China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2"

Περικλῆς Ζυγομαλάς
7 χρόνια πριν
Προβολές:

1 China B iotechnology, 2005, 25 (12) : A tkup ( ) ( ) RNA, RT2PCR,, Km ( ), A tkup1, PCR GUS Southern A tkup1 mrna PCR, PCR 2100bp, A tkup1 ( Genbank No: AF029876) ; GUS A tkup1 29 PCR A tkup1, PCR A tkup1 mrna A tkup1, 45% A tkup1 K +, [ 1 ],,,, [ 3 ], [ 1 ] 4% 5%, 3% 4%, 1% 2%, 2%, 2. 5% [ 4 ], [ 1, 2 ] A tkup1 (A rabidopsis thaliana K + : : ( ) 33 : g_zk@ sohu. com up take) K + [ 5 ],, K +, K +, K + [ 6 ] A tkup1 A tkup T/A pmd182t, ( Agrobacterium tum efaciens) LBA4404 Clontech, pcamb IA21201 DH5 (N icotiana tabacum ) 911 K RNA T4 DNA Promega ; Ex2Taq DNA DNase I PCR SYBR RT2PCR Kit, Sigma AR 1. 3 A tkup1 cdna ( Kim 1998, Genbank No: AF ), R217 (5 2AAAGGATCCAACAATGAACCAATCACCATCTCTTA TC23 ) R219 (5 2AAAGAGCTCTTAGACGTAATAAAC

2 2005, 25 (12) : A tkup1 25 CATTCCAAC23 ), B am H I SacI PCR : A tkup1z (5 2ACGCATAGAGTCGCCTTCATTTTCGCTCCAATC23 ) A tkup1f (5 2CGTCACGAAATGTCCGAAAACAGCTGG AACTCC23 ) ; mrna PCR : A tkup12s2f ( 5 2gTCCTCACTCCAACAATCTC23 ) A tkup12s2r ( 5 2ACCGGTGCTTCTAAGGAACT23 ),, PAGE 1. 4 A tkup1 Promega RNA ( RNAgents total RNA isolation system) RNA, Promega (Reverse Transcrip tion System ) cdna, R217 R219, Ex2Taq DNA PCR, PCR T2 ( pmd182t),, 1. 5 A tkup1 pcamb IA21201, B am H I SacI, A tkup1 pmd182t, T4 pcamb IA21201, A tkup1 pyf , 5mm 5mm, 50m l OD m in,, 9cm, MS0,, 22 3d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 50mg/L + Cb 250mg/L), 20d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 100mg/L + Cb 250mg/L ) 30d,, Jefferson [ 7 ] GUS, GUS (1 /2MS + Km25mg/L + Cb 25mg/L ) 30d, 3 5d, 1. 7 A tkup1 PCR A tkup1 PCR : 94 6m in, s, s, 72 3m in, 30 ; 72 10m in A tkup1 PCR : 94 6m in, s, s, 72 1m in, 30 ; 72 10m in 1. 8 Southern M ichiels [ 8 ] DNA, PstI, 32P A tkup PCR 1. 4 A tkup1 PCR, OD 260 DNA DNA DNA, Promega RNA RNA, O ligo dt, SYBR λ RT2PCR Kit, A tkup12s2f A tkup12s2r, MJ Op ticon 2 PCR, mrna DNA PCR DNA Ct, mrna A tkup1 cdna A tkup1 A tkup1 T1,, A tkup1 PCR, RNA, PCR 1. 11,, ( 45kg/ha) (90kg/ha) ( 135kg/ha) A tkup1 PCR T1,,, 6 12, A lliance A tkup1 RNA R217 R219 PCR 2 100bp, V2GENE DNA,,

3 26 China B iotechnology Vol. 25 No T/A pmd182t, YF5501, 2139bp, Genebank A tkup A tkup1 A tkup1 pmd182t pcamb IA21201 B am H I SacI, T4 A tkup1 pcamb IA21201, A tkup1 pyf7785 ( 1),, SAR ( A llen, 1996, Genebank No. U67919), CaMV 35S + TMV Omega leader sequence Km, ; CaMV 35S + TMV Omega leader sequence nos A tkup1 2 A tkup1 PCR 2 PCR ana lysis of A tkup1 tran sform ed tobacco plan ts Lane1: DNA marker DL2 000; Lane2: Nontransformed tobacco p lants; Lane3: Positive control(a tkup1 gene ) ; Lane4 12: Transgenic tobacco p lants agarose, 32 P A tkup1 (B am H I SacI ) Southern, 29 GUS, ( 3), A tkup , , 9, , A tkup1 py F Con struction of A tkup1 gene plan t expression vector py F GUS A tkup1, Km GUS 29 ( T 0 ), 911 (11 ) K326 (18 ) 2. 4 A tkup1 PCR GUS DNA, A tkup1z A tkup1f, A tkup1 PCR 2, 29 GUS 1. 0 kb 2. 5 A tkup1 Southern DNA PstII, 0. 7% 3 Sourthern 3 Sourthern blot ana lysis of tran sform ed plan ts Lane1: Nontransformed tobacco p lants; Lane2: Positive control ( YF7783 digested with PstI ) ; Lane3 12: Transgenic tobacco plants Note: Genom ic DNA were digested with PstI, followed by hybridization with A tkup1 gene p rob 2. 6 A tkup1 Southern 5, RNA DNA DNA, PCR, 4 DNA S1 S2 S3 S4 S5 Ct

4 2005, 25 (12) : A tkup A tkup1 m RNA 5 A tkup1 PCR 4 The rea ltim e PCR testing of A tkup1 5 The standard curve of C t vs A tkup1 copes m RNA in tran sgenetic roots DNA 5, Y = 222X ; r 2 = , PCR, 1 1, A tkup1 5 T1 mrna, mrna : 911 K m RNA Table 1 The mrna analysis of A tkup1 in transgenetic roots DNA template Ct Value copys of Target sequence Standard S References S S S S S0 0 S Test samp les Table 2 The chem ica l con ten ts of A tkup1 tran sform ed tobacco leaves T 0 K 2 O ( % ) P 2 O 5 ( % ) N ( % ) Cl( % ) sugar( % ) nicotine ( % ) p rotein ( % ) LY LY LY LY K K K K LY9112ck K3262ck , 2. 45%, 45% ;, 18. 5%, 3,,,,,,,,

5 28 China B iotechnology Vol. 25 No ,,,,,,,,, K +, A tkup1,, : A tkup1 45%, [ 1 ],.., 1993, 25 (3) : Cao ZH H, Hu G S. Soil, 1993, 25 (3) : [ 2 ],.., 1998, 4 (2) : Huang SH W, Jin J Y. Plant Nutrition and Fertilizer Science, 1998, 4 (2) : [ 3 ] Chaplin J R. Production factors affecting chemical compounds of the tobacco leaf. Recent Advances of Tob Sci, 1980, (6) : 3 63 [ 4 ] Sim s J L, CasyM, Legget J E, et al. Effect of transp lant water fertilization on growth and chem ical composition of burley tobacco. Annual Report of the College of Agriculture and the K Y Agri Exp Stn, 1981, [ 5 ] Kim E J, Kwak J M, Uozum i N, et al. A tkup1: an A rabidopsis gene encoding high2affinity potassium transport activity. Plant Cell, 1998, 10 (1) : [ 6 ] Fu H H. A tkup1: A dual2affinity K + transporter from A rabidopsis. The Plant Cell, 1998, 10 (1) : [ 7 ] Jefferson R A, Kavanagh T A, Bevan M W. GUS fusions: beta2 glucuronidase as a sensitive and versatile gene fusion marker in higher p lants. EMBO J, 1987, 6 (13) : [ 8 ] M ichiels A, Van den Ende W, Tucker M, et al. Extraction of high2quality genom ic DNA from latex2containing plants. Anal B iochem, 2003, 315 (1) : [ 9 ] Ahn S J, Shin R, SchachtmanD P. Exp ression of KT / KU P genes in A rabidopsis and the role of root hairs in K + up take. Plant Physiology, 2004, 134 (3) : Tran sgen ic Tobacco w ith A rabidopsis tha liana A tkup1 Gene Ha s H igh Pota ssium Con ten t in L eaves GUO Zhao2kui 1 YANG Q ian 1 YAO Quan2hong 2 WAN Xiu2qing 3 YAN Pei2qiang 3 (1 Harbin Institute of Technology L ife Sciences & Engineering Dep t Harbin , China) (2 Shanghai Academy of Agriculture Science Shanghai , China) (3 Heilongjiang Tobacco Research Institute Mudanjiang , China) Abstract Total RNA was isolated from the roots of A rabidopsis thaliana, and A tkup1 gene was amp lified using RT2PCR methods. The PCR p roduct was cloned into pmd182t, which named YF5501. After sequencing, the DNA fragment which containing A tkup1 gene was cloned into the p lant binary exp ression vector containing intron kanam ycin gene, and introduced into tobacco varieties by Agrobacterium mediated transformation. YF5501 contained the same sequence of A tkup1 gene ( Genebank No: AF029876). 29 transgenic p lants of tobacco were obtained and p roved by PCR, GUS, Southern blot and realtim e PCR analysis. The results of chem ical content assays confirmed that A tkup1 gene had been exp ressed effectively in the modified p lants and the potassium content in the tobacco leaves had been increased up to 45%. Key words A tkup1 Transgenic tobacco K + content

Σχετικά έγγραφα

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene 2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study