Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer
|
|
- Ἀπφία Γερμανός
- 7 χρόνια πριν
- Προβολές:
Transcript
1 ACTA CHIMICA SINICA Vol No a b a a Ξ a a Ξ ( a ) ( b ) 5 PCR PCR PCR amol/ L R 2 = PCR (PCR) Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer HUANG Yan2Ping a b KONG De2Ming a ZHANG Xiao2Bin a SHEN Han2Xi Ξ a MI Huai2Feng a ( a State Key Laboratory of Functional Polymer Materials for Adsorption and Separation Chemical School Nankai University Tianjin ) ( b College of Pharmacy Tianjin Medical University Tianjin ) Abstract To specific target sequence of telomerase product a fluorogenic duplex scorpion primer has been designed A probe element attached at the 5 2end of it can specifically detect target gene A PCR blocker carbon chain with C 3 group whose length is as the same as a base pair is joined between the primer sequence and the probe in the duplex scorpion primer A fluorescence signal is only produced when the probe sequence is hybridized with the target gene in the extended duplex scorpion primer Using this technology a novel method has been developed for quantitative assay of telomerase product by real2time PCR Accurate quantitative assay can be achieved with sample detected within amol/ L under fast cycling conditions The linear correlation factor R 2 = The method is specific simple and without post2pcr manipulation Keywords duplex scorpion primer telomerase real2time assay polymerase chain reaction (PCR) ( Telemetric repeat ( TTAGGG) amplification protocol TRAP) [2] (10 50 kb) TRAP (Polymerase chain reaction PCR) RNA [1] ; PCR Ξ E2mail : com Received September ; revised December ; accepted January (No )
2 No 3 : TRAP PCR PCR 2 5 L 10 TRAP [ 200 [3] mmol/ L Tris2HCl (ph = 8 3) 10 mmol/ L EGTA 630 mmol/ L [4] [5] [6] KCl 0 05 % Tween220 1 mg/ ml BSA ] 0113 L dntps [7] PCR (datp dttp dctp dgtp 10 mmol/ L) 2U Taq PCR 1 5 L MgCl 2 (25 mmol/ L) 1 4 L (75 g/ ml) PCR 0 5 L PP/ 2 5 L QP (25 mol/ L) 2 8 L (36 g/ ml) 2 L R5 25 L :95 3 min 1 ;94 30 s s (real2time) 27 PCR PCR 25 L PCR 12 % TRAP ( 130 V) 2 3 h PCR (ethidium bromide) PCR ( ) L TRAP PP QP MgCl 2 ( 1 3 1) PCR :95 15 s s min (TaqMan2 [8] [9] ) (Duplex scorpion primer DSP) PCR 2 1 PCR Kim [10] TRAP DSP ( R5) DSP R GeneAmp R 5700 PCR ( ABI ) DF2D ( ) [ CCCTAA] [11] 3 ( UVI tec ) RF2540 ( PCR (PCR2blocker) ( ) F2Q210 ( Starna Brand) ) PCR 1 2 DSP ( Probe Primer PP ) : FAM PCR DSP PP 5 FAM ; QP DABCYL PP DSP [ CCCTAA] 3 2 2AATCCGTCGAGCAGAGTT23 ( ( 1 A) PCR ) ( 1 B) (Quencher probe QP) : 5 2[ TTAGGG] DABCYL DSP Taq : 5 2 ( 1 C) PCR DSP AATCCGTCGAGCAGAGTT23 : 5 2GCGCGG [ CT T2 ACC] 3 CTAACC23 ( ( 1 D) Michael Zuker mfold( PCR 3 1) [12] ) [10] ( ) R5 : 5 2 AATCCGTCGAGCAGAGTTAG[ GGTTAG] 4 23 (molecularbeacon) PP
3 276 Vol QP PCR PCR T m PP QP DSP 2 3 PP QP DSP PP DSP FAM 495 nm ; QP DABCYL 479 nm DSP PP QP [13] DSP DABCYL FAM 1 DSP Figure 1 Assay principle of DSP 2 2 DSP 2 DSP QP 3 DSP Figure 3 Absorption spectra of DSP 1 PP ; 2 QP ; 3 DSP PP 2 4 QP PP DSP T m = mmol/ L MgCl 2 TRAP PP 0 3 mol/ L QP 95 5 min : E ff = [ 1 - ( F q - F b ) / ( F uq - F b ) ] 100 % [14] F uq F q F b PP PP QP ( 1) QP PP > 1 97 % PCR QP QP PP 5 1 PP QP DSP 2 DSP (1) (2) 2 5 DSP Figure 2 Fluorescence melting curve (1) and the derivative curve (2) DSP TRAP of DSP
4 No 3 : 277 c (QP) c (PP) 1 DSP Table 1 Quenching efficiencies of DSP PCR :95 3 min s 45 3 s 40 E ff PCR R5 DSP PCR ( 4) DSP DSP ; (50bp 56bp R ) [10] DSP 5 DSP R5 (amol/ L) DSP DSP Figure 5 Amplification plots using DSP for quantitative assay of R5 18 DSP (amol/ L) 2 7 PCR R amol/ L DSP PCR amol/ L R5 C T ( 6) R ; 0 15 amol/ L 4 (1 4) DSP (5 8) ; R5 Figure 4 Gel electrophoresis of PCR products using upstream primer (1 4) or DSP (5 8) water as reference ; R5 as template 2 6 PCR DSP 1 s [14] ( 94 6 DSP TRAP R5 0 s 0 s 3 s 100 ) Figure 6 Standard curve for detection of R5 using the DSP by TRAP PCR 60 [10] assay ( ) PCR 45 PCR PCR ( 5) 3 Whitcombe [15 16] PCR ( C T ) PCR PP TaqMan 40 C T Solinas [17] 40
5 278 Vol Uehara H ; Nardone G ; Nazarenko I ; Hohman R J Biotechniques PCR ( HEG) 6 Szatmari I ; Tokes S ; Dunn C B ; Bardos T J ; Aradi C 3 (DABCYL) J Anal Biochem DSP PCR PCR 7 Xu S ; He M ; Yu H ; Cai X ; Tan X ; Lu B ; Shu B Anal Biochem Kong D2M ; Gu L ; Shen H2X ; Mi H2F Acta Chim Sinica (in Chinese) ( ) 9 Kong D2M ; Shen H2X Chin J Chem Kim N W ; Wu F Nucleic Acids Res Hultdin M ; Grgnlund E ; Norrback K F ; Eriksson2 References 1 Granger M P ; Wright W E ; Shay J W Crit Rev Oncology/ Hematology Kim N W ; Piatyszek M A ; Prowse K R ; Harley C B ; West M D ; Ho P L ; Coviello G M ; Wright W E ; Weinrich S L ; Shay J W Science Hirose M ; Abe2Hashimoto J ; Ogura K ; Tahara H ; Ide T ; Yoshimura T J Cancer Res Clin Oncol Gelmini S ; Caldini A ; Becherini L ; Capaccioli S ; Pazzagli M ; Orlando C Clin Chem Lindstrgm E ; Just T ; Roos G Nucleic Acids Res http :/ / www bioinfo rpi edu/ applications/ mfold/ old/ dna/ form1 cgi 13 Fang X H ; Li J J ; Perlette J ; Tan W H ; Wang K M Anal Chem A 14 Tyagi S ; Kramer F R Nat Biotechnol Whitcombe D ; Theaker J ; Guy S P ; Brown T ; Little S Nat Biotechnol Thelwell N ; Millington S ; Solinas A ; Booth J ; Brown T Nucleic Acid Res Solinas A ; Brown L J ; McKeen C ; Mellor J M ; Nicol J T G ; Thelwell N ; Brown T Nucleic Acids Res e96 (A PAN B F ; FAN Y Y )
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Διαβάστε περισσότερα8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Διαβάστε περισσότεραStudies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Διαβάστε περισσότεραPotentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph
2004 62 20, 2062 2066 ACTA CHIMICA SINICA Vol 62, 2004 No 20, 2062 2066 ΞΞ ( 400715) (AET) ( GCE), (NG), (Cys) ( GA) (anti2diph), (Diph), 24 600 ng ml - 1, 8 9 mv/ decade, 0 9979, 5 2 ng ml - 1,,,,, Potentiometric
Διαβάστε περισσότεραInvestigation on Fast Determination of Trace N2Nitrosamines Assisted by Microwave Radiation
2002 60 5, 876 881 ACTA CHIMICA SINICA Vol 60, 2002 No 5, 876 881 Ξ ( 210093), NOBr NO x ( x < 2),, CrO 3, NO x ( x < 2) NO 2, 90 %, (TEA) (76 % 96 %) ; 2 10-8 mol/ L /,, 3 min, ( ),, Investigation on
Διαβάστε περισσότεραStudy of Ne w Chemiluminescence Technique Recognition of Sodium Azide by External Reference Method
2004 62 8, 794 798 ACTA CHIMICA SINICA Vol 62, 2004 No 8, 794 798 Ξ Ξ ( 200032),, : :H 2 O 2 2CH 3 CN2 ( ) H 2 O 2 2CH 3 CN2N2 252 ( ),,, IgG Study of Ne w Chemiluminescence Technique Recognition of Sodium
Διαβάστε περισσότεραVBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Διαβάστε περισσότεραRapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Διαβάστε περισσότεραStudies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones
2002 60 7, 1303 1310 ACTA CHIMICA SINICA Vol. 60, 2002 No. 7, 1303 1310 2( 1 H21,2,42 212 )2 2 ( 300071) Ξ Ξ 22(1 H21,2,42 212 )222 212 (2) 1,42, 3,,. R 1, R 1 = (CH 3 ) 3 C, R 1 = Ar, Ar., 1,42,, Studies
Διαβάστε περισσότεραStudies on the Interaction between Copper( ) Complex with Phenanthroline and L2Methionine Ligands and D NA
2003 61 2, 245 250 ACTA CHIMICA SINICA Vol 61, 2003 No 2, 245 250 ( ) DNA a, b c b a Ξ, a b b b Ξ ( a 510275) ( b 510631) ( c 510642) ph = 6186, ( ) ( EB) [ Cu (phen) ( H 2 O) ( L2Met) ] + (phen = 1,102,
Διαβάστε περισσότεραΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Διαβάστε περισσότεραΔΡΑΣΤΗΡΙΟΤΗΤΑ ΤΗΣ ΤΕΛΟΜΕΡΑΣΗΣ ΣΤΟ ΓΥΝΑΙΚΟΛΟΓΙΚΟ ΚΑΡΚΙΝΟ. Α.Τσίπης, Α.Μ. Αθανασιάδου, Π. Αθανασιάδου
ΔΡΑΣΤΗΡΙΟΤΗΤΑ ΤΗΣ ΤΕΛΟΜΕΡΑΣΗΣ ΣΤΟ ΓΥΝΑΙΚΟΛΟΓΙΚΟ ΚΑΡΚΙΝΟ Α.Τσίπης, Α.Μ. Αθανασιάδου, Π. Αθανασιάδου ΠΕΡΙΛΗΨΗ Η τελομεράση είναι ριβονουκλεϊνικό πρωτεϊνικό ένζυμο που πολυμερίζει και συνεπώς αυξάνει τις
Διαβάστε περισσότεραMetal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Διαβάστε περισσότεραA Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon
13 1 Vol13 No1 29 2 Life Science Research Feb 29 29 *,,,,, 4182 :,, (Molecular Beacon, MB),,,, 5~5 U / ml, 5 U / ml, Alu : ; ; : Q55 : A : 17-7847(29)1-6-5 A Novel Fluorescence Assay for the Activity of
Διαβάστε περισσότεραElectrochemical Study on the Interaction of D NA with Several Surfactants
2003 61 1 22 28 ACTA CHIMICA SINICA Vol 61 2003 No 1 22 28 DNA Ξ Ξ ( 430072) - (MB) DNA DNA DNA DNA MB MB DNA DNA ( ) DNA MB DNA Electrochemical Study on the Interaction of D NA with Several Surfactants
Διαβάστε περισσότερα4, Cu( II), Zn( II)
2004 62 22, 2259 2264 ACTA CHIMICA SINICA Vol 62, 2004 No 22, 2259 2264 4,52 292 Cu( II), Zn( II) Ξ Ξ ( 710069) 4,52 292 (dafo) Cu( II), Zn( II) [ Cu(dafo) 2 (H 2 O) 2 ] (NO 3 ) 2 [ Zn(dafo) 2 (H 2 O)
Διαβάστε περισσότεραProtease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Διαβάστε περισσότεραΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότεραsvari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότεραSUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Διαβάστε περισσότεραSupporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Διαβάστε περισσότεραStudies on Diazetetraene Cobalt( ) Metallic Complex as Neutral Carriers for the Preparation of Salicylate2Selective Ion Electrodes
2002 60 12, 2192 2196 ACTA CHIMICA SINICA Vol 60, 2002 No 12, 2192 2196 ( 400715) Ξ Ξ ( ) {3,3 2[1,22 ( ) ] 22,42 ( ) } [ Co ( )2EBIBP] (Sal - ), Hofmeister, Sal - µ I - > SCN - > NO 2 - > SO 2 4 - > NO
Διαβάστε περισσότεραReaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Διαβάστε περισσότεραReal-Time PCR Mycoplasma pneumoniae
148 2009 Real-Time PCR Mycoplasma pneumoniae 20 12 26 21 5 11 10 30 Mycoplasma pneumoniae real-time PCR M. pneumoniae 3 SYBR Green I Light Cycler 2.0 system (Roche) PCR 45 PCR primer M. pneumoniae 16S
Διαβάστε περισσότεραStudy on the Electrochemical Behaviors of Vincristine and the Interaction of Vincristine with Tubulin
2004 62 2, 137 141 ACTA CHIMICA SINICA Vol 62, 2004 No 2, 137 141 a, b Ξ, a a a Ξ ( a 100875) ( b 100080) 0105 mol/ L Tris, 0115 mol/ L NaCl, (VCR) - 1168 V (vs Ag/ AgCl), 110 10-8 210 10-7 mol/ L VCR,
Διαβάστε περισσότεραApproximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Διαβάστε περισσότεραAutoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide Value
368 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.2, -02-1- (,**1) 6 Autoxidation of Commercial Edible Oils and Emulsified Liquid Type Dressing by the Simple Method for the Determination of Peroxide
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότεραSeparation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection
31 2 2012 2 FENXI CESHI XUEBAO Journal of Instrumental Analysis Vol. 31 No. 2 127 ~ 132 - * 730070 PB - Eu - 3 8 min 0. 025 ~ 10 0. 025 ~ 25 0. 05 ~ 10 mg /L 3 1. 00 mg /L 3 6 RSD 4. 5% 0. 95% 3 101%~
Διαβάστε περισσότεραSupporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Διαβάστε περισσότεραCopper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Διαβάστε περισσότεραStudy on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Διαβάστε περισσότεραFENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Διαβάστε περισσότεραCollege of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Διαβάστε περισσότεραN 2. Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites and Molecular Sieves
2003 61 3, 376 381 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 376 381 N 2 Ξ Ξ ( 210093), N 2 (NNN) NNN ; NNN :NNN N N O NNN, N 2,,,, Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites
Διαβάστε περισσότερα9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Διαβάστε περισσότεραTABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Διαβάστε περισσότεραA facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Διαβάστε περισσότεραStudy of In-vehicle Sound Field Creation by Simultaneous Equation Method
Study of In-vehicle Sound Field Creation by Simultaneous Equation Method Kensaku FUJII Isao WAKABAYASI Tadashi UJINO Shigeki KATO Abstract FUJITSU TEN Limited has developed "TOYOTA remium Sound System"
Διαβάστε περισσότεραACTA CHIMICA SINICA . :AAO. H 3 PO 4 AAO AAO. Unstable Growth of Anodic Aluminum Oxide Investigated by AFM
2004 62 7, 680 685 ACTA CHIMICA SINICA Vol 62, 2004 No 7, 680 685 AFM a b Ξ, a Ξ ( a 730000) ( b 730000) (AFM) (AAO) :AAO H 3 PO 4 AAO ; H 2 C 2 O 4 AAO,,, AAO, Y T (AFM), (AAO),, Unstable Growth of Anodic
Διαβάστε περισσότεραQuantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Διαβάστε περισσότεραA strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Διαβάστε περισσότεραN 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
Διαβάστε περισσότερα, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Διαβάστε περισσότεραGro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Διαβάστε περισσότεραAnalysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis
2012 3 Vol. 30 No. 3 March 2012 Chinese Journal of Chromatography 304 ~ 308 DOI 10. 3724 /SP. J. 1123. 2011. 11015 * 210009 9. 5% v /v 80 2 h 234 nm 60 cm 50 cm 50 μm 25 20 kv 350 mmol /L ph 10. 21 3.
Διαβάστε περισσότεραNMR Studies on Interactions between Diperoxovanadate Complexes and 1-Methylimidazole
2007 65 Vol. 65, 2007 16, 1548 1554 ACTA CHIMICA SINICA No. 16, 1548 1554 NMR N- a,b a a a *,a,b a *,b ( a 411201) ( b 361005), (0.15 mol/l NaCl ), ( 1 H, 13 C 51 V) (COSY) NMR [OV(O 2 ) 2 LL'] n [n 1
Διαβάστε περισσότεραLewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Διαβάστε περισσότεραα 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Διαβάστε περισσότερα( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Διαβάστε περισσότεραSupporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Διαβάστε περισσότεραCongruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Διαβάστε περισσότεραHeterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics
Supporting Information (SI) Heterobimetallic Pd-Sn Catalysis: Michael Addition Reaction with C-, N-, -, S- Nucleophiles and In-situ Diagnostics Debjit Das, a Sanjay Pratihar a,b and Sujit Roy c * a rganometallics
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραSupporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Διαβάστε περισσότεραESI for. A simple and efficient protocol for the palladium-catalyzed. ligand-free Suzuki reaction at room temperature in aqueous DMF.
ESI for A simple and efficient protocol for the palladium-catalyzed ligand-free Suzuki reaction at room temperature in aqueous DMF Chun Liu,* Qijian i, Fanying Bao and Jieshan Qiu State Key Laboratory
Διαβάστε περισσότεραSupplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
Διαβάστε περισσότεραect of Modified Wheat Starches on the Textural Properties of Baked Products, such as Cookies
224 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. // No. /. - (**2) 22 * * E# ect of Modified Wheat Starches on the Textural Properties of Baked Products such as Cookies Atsuko Higo and Yoshiko Wada* Bunkyo
Διαβάστε περισσότερα) ; GSP ) ;PXD g, 100 ml
30 (FENXI HUAXUE) 10 2002 10 Chinese Journal of Analytical Chemistry 1163 1167 3 3 3 (, 225002) PVC, 1. 0 10-4 1. 0 10-8 molπl, 58. 6 mvπdecade ; 2. 5 10-9 molπl, 2 3,,,,, 1, PVC Pretsch 1, EDTA,, 5 10-12
Διαβάστε περισσότεραTelomerase: the expression and regulatory mechanisms in preovulatory ovarian granulosa cells
714 Acta Physiologica Sinica, December 25, 2005, 57 (6): 714-718 http://www.actaps.com.cn 1 2, 2 1 2 330006 (telomeric repeat amplification protocol-enzyme linked immunoadsordent assay, TRAP-ELISA) (radioimmunoassay,
Διαβάστε περισσότεραTechnical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1
No. +- 0 +3,**1 Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. * Construction of the General Observation System for Strong Motion in Earthquake
Διαβάστε περισσότεραCopper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Διαβάστε περισσότερα- A. A Biphenol A BPA BPA BPA LLE 5 SPE Electrospinning Kang. Packed-fiber solid-phase extraction PFSPE 1 ml
38 200 4 FENXI HUAXUE Chinese Journal of Analytical Chemistry 4 503 ~ 507 DOI 0. 3724 /SP. J. 096. 200. 00503 6 - A * 2 2 * 2 20009 2 20096 6 - A ph 6 0 ml ph 8. 0 3 ml /min. 5 mg 6 300 μl A 6 0. 20 ~
Διαβάστε περισσότεραAntimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Διαβάστε περισσότεραSupporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Διαβάστε περισσότερα[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Διαβάστε περισσότεραResonance Rayleigh Scattering Spectra of Interaction of Aminoglycoside Antibiotics with Trypan Red and Their Analytical Applications
2003 61 8, 1287 1293 ACTA CHIMICA SINICA Vol 61, 2003 No 8, 1287 1293 a Ξ, a, b a Ξ ( a 400715) ( b 400715), (TR) ( KANA) (NEO) ( GEN) (TOB) (RRS), RRS RRS, 400 535 nm, 400 nm, 01013 610 g ml - 1 RRS,
Διαβάστε περισσότεραΤεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής
Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής
Διαβάστε περισσότεραCdSe Hg? CdTe. Cu 2 + CdTe DNA. CdS / CdS /DNA NPs 10. CdSe /D-Pen /L-Cys Eeinburgh AFS-230E. D % Avocado Research Chemicals L- 98%
38 2010 10 FENXI HUAXUE Chinese Journal of Analytical Chemistry 10 1405 ~ 1410 DOI 10. 3724 /SP. J. 1096. 2010. 01405 CdSe Hg? * 510631 D- L- CdSe Hg? Hg? Cd 2 + HSe - D-Pen L-Cys 1 0. 25 2 1. 2 ph = 7.
Διαβάστε περισσότεραPrey-Taxis Holling-Tanner
Vol. 28 ( 2018 ) No. 1 J. of Math. (PRC) Prey-Taxis Holling-Tanner, (, 730070) : prey-taxis Holling-Tanner.,,.. : Holling-Tanner ; prey-taxis; ; MR(2010) : 35B32; 35B36 : O175.26 : A : 0255-7797(2018)01-0140-07
Διαβάστε περισσότερα, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Διαβάστε περισσότερα1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Διαβάστε περισσότεραOptimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Διαβάστε περισσότεραSFO-DLLME 12 DLLME DLLME SFO-DLLME. 1 L NaCl 1 mol /L H 3 PO 4
38 2010 10 FENXI UAXUE Chinese Journal of Analytical Chemistry 10 1400 ~ 1404 DOI 10. 3724 /P. J. 1096. 2010. 01400 - - * 442700 442000 - FO-DLLME - 3 24 1-200 μl 300 μl 1. 2 g NaCl 1 mol /L 3 PO 4 200
Διαβάστε περισσότεραhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Syntheses and structures of copper complexes of
Διαβάστε περισσότεραSupplementary material
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2015 Supplementary material Recyclable
Διαβάστε περισσότεραMetallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )
23 6 2003 12 Metallurgical Analysis :1000-7571(2003) 06-0024 - 09 3, (, 130022) : (19982001), 147 :; :O657132 :A,,Cu 2 + 4,22 2, ph10 Cu + 2,2 2 (Bi2qu) (BPB) Cu(Bi2 qu) 2 BPB,, [13 ] BPB (19982001) Cu
Διαβάστε περισσότεραDiscovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents
Discovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents Jinfeng Wang, Lin Zhang, Xiaoyan Pan, Bingling Dai, Ying Sun, Chuansheng Li, Jie Zhang School of Pharmacy,
Διαβάστε περισσότερα2. Chemical Thermodynamics and Energetics - I
. Chemical Thermodynamics and Energetics - I 1. Given : Initial Volume ( = 5L dm 3 Final Volume (V = 10L dm 3 ext = 304 cm of Hg Work done W = ext V ext = 304 cm of Hg = 304 atm [... 76cm of Hg = 1 atm]
Διαβάστε περισσότερα17 min R A (2009) To probe into the thermal property the mechanism of the thermal decomposition and the prospective
( 31001) (CDZ)CDZCDZ GAMSSCDZCDZ (DSC)CDZCDZ (G) DakinCDZ 1 1 CDZ a =173.9 kj mol min -1 CDZ 17 min A=.69 10 A=1.175 10 17 R97.14A1007-7693(009)1-1019-05 a =17.3 kj mol 1 Mechanism and Kinetics of hermal
Διαβάστε περισσότεραCapillary Gel Electrophoresis for Ligase Detection Reaction Products
THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko
Διαβάστε περισσότεραSupporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 16 Supporting Information Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Διαβάστε περισσότεραThe pathway of the ozonation of 2,4,62trichlorophenol in aqueous solution
25 12 2005 12 Acta Scientiae Circumstantiae Vol. 25,No. 12 Dec., 2005,. 2,4,62 [J ].,2005,25 (12) :1619-1623 PI Yunzheng, WANGJianglong. The pathway of the ozonation of 2,4,62trichlorophenol in aqueous
Διαβάστε περισσότεραFood Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR
Food Research And Development 2011 9 32 9 69 Ara h1 * 518060 Ara h1 GenBank Ara h1 DNA AF432231 2 SYBR Green -CT 2 8 Ara h1 SYBR Green 3 10 2 3 10 8 copies R 2 0.993 5 3 10 3 copies 2 8 2 Ara h1 Ara h1
Διαβάστε περισσότεραStudy on Re-adhesion control by monitoring excessive angular momentum in electric railway traction
() () Study on e-adhesion control by monitoring excessive angular momentum in electric railway traction Takafumi Hara, Student Member, Takafumi Koseki, Member, Yutaka Tsukinokizawa, Non-member Abstract
Διαβάστε περισσότεραElectrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Διαβάστε περισσότεραRh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A. new Entry to N-Carbamate Protected Arylamines
Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A new Entry to N-Carbamate Protected Arylamines Bing Zhou,* Juanjuan Du, Yaxi Yang,* Huijin Feng, Yuanchao Li Shanghai Institute of Materia Medica,
Διαβάστε περισσότεραFree Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Διαβάστε περισσότεραand Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Polymer hemistry This journal is The Royal Society of hemistry 2011 Phosphoric and Phosphoramidic Acids as Bifunctional atalysts for the Ring-pening Polymerization
Διαβάστε περισσότεραApplication of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy
37 6 2004 6 Journal of Tianjin University Vol. 37 No. 6 Jun. 2004 Ξ 1,2, 1,2, 3 (1., 300072 ; 2. 2, 300072 ; 3., 300072) :,,,.,,(RMSEP) 53 %58 %.. : ; ; : O657. 33 : A : 04932 2137 (2004) 062 05352 05
Διαβάστε περισσότεραPreparation and Application of Amorphous Alloy Catalyst
17 4 2005 7 PROGRESS IN CHEMISTRY Vol. 17 No. 4 Jul., 2005 3 ( 300072), XRD EXAFS DSC SEM TEM XPS : O643136 ; TQ42618 : A : 10052281X(2005) 0420614208 Preparation and Application of Amorphous Alloy Catalyst
Διαβάστε περισσότεραH 3 {[ Cu( en) 2 ] 5 [ ( VO) 12 O 6 B 18 O 42 ] }[ B( OH) 3 ] 2 16 H 2 O
2004 62 4, 391 398 ACTA CHIMICA SINICA Vol 62, 2004 No 4, 391 398 H 3 {[ Cu( en) 2 ] 5 [ ( VO) 12 O 6 B 18 O 42 ] }[ B( OH) 3 ] 2 16 H 2 O a Ξ, a, b a, b a a a Ξ ( a 350002) ( b 350002) H 3 BO 3, NH 4
Διαβάστε περισσότεραStudy on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Διαβάστε περισσότεραD-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Διαβάστε περισσότεραEmulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Διαβάστε περισσότερα