important in terms of pathology. Currently, antibody-based assays are employed in clinical laboratories by which the total amount of a given protein/enzyme can be determined, which include the intact zymogen, the active enzyme, complexes of the enzyme with inhibitors, but also clipped inactive forms of the enzyme and often alternatively spliced forms with no activity, which, however, are often recognized by antibodies. The inability to quantify the active form of a protease (or other enzymes) limits their diagnostic potential (Fredolini et al., 2016). Activity-based probes (ABPs) are small molecules that bind irreversibly to the active form of the enzyme and carry a specific tag that allows their detection. A major class of ABPs are the organophosphates that are suicide inhibitors of serine hydrolases, including serine proteases. Organophosphates are analogs of the transition state substrate hydrolysis reaction mediated by serine hydrolases. They covalently modify the active-site Ser of the protease. Initially, non-specific organophosphonofluoridates were developed as ABPs (Liu et al., 1999; Pampalakis et al., 2017). These compounds could effectively label serine hydrolases, including serine proteases, without any specificity. However, these molecules can be engineered to include a protease recognition sequence to increase the specificity towards certain serine protease classes (Serim et al., 2013). Building on this principle, two specific organophosphonate ABPs were designed and synthesized here that can specifically bind and label the active KLK7 and the active KLK6 enzymes, respectively. Specifically, we describe the design (by a simple in silico approach), synthesis, and validation in vitro and in vivo of an activitybased probe (ABP) and specific inhibitor for the kallikrein 7 (or KLK7) serine protease with both features accommodated in one chemical scaffold, as well as an ABP specific for KLK6. 189

222 To fish for new protease-specific recognition sequences, we used a new simple in silico approach that is based on searching the MEROPS database of protease and protease inhibitors. Using MEROPS, we unraveled the substrate specificity of KLK7 and KLK6, and we identified the peptides Phe-Phe (FF) and His-Ile-Val-Arg (HIVR) that appear specific for these proteases, respectively. The specificity was confirmed by a reciprocal search approach (Bisyris et al., 2021 submitted). These peptides were modified at their C-terminal to yield phosphonate analogs that could act as specific inhibitors. Then, the potential inhibitors were further modified to introduce a detection tag that was either a biotin or a fluorescent moiety at the N-terminus. In the latter case, a quencher was also added on the leaving group attached to the phosphorus atom, which will enable detection by measurement of fluorescence emission upon binding of the ABP to the active form of the enzyme. Also, we demonstrated the significance of carbon length at P1-like position for inhibitor binding to KLK7, since compounds 3b and 5b, respectively, have superior performance in inhibiting KLK7 activity. The inhibitory activity of the designed inhibitors was confirmed with gel zymography and by in vitro enzyme kinetics using purified components. Then, the developed ABPs were tested for their analytical/diagnostic potential with Western blotting and with activography; thereby, it was confirmed that the generated ABPs could bind and detect the active proteases in a Western blot-like assay. Activography is a recently described histochemical method to spatially localize and semiquantify enzymatic activities in situ in biopsies (Pampalakis et al., 2017; Zingkou et al., 2019). Using activography, cryosections obtained from skin biopsies from Netherton syndrome patients and a healthy individual were analyzed for localization of KLK7 activity. The activity was localized at the sites of stratum corneum disruption that is in accordance with the known role of KLKs in the cleavage of cornedosmosomal proteins (Borgoño et al., 2007). Further, a specific ABP-based ELISA for KLK7 was designed to be applied in the determination of active KLK7 in biological and clinical specimens. Previously, an ABP-based ELISA was established using an ABP (biotin-proline-phosphonolysine) that targets trypsin-like proteases, in general, which was used to detect active KLK6 in clinical specimens from cerebrospinal fluid (CSF) (Oikonomopoulou et al., 2008). The work described in this thesis is the second reported assay for the determination of active KLKs with an ABP-ELISA. Further, the developed quenched ABP (qabp) for KLK7 was tested with an SDS-PAGE. Specifically, the qabp was allowed to react with the 190

223 protease and the protease-abp adducts were analyzed with SDS-PAGE and visualized with fluorescent imaging. It was confirmed that the qabp can bind the active KLK7 and emit a fluorescence signal. Since ABPs are suicide inhibitors, it is logical to assume that they may have pharmacological applications, thus, they could be exploited as new theranostic agents. Theranostics is the term produced by the combination of the words therapy and diagnosis to describe agents that combine these two features. The advantage of theranostics lies in the use of a single agent for concomitant diagnosis and treatment. Nanotechnology has expanded the field of theranostics, and generally speaking, theranostic agents are mainly nanotechnological platforms such as liposomes, gold or iron oxide nanoparticles etc that can be directed to bind to certain cells, e.g., cancer cells and deliver their therapeutic and diagnostic cargo (Chen et al., 2014). Given the dual action of the ABPs, which can specifically localize the active enzyme and inhibit its activity, they offer a completely new and simpler platform for the development of a new class of theranostic agents. To our knowledge, only one group has assessed the roles of quenched ABPs for another protease family, i.e., cathepsin cysteine proteases, as theranostics for cancer and cardiovascular diseases. Specifically, cathepsin-targeting ABPs were used to detect and photosensitize breast tumors in mice (Ben-Nun et al., 2015) and for non-invasive intervention for cardiovascular diseases in mice (Weiss-Sadan et al., 2019). While there are many ABPs described for serine proteases, currently, there are no KLK7-ABPs, and none of these so far reported ABPs have been validated in vivo for therapeutic effect(s). The therapeutic potential of the developed KLK7-ABP-inhibitor (biotin-x-x-phe- Phe P -(OPh)2) was demonstrated in a preclinical mouse model of Netherton syndrome which reinforces the concept of using ABPs as theranostic compounds to be adopted in future studies. Specifically, the pharmacological ability of the newly synthesized KLK7-ABP-inhibitor was tested in the epidermis of Spink5 -/- Klk5 -/- mice, an established mouse model of Netherton syndrome but also atopic dermatitis. Initially, the Boc-FFP inhibitor that features the same chemical scaffold with the biotin-ffp ABP was administered topically onto the skin of P3 Spink5 -/- Klk5 -/- mice. We show that the Boc- FFP exerted a therapeutic effect, as indicated by the significantly suppressed pathological overdesquamation and inflammation, indicated by the diminished expression of proinflammatory cytokines. Similarly, epidermal application of biotin- 191

224 FFP in Spink5 -/- Klk5 -/- mice reduced the epidermal desquamation providing proof-ofprinciple for the theranostic action of ABPs. In conclusion, inhibitors or ABPs specific for the KLK7 and/or KLK6 protease are not available. Previous attempts have been made to generate reversible KLK7 or KLK6 inhibitors or suicide inhibitors, but their main drawback is their lack of specificity, while none of these compounds has ever been pharmacologically validated in preclinical models. Here, we applied a simple new in silico strategy to identify enzymespecific substrates, which can be modified chemically to generate specific/selective inhibitors and ABPs for KLK7 and KLK6. The therapeutic potential of the generated KLK7-ABP-inhibitor was validated in vivo, thus, supporting the proposed concept of using ABPs as theranostic compounds. The overall concept is shown in Figure 141. Double action!! Enzyme specific and selective inhibitors can be designed based on endogenous substrate peptide motifs, which can be modified to generate enzyme-specific activity-based probes (ABPs). The development and validation of a theranostic ABP-inhibitor for the KLK7 protease is presented as a prototype. Figure 141: Schematic outline of the results obtained in this study. In conclusion, the present study expands the use of ABPs as theranostic agents and suggests that they could be adopted for other enzymes in future studies and are interesting to a wide audience. 192

225 REFERENCES 193

226

227 Abuelyaman AS, Hudig D, Woodard SL, Powers JC. (1994) Fluorescent derivatives of diphenyl [1-(N-peptidylamino)alkyl]phosphonate esters: synthesis and use in the inhibition and cellular localization of serine proteases. Bioconjug Chem 5: Abuelyaman AS, Jackson DS, Hudig D, Woodard SL, Powers JC. (1997) Synthesis and kinetic studies of diphenyl 1-(N-peptidylamino) alkanephosphonate esters and their biotinylated derivatives as inhibitors of serine proteases and probes for lymphocyte granzymes. Arch Biochem Biophys 344: Adlington RM, Baldwin JE, Becker GW, Chen B, Cheng L, Cooper SL, Hermann RB, Howe TJ, McCoull W, McNulty AM, Neubauer BL, Pritchard GJ. (2001) Design synthesis and proposed active site binding analysis of monocyclic 2-azetidinone inhibitors of prostate specific antigen. J Med Chem 44: Al-Awadhi FH, Gao B, Rezaei MA, Kwan JC, Li C, Ye T, Paul VJ, Luesch H. (2018) Discovery synthesis pharmacological profiling and biological characterization of brintonamides A-E novel dual protease and GPCR modulators from a marine cyanobacterium. J Med Chem 61: Aloysius H, Hu L. (2015) Targeted prodrug approaches for hormone refractory prostate cancer. Med Res Rev 35: Angelo PF, Lima AR, Alves FM, Blaber SI, Scarisbrick IA, Blabe M, Juliano L, Juliano MA. (2006) Substrate specificity of human kallikrein 6: salt and glycosaminoglycan activation effects. J Biol Chem 281: Anisowicz A, Sotiropoulou G, Stenman G, Mok SC, Sager R. (1996) A novel protease homolog differentially expressed in breast and ovarian cancer. Mol Med 2: Anisowicz A, Sager R, Sotiropoulou G. (1998) Human protease M, a novel serine protease, and its cdna sequence and diagnostic and therapeutic uses. PCT Int. Patent, WO 98/11238, Arama DP, Soualmia F, Lisowski V, Longevial JF, Bosc E, Maillard LT, Martinez J, Masurier N, El Amri C. (2015) Pyrido-imidazodiazepinones as a new class of reversible inhibitors of human kallikrein 7. Eur J Med Chem 93: Arbuzov AE. (1906) On the structure of phosphonic acid and its derivates: isometization and transition of bonds from trivalent to pentavalent phosphorus. J Russ Phys Chem Soc 38:

228 Arnold S, Pampalakis G, Kantiotou K, Silva D, Cortez C, Missailidis S, Sotiropoulou G. (2012) One round of SELEX for the generation of DNA aptamers directed against KLK6. Biol Chem 393: Arrowsmith CH, Audia JE, Austin C, Baell J, Bennett J, Blagg J, Bountra C, Brennan PE, Brown PJ, Bunnage ME, Buser-Doepner C, Campbell RM, Carter AJ, Cohen P, Copeland RA, Cravatt B, Dahlin JL, Dhanak D, Edwards AM, Frederiksen M, Frye SV, Gray N, Grimshaw CE, Hepworth D, Howe T, Huber KV, Jin J, Knapp S, Kotz JD, Kruger RG, Lowe D, Mader MM, Marsden B, Mueller-Fahrnow A, Müller S, O'Hagan RC, Overington JP, Owen DR, Rosenberg SH, Roth B, Ross R, Schapira M, Schreiber SL, Shoichet B, Sundström M, Superti-Furga G, Taunton J, Toledo-Sherman L, Walpole C, Walters MA, Willson TM, Workman P, Young RN, Zuercher WJ. (2015) The promise and peril of chemical probes. Nat Chem Biol 11: Ashby EL, Kehoe PG, Love S. (2011) Kallikrein-related peptidase 6 in Alzheimer s disease and vascular dementia. Brain Res 1363: Attwood BK, Bourgognon JM, Patel S, Mucha M, Schiavon E, Skrzypiec AE, Young KW, Shiosaka S, Korostynski M, Piechota M, Przewlocki R, Pawlak R. (2011) Neuropsin cleaves EphB2 in the amygdala to control anxiety. Nature 473: Backes BJ Harris JL Leonetti F Craik CS Ellman JA. (2000) Synthesis of positionalscanning libraries of fluorogenic peptide substrates to define the extended substrate specificity of plasmin and thrombin. Nat Biotechnol 8: Bandiera E, Zanotti L, Bignotti E, Romani C, Tassi R, Todeschini P, Tognon G, Ragnoli M, Santin AD, Gion M, Pecorelli S, Ravaggi A. (2009) Human kallikrein 5: an interesting novel biomarker in ovarian cancer patients that elicits humoral response. Int J Gynecol Cancer 19: Bando Y, Hagiwara Y, Suzuki Y, Yoshida K, Aburakawa Y, Kimura T, Murakami C, Ono M, Tanaka T, Jiang Y-P, Mitrovi B, Bochimoto H, Yahara O, Yoshida S. (2018) Kallikrein 6 secreted by oligodendrocytes regulates the progression of experimental autoimmune encephalomyelitis. Glia 66: Barros TG, Santos J, de Souza B, Sodero A, de Souza A, da Silva DP, Rodrigues CR, Pinheiro S, Dias L, Abrahim-Vieira B, Puzer L, Muri E. (2017) Discovery of a new isomannide-based peptidomimetic synthetized by Ugi multicomponent reaction as human tissue kallikrein 1 inhibitor. Bioorg Med Chem Lett 27:

229 Baumeister B, Beythien J, Ryf J, Schneeberger P, White PD. (2005) Evaluation of biotin-osu and biotin-onp in the solid phase biotinylation of peptides. Int J Pept Res Ther 11: Bayani J, Paliouras M, Planque C, Shan SJ, Graham C, Squire JA, Diamandis EP. (2008) Impact of cytogenetic and genomic aberrations of the kallikrein locus in ovarian cancer. Mol Oncol 2: Bayés A, Tsetsenis T, Ventura S, Vendrell J, Aviles FX, Sotiropoulou G. (2004) Human kallikrein 6 activity is regulated via an autoproteolytic mechanism of activation/ inactivation. Biol Chem 385: Belyaev A, Zhang X, Augustyns K, Lambeir AM, De Meester I, Vedernikova I, Scharpé S, Haemers A. (1999) Structure-activity relationship of diaryl phosphonate esters as potent irreversible dipeptidyl peptidase IV inhibitors. J Med Chem 42: Ben-Nun Y, Merquiol E, Brandis A, Turk B, Scherz A, Blum G. (2015) Photodynamic quenched cathepsin activity-based probes for cancer detection and macrophage targeted therapy. Theranostics 5: Bernett MJ, Blaber SI, Scarisbrick IA, Dhanarajan P, Thompson SM, Blaber M. (2002) Crystal structure and biochemical characterization of human kallikrein 6 reveals that a trypsin-like kallikrein is expressed in the central nervous system. J Biol Chem 277: Bertrand JA, Oleksyszyn J, Kam CM, Boduszek B, Presnell S, Plaskon RR, Suddath FL, Powers JC, Williams LD. (1996) Inhibition of trypsin and thrombin by amino(4- amidinophenyl) methanephosphonate diphenyl ester derivatives: X-ray structures and molecular models. Biochemistry 35: Bhattacharya AK, Thyagarajan G. (1981) Michaelis-Arbuzov rearrangement. Chem Rev 81: Billi AC, Ludwig JE, Fritz Y, Rozic R, Swindell WR, Tsoi LC, Gruzska D, Abdollahi- Roodsaz S, Xing X, Diaconu D, Uppala R, Camhi MI, Klenotic PA, Sarkar MK, Husni ME, Scher JU, McDonald C, Kahlenberg JM, Midura RJ, Gudjonsson JE, Ward NL. (2020) KLK6 expression in skin induces PAR1-mediated psoriasiform dermatitis and inflammatory joint disease. J Clin Invest 130:

230 Bisyris E, Zingkou E, Kordopati G, Matsoukas M-T, Magriotis P, Pampalakis G, Sotiropoulou G. (2021a) A novel theranostic activity-based probe targeting kallikrein 7 for diagnosis and treatment of skin diseases. Chem Comm (Camb), in press; Advance online publication. Bisyris E, Zingkou E, Kordopati GG, Magriotis PA, Pampalakis G, Sotiropoulou G. (2021b) Generation of a quenched phosphonate activity-based probe for imaging the activity of the KLK7 protease. Organic & Biomolecular Chemistry (under review) Blaber SI, Yoon H, Scarisbrick IA, Juliano MA, Blaber M. (2007) The autolytic regulation of human kallikrein-related peptidase 6. Biochemistry 46: Blum G, Mullins SR, Keren K, Fonovic M, Jedeszko C, Rice MJ, Sloane BF, Bogyo M. (2005) Dynamic imaging of protease activity with fluorescently quenched activitybased probes. Nature Chem Biol 1: Blum G, von Degenfeld G, Merchant M J, Blau H. M, Bogyo M. (2007) Noninvasive optical imaging of cysteine protease activity using fluorescently quenched activitybased probes. Nature Chem Biol 3: Boduszek B, Oleksyszyn J, Kam CM, Selzler J, Smith RE, Powers JC. (1994a) Dipeptide phosphonates as inhibitors of dipeptidyl peptidase IV. J Med Chem 37: Boduszek B, Brown AD, Powers JC. (1994b) alpha-aminoalkylphosphonate di(chlorophenyl) esters as inhibitors of serine proteases. J Enzyme Inhib 8: Borgoño CA, Michael IP, Komatsu N, Jayakumar A, Kapadia R, Clayman GL, Sotiropoulou G, Diamandis EP. (2007a) A potential role for multiple tissue kallikrein serine proteases in epidermal desquamation. J Biol Chem 282: Borgoño CA, Michael IP, Shaw JL, Luo LY, Ghosh MC, Soosaipillai A, Grass L, Katsaros D, Diamandis EP. (2007b) Expression and functional characterization of the cancer-related serine protease human tissue kallikrein 14. J Biol Chem 282: Böttcher T, Sieber SA. (2008) Beta-lactones as privileged structures for the active-site labeling of versatile bacterial enzyme classes. Angew Chem Int Ed 47: Brattsand M, Egelrud T. (1998) Purification and characterization of interleukin 1 beta from human plantar stratum corneum. Evidence of interleukin 1 beta processing in vivo not involving interleukin 1 beta convertase. Cytokine 10:

231 Brattsand M, Egelrud T. (1999) Purification molecular cloning and expression of a human stratum corneum trypsin-like serine protease with possible function in desquamation. J Biol Chem 274: Brattsand M, Stefansson K, Lundh C, Haasum Y, Egelrud T. (2005) A proteolytic cascade of kallikreins in the stratum corneum. J Invest Dermatol 124: Brown CM, Ray M, Eroy-Reveles AA, Egea P, Tajon C, Craik CS. (2011) Peptide length and leaving-group sterics influence potency of peptide phosphonate protease inhibitors. Chem Biol 18: Caubet C, Jonca N, Brattsand M, Guerrin M, Bernard D, Schmidt R, Egelrud T, Simon M, Serre G. (2004) Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J Invest Dermatol 122: Chakrabarty S, Kahler JP, van de Plassche M, Vanhoutte R, Verhelst S. (2019) Recent advances in activity-based protein profiling of proteases. Curr Top Microbiol Immunol 420: Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, Bonafé JL, Wilkinson J, Taïeb A, Barrandon Y, Harper JI, de Prost Y, Hovnanian A. (2000) Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat Genet 25: Chen F, Ehlerding EB, Cai W. (2014) Theranostic nanoparticles. J Nucl Med 55: Chen H, Sells E, Pandey R, Abril ER, Hsu CH, Krouse RS, Nagle RB, Pampalakis G, Sotiropoulou G, Ignatenko NA. (2019) Kallikrein 6 protease advances colon tumorigenesis via induction of the high mobility group A2 protein. Oncotarget 10: Chen Z, Jiang Z, Chen N, Shi Q, Tong L, Kong F, Cheng X, Chen H, Wang C, Tang B. (2018) Target discovery of ebselen with a biotinylated probe. Chem Commun 54: Chen S, Yim JJ, Bogyo M. (2019) Synthetic and biological approaches to map substrate specificities of proteases. Biol Chem 401:

232 Chen W, Kinsler VA, Macmillan D, Di WL. (2016) Tissue Kallikrein Inhibitors Based on the sunflower trypsin inhibitor scaffold-a potential therapeutic intervention for skin diseases. PloS One 11: e Chow TF, Crow M, Earle T, El-Said H, Diamandis EP, Yousef GM. (2008) Kallikreins as microrna targets: an in silico and experimental-based analysis. Biol Chem 389: Cho A, Haruyama N, Hall B, Danton MJ, Zhang L, Arany P, Mooney DJ, Harichane Y, Goldberg M, Gibson CW, Kulkarni AB. (2013) TGF-ß regulates enamel mineralization and maturation through KLK4 expression. PloS One 8: e Clements JA, Willemsen NM, Myers M, Dong Y. (2004) The tissue kallikrein family of serine proteases: functional roles in human disease and potential as clinical biomarkers. Crit Rev Clin Lab Sci 41: Coda AB, Hata T, Miller J, Audish D, Kotol P, Two A, Shafiq F, Yamasaki K, Harper JC, Del Rosso JQ, Gallo RL. (2013) Cathelicidin kallikrein 5 and serine protease activity is inhibited during treatment of rosacea with azelaic acid 15% gel. Journal of the American Academy of Dermatology (JAAD) 69: Cork MJ, Danby SG, Vasilopoulos Y, Hadgraft J, Lane ME, Moustafa M, Guy RH, Macgowan AL, Tazi-Ahnini R, Ward SJ. (2009) Epidermal barrier dysfunction in atopic dermatitis. J Invest Dermatol 129: Costello LC, Feng P, Milon B, Tan M, Franklin RB. (2004) Role of zinc in the pathogenesis and treatment of prostate cancer: critical issues to resolve. Prostate Cancer Prostatic Dis 7: Cutter JL, Cohen NT, Wang J, Sloan AE, Cohen AR, Panneerselvam A, Schluchter M, Blum G, Bogyo M, Basilion JP. (2012) Topical application of activity-based probes for visualization of brain tumor tissue. PLoS One 7: e de Veer SJ, Furio L, Swedberg JE, Munro CA, Brattsand M, Clements JA, Hovnanian A, Harris JM. (2017) Selective Substrates and Inhibitors for Kallikrein-Related Peptidase 7 (KLK7) Shed light on KLK proteolytic activity in the stratum corneum. J Invest Dermatol 137: de Veer SJ, Ukolova SS, Munro CA, Swedberg JE, Buckle AM, Harris JM. (2013) Mechanism-based selection of a potent kallikrein-related peptidase 7 inhibitor from a 200

233 versatile library based on the sunflower trypsin inhibitor SFTI-1. Biopolymers 100: de Veer SJ, Wang CK, Harris JM, Craik DJ, Swedberg JE. (2015) Improving the selectivity of engineered protease inhibitors: Optimizing the P2 prime residue using a versatile cyclic peptide library. J Med Chem 58: Debela M, Magdolen V, Schechter N, Valachova M, Lottspeich F, Craik C.S, Choe Y, Bode W, Goettig P. (2006) Specificity profiling of seven human tissue kallikreins reveals individual subsite preferences. J Biol Chem 281: Debela M, Hess P, Magdolen V, Schechter NM, Steiner T, Huber R, Bode W, Goettig P. (2007) Chymotryptic specificity determinants in the 1.0A structure of the zincinhibited human tissue kallikrein 7. Proc Natl Acad Sci USA 104: Debela M, Beaufort N, Magdolen V, Schechter NM, Craik CS, Schmitt M, Bode W, Goettig P. (2008) Structures and specificity of the human kallikrein-related peptidases KLK4 5 6 and 7. Biol Chem 389: Demmer CS, Krogsgaard-Larsen N, Bunch L. (2011) Review on modern advances of chemical methods for the introduction of a phosphonic acid group. Chem Rev 111: Deng H, Lei Q, Wu Y, He Y, Li W. (2020) Activity-based protein profiling: Recent advances in medicinal chemistry. Eur J Med Chem 191: der Veken PV, El Sayed I, Joossens J, Stevens CV, Augustyns K, Haemers A. (2005) Lewis acid catalyzed synthesis of N-protected diphenyl 1-aminoalkylphosphonates. Synthesis-Stuttgart p Deraison C, Bonnart C, Lopez F, Besson C, Robinson R, Jayakumar A, Wagberg F, Brattsand M, Hachem J.P, Leonardsson G, Hovnanian A. (2007) LEKTI fragments specifically inhibit KLK5 KLK7 and KLK14 and control desquamation through a phdependent interaction. Mol Biol Cell 18: Descargues P, Deraison C, Bonnart C, Kreft M, Kishibe M, Ishida-Yamamoto A, Elias P, Barrandon Y, Zambruno G, Sonnenberg A, Hovnanian A. (2005) Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat Genet 37:

234 Descargues P, Deraison C, Prost C, Fraitag S, Mazereeuw-Hautier J, D Alessio M, Ishida-Yamamoto A, Bodemer C, Zambruno G, Hovnanian A. (2006) Corneodesmo somal cadherins are preferential targets of stratum corneum trypsin- and chymotrypsinlike hyperactivity in Netherton syndrome. J Invest Dermatol 126: Deu E, Verdoes M, Bogyo M. (2012) New approaches for dissecting protease functions to improve probe development and drug discovery. Nat Struct Mol Biol 19: Diamandis EP, Yousef GM, Soosaipillai AR, Grass L, Porter A, Little S, Sotiropoulou G. (2000a) Immunofluorometric assay of human kallikrein 6 (zyme/proteasem/ neurosin) and preliminary clinical applications. Clin Biochem 33: Doering K, Meder G, Hinnenberger M, Woelcke J, Mayr LM, Hassiepen U. (2009) A fluorescence lifetime-based assay for protease inhibitor profiling on human kallikrein 7. J Biomol Screen 14: 1-9. Dong Y, Matigian N, Harvey TJ, Samaratunga H, Hooper JD, Clements JA. (2008) Tissue-specific promoter utilization of the kallikrein-related peptidase genes KLK5 and KLK7 and cellular localisation of the encoded proteins suggest roles in exocrine pancreatic function. Biol Chem 389: Drag M, Pawelczak M, Kafarski P. (2003) Stereoselective synthesis of 1-amino alkanephosphonic acids with two chiral centers and their activity towards leucine aminopeptidase. Chirality 15: S104-S107. Du JP, Li L, Zheng J, Zhang D, Liu W, Zheng WH, Li X. S, Yao RC, Wang F, Liu S, Tan X. (2018) Kallikrein-related peptidase 7 is a potential target for the treatment of pancreatic cancer. Oncotarget 9: Edgington LE, Verdoes M, Bogyo M. (2011) Functional imaging of proteases: recent advances in the design and application of substrate-based and activity-based probes. Curr Opin Chem Biol 15: Edgington LE, Bogyo M. (2013) In vivo imaging and biochemical characterization of protease function using fluorescent activity-based probes. Curr Protoc Chem Biol 5: Edgington-Mitchell LE, Barlow N, Aurelio L, Samha A, Szabo M, Graham B, Bunnett N. (2017) Fluorescent diphenylphosphonate-based probes for detection of serine protease activity during inflammation. Bioorg Med Chem Lett 27:

235 Egelrud T. (1993) Purification and preliminary characterization of stratum corneum chymotryptic enzyme: a proteinase that may be involved in desquamation. J Invest Dermatol 101: Egelrud T, Lundstrom A. (1991) A chymotrypsin-like proteinase that may be involved in desquamation in plantar stratum corneum. Arch Dermatol Res 283: Eissa A, Amodeo V, Smith CR, Diamandis EP. (2011) Kallikrein-related peptidase-8 (KLK8) is an active serine protease in human epidermis and sweat and is involved in a skin barrier proteolytic cascade. J Biol Chem 286: Eitelhuber AC, Vosyka O, Nagel D, Bognar M, Lenze D, Lammens K, Schlauderer F, Hlahla D, Hopfner KP, Lenz G, Hummel M, Verhelst SH, Krappmann D. (2015) Activity-based probes for detection of active MALT1 paracaspase in immune cells and lymphomas. Chem Biol 22: Ekholm E, Egelrud T. (2000) Expression of stratum corneum chymotryptic enzyme in relation to other markers of epidermal differentiation in a skin explants model. Exp Dermatol 9: Emami N, Diamandis EP. (2008) Human kallikrein-related peptidase 14 (KLK14) is a new activator component of the KLK proteolytic cascade. Possible function in seminal plasma and skin. J Biol Chem 283: Faucher F, Bennett J. M, Bogyo M, Lovell S. (2020) Strategies for tuning the selectivity of chemical probes that target serine hydrolases. Cell Chem Biol 27: Felix AM, Heimer EP, Lambros TJ, Tzougraki C, Meienhofer J. (1978) Rapid removal of protecting groups from peptides by catalytic transfer hydrogenation with 1,4- cyclohexadiene. J Org Chem 43: Fernández A Vendrell M. (2015) Smart fluorescent probes for imaging macrophage activity. Chem Soc Rev 45: Fernandez I.S, Standker L, Forssmann W.G, Gimenez-Gallego G, Romero A. (2007). Crystallization and preliminary crystallographic studies of human kallikrein 7 a serine protease of the multigene kallikrein family. Acta Crystallogr Sect F Struct Biol Cryst Commun 63: Filippou PS, Karagiannis GS, Musrap N, Diamandis EP. (2016) Kallikrein-related peptidases (KLKs) and the hallmarks of cancer. Crit Rev Clin Lab Sci 53:

236 Flohr S, Randl SA, Ostermann N, Hassiepen U, Berst F, Bodendorf U, Gerhartz B, Marzinzik A, Ehrhardt C, Meingassner JG. (2010) Kallikrein 7 modulators. US Patent A1. Fonović M, Bogyo M. (2007) Activity based probes for proteases: applications to biomarker discovery molecular imaging and drug screening. Curr Pharm Des 13: Fortugno P, Furio L, Teson M, Berretti M, El Hachem M, Zambruno G, Hovnanian A, D'Alessio M. (2012) The 420K LEKTI variant alters LEKTI proteolytic activation and results in protease deregulation: implications for atopic dermatitis. Hum Mol Genet 21: Foust BJ, Poe MM, Lentini NA, Hsiao CC, Wiemer AJ, Wiemer DF. (2017) Mixed aryl phosphonate prodrugs of a butyrophilin ligand. ACS Med Chem Lett 8: Franzke CW, Baici A, Bartels J, Christophers E, Wiedow O. (1996) Antileukoprotease inhibits stratum corneum chymotryptic enzyme. Evidence for a regulative function in desquamation. J Biol Chem 271: Fredolini C, Byström S, Pin E, Edfors F, Tamburro D, Iglesias MJ, Häggmark A, Hong M-G, Uhlen M, Nilsson P, Schwenk JM. (2016) Immunocapture strategies in translational proteomics. Expert Rev Proteomics 13: Freitas RF, Teixeira TS, Barros TG, Santos JA, Kondo MY, Juliano MA, Juliano L, Blaber M, Antunes OA, Abrahão O, Jr Pinheiro S, Muri EM, Puzer L. (2012) Isomannide derivatives as new class of inhibitors for human kallikrein 7. Bioorg Med Chem Lett 22: Furio L, de Veer S, Jaillet M, Briot A, Robin A, Deraison C Hovnanian A. (2014) Transgenic kallikrein 5 mice reproduce major cutaneous and systemic hallmarks of Netherton syndrome. J Exp Med 211: Furio L, Pampalakis G, Michael IP, Nagy A, Sotiropoulou G, Hovnanian A. (2015) KLK5 inactivation reverses cutaneous hallmarks of Netherton syndrome. PLoS Genet 11: e Gaikwad HK, Tsvirkun D, Ben-Nun Y, Merquiol E, Popovtzer R, Blum G. (2018) Molecular imaging of cancer using X-ray computed tomography with protease targeted iodinated activity-based probes. Nano Lett 18:

237 Gerry CJ, Schreiber SL. (2018) Chemical probes and drug leads from advances in synthetic planning and methodology. Nat Rev Drug Discov 17: Ghosh MC, Grass L, Soosaipillai A, Sotiropoulou G, Diamandis EP. (2004) Human kallikrein 6 degrades extracellular matrix proteins and may enhance the metastatic potential of tumour cells. Tumor Biol 25: Gillet LC, Namoto K, Ruchti A, Hoving S, Boesch D, Inverardi B, Mueller D, Coulot M, Schindler P, Schweigler P, Bernardi A, Gil-Parrado S. (2008) In-cell selectivity profiling of serine protease inhibitors by activity-based proteomics. Mol Cell Proteomics 7: Goettig P, Magdolen V, Brandstetter H. (2010) Natural and synthetic inhibitors of kallikrein-related peptidases (KLKs). Biochimie 92: Gomis-Rüth FX, Bayés A, Sotiropoulou G, Pampalakis G, Tsetsenis T, Villegas V, Avilés FX, Coll M. (2002) The structure of human prokallikrein 6 reveals a novel activation mechanism for the kallikrein family. J Biol Chem 277: Gottlieb AB. (2005) Psoriasis: emerging therapeutic strategies. Nat Rev Drug Discov 4: Greenbaum D, Baruch A, Hayrapetian L, Darula Z, Burlingame A, Medzihradszky K. F, Bogyo M. (2002) Chemical approaches for functionally probing the proteome. Mol Cell Proteom 1: Greenbaum D, Medzihradszky KF, Burlingame A, Bogyo M. (2000) Epoxide electrophiles as activity-dependent cysteine protease profiling and discovery tools. Chem Biol 7: Grembecka J, Mucha A, Cierpicki T, Kafarski P. (2003) The most potent organophosphorus inhibitors of leucine aminopeptidase. Structure-based design, chemistry, and activity. J Med Chem Grzywa R, Sieńczyk M. (2013). Phosphonic esters and their application of protease control. Curr Pharma Des 19: Hachem JP, Man MQ, Crumrine D, Uchida Y, Brown BE, Rogiers V, Roseeuw D, Feingold KR, Elias PM. (2005). Sustained serine proteases activity by prolonged increase in ph leads to degradation of lipid processing enzymes and profound 205

238 alterations of barrier function and stratum corneum integrity. J Invest Dermatol 125: Hachem JP, Wagberg F, Schmuth M, Crumrine D, Lissens W, Jayakumar A, Houben E, Mauro TM, Leonardsson G, Brattsand M, Egelrud T, Roseeuw D, Clayman GL, Feingold KR, Williams ML, Elias PM. (2006) Serine protease activity and residual LEKTI expression determine phenotype in Netherton syndrome. J Invest Dermatol 126: Haddada M, Draoui H, Deschamps L, Walker F, Delaunay T, Brattsand M, Darmoul D. (2018) Kallikrein-related peptidase 7 overexpression in melanoma cells modulates cell adhesion leading to a malignant phenotype. Biol Chem 399: Haedke U, Götz M, Baer P, Verhelst SH. (2012). Alkyne derivatives of isocoumarins as clickable activity-based probes for serine proteases. Bioorg Med Chem 20: Hamilton R, Walker BJ, Walker B. (1993) Tetrahedron Lett 34: Hansson L, Backman A, Ny A, Edlund M, Ekholm E, Ekstrand Hammarstrom B, Tornell J, Wallbrandt P, Wennbo H, Egelrud T. (2002) Epidermal overexpression of stratum corneum chymotryptic enzyme in mice: a model for chronic itchy dermatitis. J Invest Dermatol 118: Hansson L, Stromqvist M, Backman A, Wallbrandt P, Carlstein A, Egelrud T. (1994). Cloning expression and characterization of stratum corneum chymotryptic enzyme. A skin-specific human serine proteinase. J Biol Chem 269: Heiker JT, Klöting N, Kovacs P, Kuettner EB, Sträter N, Schultz S, Kern M, Stumvoll M, Blüher M, Beck-Sickinger AG. (2013) Vaspin inhibits kallikrein 7 by serpin mechanism. Cell Mol Life Sci 70: Heinis C, Rutherford T, Freund S, Winter G. (2009). Phage-encoded combinatorial chemical libraries based on bicyclic peptides. Nat Chem Biol 5: Henkhaus RS, Roy UK, Cavallo-Medved D, Sloane BF, Gerner EW, Ignatenko NA. (2008) Caveolin-1-mediated expression and secretion of kallikrein 6 in colon cancer cells. Neoplasia 10: Hewett DR Simons AL Mangan NE Jolin HE Green SM Fallon PG McKenzie AN. (2005) Lethal neonatal ichthyosis with increased proteolytic processing of filaggrin in a mouse model of Netherton syndrome. Hum Mol Genet 142:

239 Hoffman BR, Katsaros D, Scorilas A, Diamandis P, Fracchioli S, Rigault de la Longrais IA, Colgan T, Puopolo M, Giardina G, Massobrio M, Diamandis EP. (2002) Immunofluorometric quantitation and histochemical localization of kallikrein 6 protein in ovarian cancer tissue: a new independent unfavourable prognostic biomarker. Br J Cancer 87: Hong JA, Choi NE, La YK, Nam HY, Seo J, Lee J. (2017) Development of a smart activity-based probe to detect subcellular activity of asparaginyl endopeptidase in living cells. Org Biomol Chem 15: Hovnanian A. (2013) Netherton syndrome: skin inflammation and allergy by loss of protease inhibition. Cell Tissue Res 351: Igawa S, Kishibe M, Minami-Hori M, Honma M, Tsujimura H, Ishikawa J, Fujimura T, Murakami M, Ishida-Yamamoto A. (20017) Incomplete KLK7 secretion and upregulated LEKTI expression underlie hyperkeratotic stratum corneum in atopic dermatitis. J Invest Dermatol 137: Ishida-Yamamoto A, Deraison C, Bonnart C, Bitoun E, Robinson R, O'Brien TJ, Wakamatsu K, Ohtsubo S, Takahashi H, Hashimoto Y, Dopping-Hepenstal PJ, McGrath JA, Iizuka H, Richard G, Hovnanian A. (2005) LEKTI is localized in lamellar granules, separated from KLK5 and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J Invest Dermatol 124: Iwata A, Maruyama M, Akagi T, Hashikawa T, Kanazawa I, Tsuji S, Nukina N. (2003) Alpha-synuclein degradation by serine protease neurosin: implication or pathogenesis of synucleinopathies. Hum Mol Genet 12: Izumi A, Iijima Y, Noguchi H, Numakawa T, Okada T, Hori H, Kato T, Tatsumi M, Kosuga A, Kamijima K, Asada T, Arima K, Saitoh O, Shiosaka S, Kunugi H. (2008) Genetic variations of human neuropsin gene and psychiatric disorders: polymorphism screening and possible association with bipolar disorder and cognitive functions. Neuropsychopharmacology 33: Jackson DS, Fraser SA, Ni LM, Kam CM, Winkler U, Johnson DA, Froelich CJ, Hudig D, Powers JC. (1998) Synthesis and evaluation of diphenyl phosphonate esters as inhibitors of the trypsin-like granzymes A and K and mast cell tryptase. J Med Chem 41:

240 Jeffery DA, Bogyo M. (2003) Chemical proteomics and its application to drug discovery. Curr Opin Biotechnol 14: Jendry C, Beck-Sickinger AG. (2016) Inhibition of kallikrein-related peptidases 7 and 5 by grafting serpin reactive-center loop sequences onto sunflower trypsin inhibitor-1 (SFTI-1). Chembiochem 17: Jeong S, Han SR, Lee YJ, Lee SW. (2010) Selection of RNA aptamers specific to active prostate-specific antigen. Biotechnol Lett 32: Jessani N, Liu Y, Humphrey M, Cravatt BF. (2002) Enzyme activity profiles of the secreted and membrane proteome that depict cancer cell invasiveness. Proc Natl Acad Sci USA 99: Jiang R, Shi Z, Johnson JJ, Liu Y, Stack MS. (2011) Kallikrein-5 promotes cleavage of desmoglein-1 and loss of cell-cell cohesion in oral squamous cell carcinoma. J Biol Chem 286: Johnson SK, Ramani VC, Hennings L, Haun RS. (2007) Kallikrein 7 enhances pancreatic cancer cell invasion by shedding E-cadherin. Cancer 109: Joossens J, Van der Veken P, Lambeir AM, Augustyns K, Haemers A. (2004) Development of irreversible diphenyl phosphonate inhibitors for urokinase plasminogen activator. J Med Chem 47: Jun M, Wang HY, Lee S, Choi E, Lee H, Choi EH. (2018) Differences in Genetic Variations between treatable and recalcitrant atopic dermatitis in Korean. Allergy Asthma Immunol Res 10: Kahler JP, Vanhoutte R, Verhelst S. (2020) Activity-based protein profiling of serine proteases in immune cells. Archivum immunologiae et therapiae experimentalis 68: 23. Kalinska M, Meyer-Hoffert U, Kantyka T, Potempa J. (2016) Kallikreins - The melting pot of activity and function. Biochimie 122: Kam CM, Abuelyaman AS, Li Z, Hudig D, Powers JC. (1993) Biotinylated isocoumarins new inhibitors and reagents for detection localization and isolation of serine proteases. Bioconjugate Chem 4:

241 Kanada KN, Nakatsuji T, Gallo RL. (2012) Doxycycline indirectly inhibits proteolytic activation of tryptic kallikrein-related peptidases and activation of cathelicidin. J Invest Dermatol 132: Kapadia C, Chang A, Sotiropoulou G, Yousef GM, Grass L, Soosaipillai A, Xing X, Howarth DHC, Diamandis EP. (2003) Human kallikrein 13: Production and purification of recombinant protein, monoclonal and polyclonal antibodies and development of a sensitive and specific immunofluorometric assay. Clin Chem 49: Kasai T, Tokuda T, Yamaguchi N, Watanabe Y, Kametani F, Nakagawa M, Mizuno T. (2008) Cleavage of normal and pathological forms of alpha-synuclein by neurosin in vitro. Neurosci Lett 436: Kasparek P, Ileninova Z, Zbodakova O, Kanchev I, Benada O, Chalupsky K, Brattsand M, Beck IM, Sedlacek R. (2017) KLK5 and KLK7 ablation fully rescues lethality of Netherton syndrome-like phenotype. PLoS Genet 13: e Kasperkiewicz P, Altman Y, D'Angelo M, Salvesen GS, Drag M. (2017) Toolbox of fluorescent probes for parallel imaging reveals uneven location of serine proteases in neutrophils. J Am Chem Soc 139: Kasperkiewicz P, Gajda AD, Drąg M. (2012) Current and prospective applications of non-proteinogenic amino acids in profiling of proteases substrate specificity. Biol Chem 393: Kasperkiewicz P, Poreba M, Snipas SJ, Lin SJ, Kirchhofer D, Salvesen GS, Drag M. (2015) Design of a Selective Substrate and Activity Based Probe for Human Neutrophil Serine Protease 4. PLoS One 10: e Kasperkiewicz P, Poreba M, Snipas SJ, Parker H, Winterbourn CC, Salvesen GS, Drag M. (2014). Design of ultrasensitive probes for human neutrophil elastase through hybrid combinatorial substrate library profiling. Proc Natl Acad Sci USA 111: Khoury N, Zingkou E, Pampalakis G, Zoumpourlis V, Sotiropoulou G. (2018) KLK6 protease accelerates skin tumor formation and progression. Carcinogenesis 39:

242 Kim JT, Song EY, Chung K.S, Kang MA, Kim JW, Kim SJ, Yeom YI, Kim JH, Kim KH, Lee HG. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer 117: Klucky B, Mueller R, Vogt I, Teurich S, Hartenstein B, Breuhahn K, Flechtenmacher C, Angel P, Hess J. (2007) Kallikrein 6 induces E-cadherins shedding and promotes cell proliferation migration and invasion. Cancer Res 67: Knorr R, Trzeciak A, Bannwarth W, Gillessen D. (1989) New coupling reagents in peptide chemistry. Tetrahedron Lett 30: Koistinen H, Wohlfahrt G, Mattsson J. M, Wu P, Lahdenperä J, Stenman UH. (2008) Novel small molecule inhibitors for prostate-specific antigen. Prostate 68: Komatsu N, Saijoh K, Kuk C, Liu A.C, Khan S, Shirasaki F, Takehara K, Diamandis EP. (2007a) Human tissue kallikrein expression in the stratum corneum and serum of atopic dermatitis patients. Exp Dermatol 16: Komatsu N, Saijoh K, Kuk C, Shirasaki F, Takehara K, Diamandis EP. (2007b) Aberrant human tissue kallikrein levels in the stratum corneum and serum of patients with psoriasis: dependence on phenotype, severity and therapy. Br J Dermatol 156: Komatsu N, Takata M, Otsuki N, Ohka R, Amano O, Takehara K, Saijoh K. (2002). Elevated stratum corneum hydrolytic activity in Netherton syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. J Invest Dermatol 118: Krastel P, Liechty BM, Schmitt E, Schreiner EP. (2013) Use of cyclic depsipeptides to inhibit kallikrein 7. US Patent Krenzer S, Peterziel H, Mauch C, Blaber SI, Blaber M, Angel P, Hess J. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol 131: Krysiak JM, Kreuzer J, Macheroux P, Hermetter A, Sieber SA, Breinbauer R. (2012) Activity-based probes for studying the activity of flavin-dependent oxidases and for the protein target profiling of monoamine oxidase inhibitors. Angew Chem Int Ed Engl 51:

243 Kryza T, Silva ML, Loessner D, Heuzé-Vourc'h N, Clements JA. (2016) The kallikreinrelated peptidase family: Dysregulation and functions during cancer progression. Biochimie 122: Lawrence MG, Lai J, Clements JA. (2010) Kallikreins on steroids: structure function and hormonal regulation of prostate-specific antigen and the extended kallikrein locus. Endocr Rev 31: LeBeau AM, Banerjee SR, Pomper MG, Mease RC, Denmeade SR. (2009) Optimization of peptide-based inhibitors of prostate-specific antigen (PSA) as targeted imaging agents for prostate cancer. Bioorg Med Chem 17: Lenga M, Bonda W, Iochmann S, Magnen M, Courty Y, Reverdiau P. (2018) Kallikrein-related peptidases in lung diseases. Biol Chem 399: Lentz CS. (2020) What you see is what you get: activity-based probes in single-cell analysis of enzymatic activities. Biol Chem 401: Liang G, Chen X, Aldous S, Pu SF, Mehdi S, Powers E, Xia T, Wang R. (2012) Human kallikrein 6 inhibitors with a para-amidobenzylamine P1 group identified through virtual screening. Bioorg Med Chem Lett 22: Lilja H, Ulmert D, Vickers AJ. (2008) Prostate-specific antigen and prostate cancer: prediction detection and monitoring. Nature Rev Cancer 8: Lin R, Nagai Y, Sladek R, Bastien Y, Ho J, Petrecca K, Sotiropoulou G, Diamandis EP, Hudson TJ, White JH. (2002) Expression profiling in squamous carcinoma cells reveals pleiotropic effects of vitamin D3 analog EB1089 signalling on cell proliferation, differentiation, and immune system regulation. Mol Endocrinol 16: Linschoten M. (2011) Use of heterocyclic compounds as SCCE inhibitors. US Patent A1. Little SP, Dixon E.P, Norris F, Buckley W, Becker GW, Johnson M, Dobbins JR, Wyrick T, Miller JR, MacKellar W, Hepburn D, Corvalan J, McClure D, Liu X, Stephenson D, Clemens J, Johnstone EM. (1997) Zyme a novel and potentially amyloidogenic enzyme cdna isolated from Alzheimer s disease brain. J Biol Chem 272: Liu Y, Patricelli MP, Cravatt BF. (1999) Activity-based protein profiling: the serine hydrolases. Proc Natl Acad Sci USA 96:

244 Loessner D, Goettig P, Preis S, Felber J, Bronger H, Clements JA, Dorn J, Magdolen V. (2018) Kallikrein-related peptidases represent attractive therapeutic targets for ovarian cancer. Expert Opin Ther Targets 22: Logothetis CJ, Lin SH. (2005) Osteoblasts in prostate cancer metastasis to bone. Nature Rev Cancer 5: Lövgren J, Airas K, Lilja H. (1999) Enzymatic action of human glandular kallikrein 2 (hk2). Substrate specificity and regulation by Zn 2+ and extracellular protease inhibitors. Eur J Biochem 262: Lu J, Goldstein KM, Chen P, Huang S, Gelbert LM, Nagpal S. (2005) Transcriptional profiling of keratinocytes reveals a vitamin D-regulated epidermal differentiation network. J Invest Dermatol 124: Lundberg KC, Fritz Y, Johnston A, Foster AM, Baliwag J, Gudjonsson JE, Schlatzer D, Gokulrangan G, McCormick TS, Chance MR, Ward NL. (2015) Proteomics of skin proteins in psoriasis: from discovery and verification in a mouse model to confirmation in humans. Mol Cell Proteomics 14: Lundstrom A, Egelrud T. (1988) Cell shedding from human plantar skin in vitro: evidence of its dependence on endogenous proteolysis. J Invest Dermatol 91: Lundwall Ǻ, Band V, Blaber M, Clements J, Courty Y, Diamandis EP, Fritz H, Lilja H, Malm J, Maltais LJ, Olsson AY, Petraki C, Scorilas A, Sotiropoulou G, Stenman U- H, Stephan C, Talieri M, Yousef GM. (2006) A comprehensive nomenclature for serine proteases with homology to the tissue kallikrein. Biol Chem 387: Madeddu P, Emanueli C, El-Dahr S. (2007) Mechanisms of disease: the tissue kallikrein-kinin system in hypertension and vascular remodeling. Nature clinical practice. Nephrology 3: Magklara A, Mellati AA, Wasney GA, Little SP, Sotiropoulou G, Becker GW, Diamandis EP. (2003) Characterization of the enzymatic activity of human kallikrein 6: Autoactivation substrate specificity and regulation by inhibitors. Biochem Biophys Res Commun 307: Mahrus S, Craik CS. (2005) Selective chemical functional probes of granzymes A and B reveal granzyme B is a major effector of natural killer cell-mediated lysis of target cells. Chem Biol 12:

245 Maluch I, Czarna J, Drag M. (2019) Applications of unnatural amino acids in protease probes. Chemistry an Asian journal 14: Mandal PK and McMurray JS. (2007) Pd C-Induced Catalytic Transfer Hydrogenation with Triethylsilane. J Org Chem 72(17): Marceau F, Regoli D. (2004) Bradykinin receptor ligands: therapeutic perspectives. Nature Rev Drug Discov 3: Martin EJ, Blaney JM, Siani MA, Spellmeyer DC, Wong AK, Moos WH. (1995) Measuring diversity: experimental design of combinatorial libraries for drug discovery. J Med Chem 38: Maślanka M, Mucha A. (2019) Recent developments in peptidyl diaryl phoshonates as inhibitors and activity-based probes for serine proteases. Pharmaceuticals (Basel Switzerland) 12: 86. Masurier N, Arama DP, El Amri C, Lisowski V. (2018) Inhibitors of kallikrein-related peptidases: An overview. Med Res Rev 38: Masurier N, Aruta R, Gaumet V, Denoyelle S, Moreau E, Lisowski V, Martinez J, Maillard LT. (2012) Selective C-acylation of 2-aminoimidazo[1,2-a] pyridine: Application to the synthesis of imidazopyridine-fused [1,3] diazepinones. J Org Chem 77: McKay CS, Finn MG. (2014) Click chemistry in complex mixtures: bioorthogonal bioconjugation. Chem Biol 21: Mella C, Figueroa CD, Otth C, Ehrenfeld P. (2020) Involvement of kallikrein-related peptidases in nervous system disorders. Front Cell Neurosci 14: 166. Ménez R, Michel S, Muller BH, Bossus M, Ducancel F, Jolivet-Reynaud C, Stura EA. (2008) Crystal structure of a ternary complex between human prostate-specific antigen its substrate acyl intermediate and an activating antibody. J Mol Biol 376: Meyer-Hoffert U, Schröder JM. (2011) Epidermal proteases in the pathogenesis of rosacea. J Invest Dermatol-Symposium Proceedings 15: Meyer-Hoffert U, Wu Z, Kantyka T, Fischer J, Latendorf T, Hansmann B, Bartels J, He Y, Glaser R, Schroder JM. (2010) Isolation of SPINK6 in human skin: selective inhibitor of kallikrein-related peptidases. J Biol Chem 285:

246 Michael IP, Pampalakis G, Mikolajczyk SD, Malm J, Sotiropoulou G, Diamandis EP. (2006) Human tissue kallikrein 5 is a member of a proteolytic cascade pathway involved in seminal clot liquefaction and potentially in prostate cancer progression. J Biol Chem 281: Michael IP, Sotiropoulou G, Pampalakis G, Magklara A, Ghosh M, Wasney G, Diamandis EP. (2005) Biochemical and enzymatic characterization of human kallikrein 5 (hk5), a novel serine protease potentially involved in cancer progression. J Biol Chem 280: Michaelis A, Becker T. (1897) Ueber die Constitution der phosphorigen Säure. Berichte Der Deutschen Chemischen Gesellschaft 30: Michaelis A, Kaehne R. (1898) Ueber das Verhalten der Jodalkyle gegen die sogen. Phosphorigsäureester odero-phosphine. Berichte Der Deutschen Chemischen Gesellschaft 31: Mitsui S, Okui A, Uemura H, Mizuno T, Yamada T, Yamamura Y, Yamaguchi N. (2002) Decreased cerebrospinal fluid levels of neurosin (KLK6), an aging-related protease as a possible new risk factor for Alzheimer s disease. Ann N Y Acad Sci 977: Mochida A, Ogata F, Nagaya T, Choyke PL, Kobayashi H. (2017) Activatable fluorescent probes in fluorescence-guided surgery: Practical considerations. Bioorg Med Chem 26: Morizane S, Yamasaki K, Kabigting FD, Gallo RL. (2010) Kallikrein expression and cathelicidin processing are independently controlled in keratinocytes by calcium vitamin D(3), and retinoic acid. J Invest Dermatol 130: Morizane S, Yamasaki K, Kajita A, Ikeda K, Zhan MAoyama Y, Gallo RL, Iwatsuki K. (2012) TH2 cytokines increase kallikrein 7 expression and function in patients with atopic dermatitis. J Allergy Clin Immunol 130: Mucha A, Kafarski P. (2002) Transesterification of monophenyl phosphonamidates - chemical modelling of serine protease inhibition. Tetrahedron 58: Murafuji H Sugawara H Goto M Oyama Y Sakai H Imajo S Tomoo T Muto T. (2018a) Structure-based drug design to overcome species in kallikrein 7 inhibition of 1,3,6- trisubstituted 1,4-diazepan-7-ones. Bioorg Med Chem 26:

247 Murafugi H, Sakai H, Goto M, Oyama Y, Imajo S, Sugawara H, Tomoo T, Muto T. (2018b) Structure-based drug design of 1,3,6-trisubstituted 1,4-diazepan-7-ones as selective human kallikrein 7 inhibitors. Bioorg Med Chem Lett 28: Murafuji H, Sakai H, Goto M, Imajo S, Sugawara H, Muto T. (2017) Discovery and structure-activity relationship study of 1,3,6-trisubstituted 1,4-diazepane-7-ones as novel human kallikrein 7 inhibitors. Bioorg Med Chem Lett 27: Murakami K, Jiang YP, Tanaka T, Bando Y, Mitrovic B, Yoshida S. (2013) In vivo analysis of kallikrein-related peptidase 6 (KLK6) function in oligodendrocyte development and the expression of myelin proteins. Neuroscience 236: Nagahara H, Mimori K, Utsunomiya T, Barnard GF, Ohira M, Hirakawa K, Mori M. (2005) Clinicopathologic and biological significance of kallikrein 6 overexpression in human gastric cancer. Clin Cancer Res 11: Nathalie HV, Chris P, Serge G, Catherine C, Benjamin B, Claire B, Christelle P, Briollais L, Pascale R, Marie-Lise J, Yves C. (2009) High Kallikrein-Related Peptidase 6 in Non-Small Cell Lung Cancer Cells: an indicator of tumor proliferation and poor prognosis. J Cell Mol Med 13: Ni X, Zhang W, Huang K-C, Wang Y, Ng S-K, Mok SC, Berkowitz RS, Ng S-W. (2004) Characterisation of human kallikrein 6/protease M expression in ovarian cancer. Br J Cancer 91: Nishiyama Y, Taguchi H, Luo JQ, Zhou YX, Burr G, Karle S, Paul S. (2002) Covalent reactivity of phosphonate monophenyl esters with serine proteinases: an overlooked feature of presumed transition state analogs. Arch Biochem Biophys 402: Ny A, Egelrud T. (2004) Epidermal hyperproliferation and decreased skin barrier function in mice overexpressing stratum corneum chymotryptic enzyme. Acta Dermato Venereologica 84: Nylander-Lundqvist E, Egelrud T. (1997) Formation of active IL-1 beta from pro-il-1 beta catalyzed by stratum corneum chymotryptic enzyme in vitro. Acta Derm Venereol 77: Ogawa K, Utsunomiya T, Mimori K, Tanaka F, Inoue H, Nagahara H, Murayama S, Mori M. (2005) Clinical significance of human kallikrein gene 6 messenger expression in colorectal cancer. Clin Cancer Res 11:

248 Ogawa K, Yamada T, Tsujioka Y, Taguchi J, Takahashi M, Tsuboi Y, Fujino Y, Nakajima M, Yamamoto T, Akatsu H, Mitsui S, Yamaguchi N. (2000) Localization of a novel type trypsin-like serine protease neurosin in brain tissues of Alzheimer s disease and Parkinson s disease. Psychiatry Clin Neurosci 54: Ohler A, Debela M, Wagner S, Magdolen V, Becker-Pauly C. (2010) Analyzing the protease web in skin: meprin metalloproteases are activated specifically by KLK4 5 and 8 vice versa leading to processing of proklk7 thereby triggering its activation. Biol Chem 391: Oikonomopoulou K, Hansen KK, Baruch A, Hollenberg MD, Diamandis EP. (2008) Immunofluorometric activity-based probe analysis of active KLK6 in biological fluids. Biol Chem 389: Oleksyszyn J, Powers JC. (1989) Irreversible inhibition of serine proteases by peptidyl derivatives of alpha-aminoalkylphosphonate diphenyl esters. Biochem Biophys Res Commun 161: Oleksyszyn J, Powers JC. (1991) Irreversible inhibition of serine proteases by peptide derivatives of (alpha-aminoalkyl) phosphonate diphenyl esters. Biochemistry 30: Oleksyszyn J, Boduszek B, Kam CM, Powers JC. (1994) Novel amidine-containing peptidyl phosphonates as irreversible inhibitors for blood coagulation and related serine proteases. J Med Chem 37: Oleksyszyn J, Subotkowska L, Mastalerz P. (1979) Diphenyl 1-Aminoalkanephospho nates. Synthesis Oliveira JP, Freitas RF, Melo LS, Barros TG, Santos JA, Juliano MA, Pinheiro S, Blaber M, Juliano L, Muri E. M, Puzer L. (2013) Isomannide-based peptidomimetics as inhibitors for human tissue kallikreins 5 and 7. ACS Med Chem Lett 5: Oliveira JR, Bertolin TC, Andrade D, Oliveira LCG, Kondo MY, Santos JAN, Juliano MA. (2015) Specificity studies on kallikrein-related peptidase 7 (KLK7) and effects of osmolytes and glycosaminoglycans on its peptidase activity. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1854: Oresic Bender K, Ofori L, van der Linden WA, Mock ED, Datta GK, Chowdhury S, Li H, Segal E, Sanchez Lopez M, Ellman JA, Figdor CG, Bogyo M, Verdoes M. (2015) 216

249 Design of a highly selective quenched activity-based probe and its application in dual color imaging studies of cathepsin S activity localization. J Am Chem Soc 137: Pasic MD, Sotiropoulou G, Yousef GM. (2015) The mirna-kallikrein interactions: adding a new dimension. Cell Cycle 14: Pampalakis G, Kurlender L, Diamandis EP, Sotiropoulou G. (2004) Cloning and characterization of novel isoforms of the human kallikrein 6 gene. Biochem Biophys Res Commun 320: Pampalakis G, Sotiropoulou G. (2006a) Multiple mechanisms underlie the aberrant expression of the human kallikrein 6 gene in breast cancer. Biol Chem 387: Pampalakis G, Diamandis EP, Sotiropoulou G. (2006b) The epigenetic basis for the aberrant expression of kallikreins in human cancers. Biol Chem 387: Pampalakis G, Arampatzidou M, Sotiropoulou G. (2006c) Computational cloning and analysis of human kallikrein 6 orthologue genes. Lect Series Comp Comput Sci 7: Pampalakis G, Sotiropoulou G. (2007) Tissue kallikrein proteolytic cascade pathways in normal physiology and cancer. Biochim Biophys Acta 1776: Pampalakis G, Scorilas A, Sotiropoulou G. (2008) Novel splice variants of prostatespecific antigen and applications in diagnosis of prostate cancer. Clin Biochem 41: Pampalakis G, Arampatzidou M, Amoutzias G, Kossida S, Sotiropoulou G. (2008) Identification and analysis of mammalian KLK6 orthologue genes for prediction of physiological substrates. Comput Biol Chem 32: Pampalakis G, Prosnikli E, Agalioti T, Vlahou A, Zoumpourlis V, Sotiropoulou G. (2009) A tumor-protective role for human kallikrein-related peptidase 6 in breast cancer mediated by inhibition of epithelial-to-mesenchymal transition. Cancer Res 69: Pampalakis G, Sotiropoulou G. (2012) Pharmacological targeting of the human tissue kallikrein-related peptidases. In "Proteinases as Drug Targets", Edited by Ben M. Dunn, Royal Society of Chemistry, UK, RSC Publishing. 217

250 Pampalakis G, Obasuyi O, Papadodima O, Chatziioannou A, Zoumpourlis V, Sotiropoulou G. (2014) The KLK5 protease suppresses breast cancer by repressing the mevalonate pathway. Oncotarget 5: Pampalakis G, Zingkou E, Vekrellis K, Sotiropoulou G. (2017a) "Activography": a novel versatile and easily adaptable method for monitoring enzymatic activities in situ. Chem Commun (Camb) 53: Pampalakis G, Sykioti VS, Ximerakis M, Stefanakou-Kalakou I, Melki R, Vekrellis K, Sotiropoulou G. (2017b) KLK6 proteolysis is implicated in the turnover and uptake of extracellular alpha-synuclein species. Oncotarget 8: Pampalakis G, Kiritsi D, Zingkou E, Franzke CW, Valari M, Sotiropoulou G. (2017c) Enhanced proteolytic activities in acral peeling skin syndrome: a role of transglutaminase 5 in epidermal homeostasis. J Invest Dermatol 137: Pampalakis G, Sotiropoulou G. (2017d) Insights into the regulation of proteolytic pathways in skin differentiation. Br J Dermatol 176: Pampalakis G, Zingkou E, Sotiropoulou G. (2018) KLK5 a novel potential suppressor of vaginal carcinogenesis. Biol Chem 399: Pampalakis G, Zingkou E, Sidiropoulos KG, Diamandis EP, Zoumpourlis V, Yousef GM, Sotiropoulou G. (2019) Biochemical pathways mediated by KLK6 protease in breast cancer. Mol Oncol 13: Pampalakis G, Zingkou E, Kaklamanis L, Spella M, Stathopoulos GT, Sotiropoulou G. (2019) Elimination of KLK5 inhibits early skin tumorigenesis by reducing epidermal proteolysis and reinforcing epidermal microstructure. Biochim Biophys Acta Mol Basis Dis 1865: Pampalakis G, Zingkou E, Zoumpourlis V, Sotiropoulou G. (2021) Ectopic expression of KLK6 in MDA-MB-435 melanoma cells reduces tumorigenicity in vivo. Pathol Res Pract 217: Pan Z, Jeffery D. A, Chehade K, Beltman J, Clark J. M, Grothaus P, Bogyo M, Baruch A. (2006) Development of activity-based probes for trypsin-family serine proteases. Bioorg Med Chem Lett 16:

251 Paquet A. (1982) Introduction of 9-fluorenylmethyloxycarbonyl trichloroethoxycar bonyl and benzyloxycarbonyl amine protecting groups into O-unprotected hydroxyamino acids using succinimidyl carbonates. Can J Chem 60: Pathak M, Wong SS, Dreveny I, Emsley J. (2013) Structure of plasma and tissue kallikreins. Thromb Haemost 110: Patricelli MP, Giang DK, Stamp LM, Burbaum JJ. (2001) Direct visualization of serine hydrolase activities in complex proteomes using fluorescent active site-directed probes. Proteomics 1: Pavlopoulou A, Pampalakis G, Michalopoulos I, Sotiropoulou G. (2010) Evolutionary history of tissue kallikreins. PLoS One 5: e13781 Petraki CD, Karavana VN, Skoufogiannis PT, Little SP, Howarth DJ, Yousef GM, Diamandis EP. (2001) The spectrum of human kallikrein 6 (zyme/proteasem/neurosin) expression in human tissues as assessed by immunohistochemistry. J Histochem Cytochem 49: Pettus JR, Johnson JJ, Shi Z, Davis JW, Koblinski J, Ghosh S, Liu Y, Ravosa MJ, Frazier S, Stack MS. (2009) Multiple kallikrein (KLK5 7 8 and 10) expression in squamous cell carcinoma of the oral cavity. Histol Histopathol 24: Planque C, demonte M, Guyetant S, Rollin J, Desmazes C, Panel V, Lemarie E, Courty Y. (2005) KLK5 and KLK7 two members of the human tissue kallikrein family are differentially expressed in lung cancer. Biochem Biophys Res Commun 329: Polgár L. (2005) The catalytic triad of serine peptidases. Cell Mol Life Sci 62: Pollaro L, Diderich P, Angelini A, Bellotto S, Wegner H, Heinis C. (2012) Measuring net protease activities in biological samples using selective peptidic inhibitors. Anal Biochem 427: Poreba M, Kasperkiewicz P, Snipas SJ, Fasci D, Salvesen GS, Drag M. (2014) Unnatural amino acids increase sensitivity and provide for the design of highly selective caspase substrates. Cell Death Differ 21: Poreba M, Salvesen G. S, Drag M. (2017) Synthesis of a HyCoSuL peptide substrate library to dissect protease substrate specificity. Nat Protoc 12:

252 Powers JC, Asgian JL, Ekici OD, James KE. (2002) Irreversible inhibitors of serine cysteine and threonine proteases. Chem Rev 102: Prassas I, Eissa A, Poda G, Diamandis EP. (2015) Unleashing the therapeutic potential of human kallikrein-related serine proteases. Nat Rev Drug Discov 14: Ramani V.C, Haun R.S. (2008) The extracellular matrix protein fibronectin is a substrate for kallikrein 7. Biochem Biophys Res Commun 369: Rawlings ND, Barrett AJ. (1993) Evolutionary families of peptidases. Biochem J 290: Rawlings ND, Barrett AJ, Thomas P. D, Huang X, Bateman A, Finn RD. (2018) The MEROPS database of proteolytic enzymes their substrates and inhibitors in 2017 and a comparison with peptidases in the PANTHER database. Nucleic Acids Res 46: Sales KU, Masedunskas A, Bey AL, Rasmussen AL, Weigert R, List K, Szabo R, Overbeek PA, Bugge TH. (2010) Matriptase initiates activation of epidermal prokallikrein and disease onset in a mouse model of Netherton syndrome. Nat Genet 42: Sanman LE, Bogyo M. (2014) Activity-based profiling of proteases. Annu Rev Biochem 83: Santin AD, Diamandis EP, Bellone S, Soosaipillai A, Cane S, Palmieri M, Burnett A, Roman JJ, Pecorelli S. (2005) Human kallikrein 6: a new potential serum biomarker for uterine serous papillary cancer. Clin Cancer Res 11: Savory N, Abe K, Sode K, Ikebukuro K. (2010) Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing. Biosens Bioelectron 26: Scarisbrick I. A, Yoon H, Panos M, Larson N, Blaber S. I, Blaber M, Rodriguez M. (2012) Kallikrein 6 regulates early CNS demyelination in a viral model of multiple sclerosis. Brain Pathol (Zurich Switzerland) 22: Scarisbrick IA, Epstein B, Cloud BA, Yoon H, Wu J, Renner DN, Blaber SI, Blaber M, Vandell AG, Bryson AL. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One 6: e

253 Schechter I, Berger A. (1967) On the size of the active site in proteases. I. Papain. Biochem Biophys Res Commun 27: Schechter NM, Choi E-J, Wang Z-M, Hanakawa Y, Stanley JR, Kang Y, Clayman GL, Jayakumar A. (2005) Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol Chem 386: Schreiber SL, Kotz JD, Li M, Aubé J, Austin CP, Reed JC, Rosen H, White EL, Sklar LA, Lindsley CW, Alexander BR, Bittker JA, Clemons PA, de Souza A, Foley MA, Palmer M Shamji AF, Wawer MJ, McManus O, Wu M, Zou B, Yu H, Golden JE, Schoenen FJ, Simeonov A, Jadhav A, Jackson MR, Pinkerton AB, Chung TD, Griffin PR, Cravatt BF, Hodder PS, Roush WR, Roberts E, Chung DH, Jonsson CB, Noah JW Severson WE, Ananthan S, Edwards B, Oprea TI, Conn PJ, Hopkins CR, Wood MR, Stauffer SR, Emmitte KA. (2015) NIH Molecular Libraries Project Team. Advancing biological understanding and therapeutics discovery with small-molecule probes. Cell 161: Schröder FH, Bangma CH, Roobol MJ. (2008) Is it necessary to detect all prostate cancers in men with serum PSA levels <3.0 ng/ml? A comparison of biopsy results of PCPT and outcome-related information from ERSPC. Eur Urol 53: Serim S, Baer P, Verhelst SH. (2015) Mixed alkyl aryl phosphonate esters as quenched fluorescent activity-based probes for serine proteases. Org Biomol Chem 13: Serim S, Haedke U, Verhelst SH. (2012) Activity-based probes for the study of proteases: recent advances and developments. ChemMedChem 7: Serim S, Mayer SV, Verhelst SH. (2013) Tuning activity-based probe selectivity for serine proteases by on-resin 'click' construction of peptide diphenyl phosphonates. Org Biomol Chem 11: Sharma N, Oikonomopoulou K, Ito K, Renaux B, Diamandis EP, Hollenberg MD, Rancourt DE. (2008) Substrate specificity determination of mouse implantation serine proteinase and human kallikrein-related peptidase 6 by phage display. Biol Chem 389: Shaw JL, Diamandis EP. (2007) Distribution of 15 human kallikreins in tissues and biological fluids. Clin Chem 53:

254 Sidiropoulos M, Pampalakis G, Sotiropoulou G, Katsaros D, Diamandis EP. (2005) Downregulation of human kallikrein 10 (KLK10/NES1) by CpG island hypermethylation in breast, ovarian and prostate cancers. Tumor Biol 26: Sidiropoulos KG, Ding Q, Pampalakis G, White NMA, Boulos P, Sotiropoulou G, Yousef GM.. (2016) KLK6-regulated mirna networks activate oncogenic pathways in breast cancer subtypes. Mol Oncol 10: Sidiropoulos KG, White NMA, Bui A, Ding Q, Boulos P, Pampalakis G, Khella H,, Samuel JN, Sotiropoulou G, Yousef GM. (2014) Kallikrein-related peptidase 5 induces mirna-mediated anti-oncogenic pathways in breast cancer. Oncoscience 1: Sieber SA, Mondala TS, Head SR, Cravatt BF. (2004) Microarray platform for profiling enzyme activities in complex proteomes. J Am Chem Soc 126: Sieńczyk M, Oleksyszyn J. (2009) Irreversible inhibition of serine proteases - design and in vivo activity of diaryl alpha-aminophosphonate derivatives. Curr Med Chem 16: Sieńczyk M, Oleksyszyn J. (2006) Inhibition of trypsin and urokinase by Cbz-amino(4- guanidinophenyl) methanephosphonate aromatic ester derivatives: the influence of the ester group on their biological activity. Bioorg Med Chem Lett 16: Simmer JP, Fukae M, Tanabe T, Yamakoshi Y, Uchida T, Xue J, Margolis HC, Shimizu M, DeHart BC, Hu CC, Bartlett JD. (1998) Purification characterization and cloning of enamel matrix serine proteinase 1. J Dental Res 77: Skoreński M, Oleksyszyn J, Sieńczyk M. (2013) Efficient methods for the synthesis of α-aminophosphonate fluoroalkyl esters. Tetrahecron Lett 54: Skytt A, Stromqvist M, Egelrud T. (1995) Primary substrate specificity of recombinant human stratum corneum chymotryptic enzyme. Biochem Biophys Res Commun 211: Soleimany AP, Bhatia SN. (2020) Activity-based diagnostics: An emerging paradigm for disease detection and monitoring. Trends Mol Med 26: Sotiropoulou G, Rogakos V, Tsetsenis T, Pampalakis G, Zafiropoulos N, Simillides G, Yiotakis A, Diamandis EP. (2003) Emerging interest in the kallikrein gene family for understanding and diagnosing cancer. Oncol Res 13:

255 Sotiropoulou G, Pampalakis G, Diamandis EP. (2009) Functional roles of human kallikrein-related peptidases. J Biol Chem 284: Sotiropoulou G, Pampalakis G, Prosnikli E, Evangelatos GP, Livaniou E. (2012b) Development and immunochemical evaluation of a novel chicken IgY antibody specific for KLK6. Chem Cent J 6: 148. Sotiropoulou G, Pampalakis G. (2010) Kallikrein-related peptidases: bridges between immune functions and extracellular matrix degradation. Biol Chem 391: Sotiropoulou G, Pampalakis G. (2012) Targeting the kallikrein-related peptidases for drug development. Trends Pharmacol Sci 33: Sotiropoulou G, Zingkou E, Pampalakis G. (2021) Redirecting drug repositioning to discover innovative cosmeceuticals. Exp Dermatol 30: Soualmia F, Bosc E, Amiri SA, Stratmann D, Magdolen V, Darmoul D, Reboud- Ravaux M, El Amri C. (2018) Insights into the activity control of the kallikrein-related peptidase 6: small-molecule modulators and allosterism. Biol Chem 399: Speers AE, Adam GC, Cravatt BF. (2003) Activity-based protein profiling in vivo using a copper(i)-catalyzed azide-alkyne [3+2] cycloaddition. J Am Chem Soc 125: Spencer B, Michael S, Shen J, Kosberg K, Rockenstein E, Patrick C, Adame A, Masliah E. (2013) Lentivirus mediated delivery of neurosin promotes clearance of wild-type α- synuclein and reduces the pathology in an α-synuclein model of LBD. Mol Ther 21: Spencer B, Valera E, Rockenstein E, Trejo-Morales M, Adame A, Masliah E. (2015) A brain-targeted modified neurosin (kallikrein-6) reduces α-synuclein accumulation in a mouse model of multiple system atrophy. Mol Neurodegener 10: Staub I, Sieber SA. (2008) Beta-lactams as selective chemical probes for the in vivo labeling of bacterial enzymes involved in cell wall biosynthesis antibiotic resistance and virulence. J Am Chem Soc 130: Stefansson K, Brattsand M, Ny A, Glas B, Egelrud T. (2006) Kallikrein-related peptidase 14 may be a major contributor to trypsin-like proteolytic activity in human stratum corneum. Biol Chem 387:

256 Stubbs KA. (2014) Activity-based proteomics probes for carbohydrate-processing enzymes: current trends and future outlook. Carbohydr Res 390: Swedberg JE, Nigon LV, Reid JC, de Veer S. J, Walpole CM, Stephens CR, Walsh TP, Takayama TK, Hooper JD, Clements JA, Buckle AM, Harris JM. (2009) Substrateguided design of a potent and selective kallikrein-related peptidase inhibitor for kallikrein 4. Chem Biol 16: Takahashi D. (2010) Method for selective removal of dibenzofulvene derivative. US A1. Takayama TK, Carter CA, Deng T. (2001) Activation of prostate-specific antigen precursor (pro-psa) by prostin a novel human prostatic serine protease identified by degenerate PCR. Biochemistry 40: Tam J, Henault M, Li L, Wang Z, Partridge AW, Melnyk RA. (2011) An activity-based probe for high-throughput measurements of triacylglycerol lipases. Anal Biochem 414: Tamura H, Kawata M, Hamaguchi S, Ishikawa Y, Shiosaka S. (2012) Processing of neuregulin-1 by neuropsin regulates GABAergic neuron to control neural plasticity of the mouse hippocampus. J Neurosci 32: Tan X, Furio L, Reboud-Ravaux M, Villoutreix B. O, Hovnanian A, El Amri C. (2013a) 1,2,4-Triazole derivatives as transient inactivators of kallikreins involved in skin diseases. Bioorg Med Chem Lett 23: Tan X, Bertonati C, Qin L, Furio L, El Amri C, Hovnanian A, Reboud-Ravaux M, Villoutreix BO. (2013b) Identification by in silico and in vitro screenings of small organic molecules acting as reversible inhibitors of kallikreins. Eur J Med Chem 70: Tan X, Soualmia F, Furio L, Renard JF, Kempen I, Qin L, Pagano M, Pirotte B, El Amri C, Hovnanian A, Reboud-Ravaux M. (2015) Toward the first class of suicide inhibitors of kallikreins involved in skin diseases. J Med Chem 58: Tanimoto H, Underwood LJ, Shigemasa K, Parmley TH, O Brien TJ. (2001) Increased expression of protease M in ovarian tumors. Tumour Biol 22: Teixeira TS, Freitas RF, Abrahão O, Jr Devienne KF, de Souza LR, Blaber SI, Blaber M, Kondo MY, Juliano MA, Juliano L, Puzer L. (2011) Biological evaluation and 224

257 docking studies of natural isocoumarins as inhibitors for human kallikrein 5 and 7. Bioorg Med Chem Lett 21: Tojo G, Fernández M (2006) Chromium-based reagents. In: Tojo G (ed) Oxidation of alcohols to aldehydes and ketones. Series: Basic reactions in organic synthesis. Springer US pp Tuin AW, Mol MA, van den Berg RM, Fidder A, van der Marel GA, Overkleeft HS, Noort D. (2009) Activity-based protein profiling reveals broad reactivity of the nerve agent sarin. Chem Res Toxicol 22: Ulbricht D, Pippel J, Schultz S, Meier R, Sträter N, Heiker JT. (2015) A unique serpin P1' glutamate and a conserved β-sheet C arginine are key residues for activity protease recognition and stability of serpina12 (vaspin). Biochem J 470: Ulmert D, O'Brien MF, Bjartell AS, Lilja H. (2009) Prostate kallikrein markers in diagnosis risk stratification and prognosis. Nat Rev Urol 6: Van Kersavond T, Nguyen M, Verhelst S. (2017) Synthesis and application of activitybased probes for proteases. Methods Mol Biol (Clifton NJ) 1574: Vasilopoulos Y, Sharaf N, di Giovine F, Simon M, Cork MJ, Duff GW, Tazi-Ahnini R. (2011) The 3 UTR AACCins5874 in the stratum corneum chymotryptic enzyme gene (SCCE/KLK7), associated with atopic dermatitis; causes an increased mrna expression without altering its stability. J Dermatol Sci 61: Vasilopoulos Y, Cork J, Murphy R, Williams H.C, Robinson DA, Duff GW, Ward SJ, Tazi-Ahnini R. (2004) Genetic association between an AACC insertion in the 3 UTR of the stratum corneum chymotryptic enzyme gene and atopic dermatitis. J Invest Dermatol 123: Verdoes M, Verhelst SH. (2016) Detection of protease activity in cells and animals. Biochim Biophys Acta 1864: Vickers CJ, González-Páez GE, Wolan DW. (2013) Selective detection of caspase-3 versus caspase-7 using activity-based probes with key unnatural amino acids. ACS Chem Biol 8: Voegeli R, Doppler S, Joller P, Breternitz M, Fluhr JW, Rawlings AV. (2011) Increased mass levels of certain serine proteases in the stratum corneum in acute eczematous atopic skin. Int J Cosmet Sci 33:

258 Walker E, Mann M, Honda K, Vidimos A, Schluchter MD, Straight B, Bogyo M, Popkin D, Basilion JP. (2017) Rapid visualization of nonmelanoma skin cancer. J Am Acad Dermatol 76: e9. Walker B, Wharry S, Hamilton RJ, Martin SL, Healy A, Walker BJ. (2000) Asymmetric preference of serine proteases toward phosphonate and phosphinate esters. Biochem Biophys Res Commun 276: Walley AJ, Chavanas S, Moffatt MF, Esnouf RM, Ubhi B, Lawrence R, Wong K, Abecasis GR, Jones EY, Harper JI, Hovnanian A, Cookson WO. (2001) Gene polymorphism in Netherton and common atopic disease. Nat Genet 29: Wang CLJ, Taylor TL, Mical AJ, Spitz S, Reilly TM. (1992) Synthesis of phosphono peptides as thrombin inhibitors. Tetrahedron Lett 33: Wang S, Olt S, Schoefmann N, Stuetz A, Winiski A, Wolff-Winiski B. (2014) SPINK5 knockdown in organotypic human skin culture as a model system for Netherton syndrome: effect of genetic inhibition of serine proteases kallikrein 5 and kallikrein 7. Exp Dermatol 23: Weiss-Sadan T, Ben-Nun Y, Maimoun D, Merquiol E, Abd-Elrahman I, Gotsman I, Blum G. (2019) A theranostic cathepsin activity-based probe for noninvasive intervention in cardiovascular diseases. Theranostics 9: Willems LI, van der Linden WA, Li N, Li KY, Liu N, Hoogendoorn S, van der Marel GA, Florea BI, Overkleeft HS. (2011) Bioorthogonal chemistry: applications in activity-based protein profiling. Acc Chem Res 44: Woodard SL, Jackson DS, Abuelyaman AS, Powers JC, Winkler U, Hudig D. (1994) Chymase-directed serine protease inhibitor that reacts with a single 30-kDa granzyme and blocks NK-mediated cytotoxicity. J Immunol 153: Wu X, Shi W, Li X, Ma H. (2017) A strategy for specific fluorescence imaging of monoamine oxidase A in living cells. Angew Chem Int Ed Engl 56: Ximerakis M, Pampalakis G, Roumeliotis TI, Sykioti VS, Garbis SD, Stefanis L, Sotiropoulou G, Vekrellis K. (2014) Resistance of naturally secreted α-synuclein to proteolysis. FASEB J 28:

259 Yamasaki K, Schauber J, Coda A, Lin H, Dorschner RA, Schechter NM, Bonnart C, Descargues P, Hovnanian A, Gallo RL. (2006) Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin. FASEB J 20: Yamasaki K, Di Nardo A, Bardan A, Murakami M, Ohtake T, Coda A, Dorschner R. A, Bonnart C, Descargues P, Hovnanian A, Morhenn VB, Gallo RL. (2007) Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nature Med 13: Yamashiro K, Tsuruoka N, Kodama S, Tsujimoto M, Yamamura Y, Tanaka T, Nakazato H, Yamaguchi N. (1997) Molecular cloning of a novel trypsin-like serine protease (neurosin) preferentially expressed in brain. Biochim Biophys Acta 1350: Yan X, Luo Y, Zhang Z, Li Z, Luo Q, Yang L, Zhang B, Chen H, Bai P, Wang Q. (2012) Europium-labeled activity-based probe through click chemistry: absolute serine protease quantification using (153)Eu isotope dilution ICP/MS. Angew Chem Int Ed 51: Yang P, Liu K. (2015) Activity-based protein profiling: recent advances in probe development and applications. Chembiochem 16: Yim JJ, Tholen M, Klaassen A, Sorger J, Bogyo M. (2018) Optimization of a protease activated probe for optical surgical navigation. Mol Pharm 15: Yoon H, Laxmikanthan G, Lee J, Blaber S.I, Rodriguez A, Kogot JM, Scarisbrick IA, Blaber M. (2007) Activation profiles and regulatory cascades of the human kallikreinrelated peptidases. J Biol Chem 282: Yousef GM, Luo LY, Scherer SW, Sotiropoulou G, Diamandis EP. (1999) Molecular characterization of zyme/protease M/neurosin, a hormonally-regulated kallikrein-like serine protease. Genomics 62: Yousef GM, Scorilas A, Magklara A, Soosaipillai A, Diamandis EP. (2000) The KLK7 (PRSS6) gene encoding for the stratum corneum chymotryptic enzyme is a new member of the human kallikrein gene family - genomic characterization mapping tissue expression and hormonal regulation. Gene 254:

260 Yu Y, Prassas I, Dimitromanolakis A, Diamandis EP. (2015) Novel Biological substrates of human kallikrein 7 identified through degradomics. J Biol Chem 290: Zarghooni M, Soosaipillai A, Grass L, Scorilas A, Mirazimi N, Diamandis EP. (2002) Decreased concentration of human kallikrein 6 in brain extracts of Alzheimer s disease patients. Clin Biochem 35: Zhao H, Dong Y, Quan J, Smith R, Lam A, Weinstein S, Clements J, Johnson NW, Gao J. (2011) Correlation of the expression of human kallikrein-related peptidases 4 and 7 with the prognosis in oral squamous cell carcinoma. Head Neck 33: Zhu Y, Underwood J, Macmillan D, Shariff L, O'Shaughnessy R, Harper JI, Pickard C, Friedmann PS, Healy E, Di WL. (2017) Persistent kallikrein 5 activation induces atopic dermatitis-like skin architecture independent of PAR2 activity. J Allergy Clin Immunol 140: Zingkou E, Pampalakis G, Charla E, Nauroy P, Kiritsi D, Sotiropoulou G. (2019) A proinflammatory role of KLK6 protease in Netherton syndrome. J Dermatol Sci 95: Zingkou E, Pampalakis G, Kiritsi D, Valari M, Jonca N, Sotiropoulou G. (2018) Activography reveals aberrant proteolysis in desquamating diseases of differing backgrounds. Exp Dermatol 28: Zingkou E, Pampalakis G, Sotiropoulou G. (2020a) Cathelicidin represents a new target for manipulation of skin inflammation in Netherton syndrome. Biochim Biophys Acta Mol Basis Dis 1866: Zingkou E, Pampalakis G, Sotiropoulou G. (2020b) Exacerbated dandruff in the absence of kallikrein-related peptidase 5 protease. J Dermatol 47:

261 APPENDIX 229

262

263 Figure 142: RT-qPCR expression of inflammatory cytokines. 231

264 A B C Figure 143: ESI-MS of the reaction mixture of biotin-dpeg 4-His(Clt)-Ile-Val- Arg P (Boc)2-(OPh)2 deprotection. 232