SUPPLEMENTARY MATERIALS

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "SUPPLEMENTARY MATERIALS"

Transcript

1 Fasanaro et al. supplementary materials SUPPLEMENTARY MATERIALS mrna quantification by Real Time-PCR (qpcr). To analyze mrna levels using tsybr-green q-pcr, the following primers were used: ADENYLATE KINASE-3_FWD 5 -CGTTGGATTCACCCTCCTAGC-3 ADENYLATE KINASE-3_REV 5 -GCTGGACTAACGGTTCACCA-3 ADRENOMEDULLIN_FWD 5 -GGAAGAGGGAACTGCGGATGT-3 ADRENOMEDULLIN_REV 5 -GGCATCCGGACTGCTGTCT-3 ALDOLASE-C_FWD 5 -GGCTGCCACTGAGGAGTTC-3 ALDOLASE-C_REV 5 -CTGCTGCTCCACCATCTTCT-3 BNIP3 (BCL2/adenovirus E1B 19kDa protein-interacting protein 3)_FWD 5 - CAGGGCTCCTGGGTAGAACT-3 BNIP3 (BCL2/adenovirus E1B 19kDa protein-interacting protein 3)_REV 5 - CTCCGTCCAGACTCATGCTG-3 CXCR4_FWD 5 -CAGTGGCCGACCTCCTCTT-3 CXCR4_REV 5 -GGACTGCCTTGCATAGGAAGTT-3 EFNA3_FWD 5 -CACTCTCCCCCAGTTCACCAT-3 EFNA3_REV 5 -CGCTGATGCTCTTCTCAAGCT-3 ENOLASE-1_FWD 5 -GCCTCCTGCTCAAAGTCAAC-3 ENOLASE-1_REV 5 -AACGATGAGACACCATGACG-3 GLUT-1 (Glucose transporter 1)_FWD 5 -GATTGGCTCCTTCTCTGTGG-3 GLUT-1 (Glucose transporter 1)_REV 5 -TCAAAGGACTTGCCCAGTTT-3 HIF1α_FWD 5 -CGTTCCTTCGATCAGTTGTC-3 HIF1α_REV 5 -TCAGTGGTGGCAGTGGTAGT-3 HIF2α_FWD 5 -GCGCTAGACTCCGAGAACAT-3 HIF2α_REV 5 -TGGCCACTTACTACCTGACCCTT-3 Hum Beta Actin_FWD: 5 -CCAGCTCACCATGGATGATG-3 Hum Beta Actin_REV: 5 -ATGCCGGAGCCGTTGTC-3 IGF2_FWD 5 -CCGTGCTTCCGGACAACTT-3 IGF2_REV 5 -CTGCTTCCAGGTGTCATATTGG-3 PAI-1 (Plasminogen Activator Inhibitor 1)_FWD 5 -CACAAATCAGACGGCAGCACT-3 PAI-1 (Plasminogen Activator Inhibitor 1)_REV 5 -CATCGGGCGTGGTGAACTC-3 VEGFA_FWD 5 -CAACATCACCATGCAGATTATGC-3 VEGFA_REV 5 -TCGGCTTGTCACATTTTTCTTGT-3 VEGF-R _REV 5 - AGTGGAGTACGTGAAGCCGC -3 VEGF-R_FWD 5 -AACTAGGCGACCTGCTGCAA-3 Acidosis and hypoxia. To induce acidosis and hypoxia, 60-70% confluent (6-7x10 3 /cm 2 ) cells were incubated in defined atmosphere chambers (Billups-Rothenberg Inc.). To induce acidosis, cells were placed in the chamber and then an appropriate gas mixture of either 20% CO 2-80% air or 25% CO 2-75% air was injected for 20 min, yielding ph of 7.0 and 6.6, respectively (1). Thereafter, the chamber was sealed and incubated at 37 C for the indicated time. Similarly, to induce hypoxia, a gas mixture of 5% CO 2-95% N 2 was used, yielding about 1% O 2 (2,3) as measured using an ISO2 MarkII oxygen meter and electrode and Duo-18 software (World Precision Instruments) (4). In O 2 dose-response experiments, an hypoxic incubator was used (Forma series II incubator mod. 3131). In this case, O 2 tension is continuously monitored and adjusted to the desired value by N 2 injections. Where indicated, 1

2 Fasanaro et al. supplementary materials hyper-buffered medium (EGM-2 supplemented with 25mM HEPES, ph 7.4) was added immediately before the hypoxic treatment. Small Interfering RNA-mediated Gene Silencing. Small interfering RNAs (sirna) targeting HIF1α, HIF2α or a scramble sequence (Santa Cruz) were transfected into HUVEC, according to manufacturer instruction. Briefly, cells were plated in Pen-Strep free medium and transfected the next day using sirna Transfection Reagent (Santa Cruz). At the time of transfection, cells were 40% confluent (4x10 3 /cm2). After 8 hours, cells were re-fed with fresh medium and experiments were performed 16 hours later. Luciferase assay. The rationale of this assay is based on the translational inhibition of the luciferase reporter gene by the cloning of mirna-targeted sequences in its 3 UTR (5). pluc_control, pluc_24-926, pluc_ (see Reporter plasmid generation) were transfected in U2OS cells using Fugene6 (Roche). p3 dishes were transfected with 100 ng of pluc derivative and 1 µg of psuper-mir-210. Alternatively, cells were transfected with 25 ng of pluc derivative and 1 µg of pbluescript and exposed to hypoxia or normoxia for 48 hrs. Cellular extracts were tested with Dual Luciferase Assay (Promega), according to the manufacturer instructions, 48 hrs after transfection. Values were normalized according to luciferase mrna levels. Expression and reporter plasmid generation. To over-express mir-210, the pre-mir-210 sequence (MI ) was cloned between BglII and HindIII restriction sites, in psuper.retro.puro vector (psuper, Oligoengine). To over-express an EFNA3 allele that can not be targeted by mir-210 (EFNA3 ), EFNA3 cdna was excised from pcmv-sport6-efna3 (NCBI accession: BC017722) using KpnI and cloned in pbabepuro retroviral vector (6) using standard techniques. Thus, the last 718 basepairs of EFNA3 cdna, encompassing mir-210 binding site, were deleted. pluc derivatives were generated cloning 3 -UTR sequences of EFNA3 gene downstream of the stop codon in pmir-reporter-luc (pluc, Ambion) between SpeI and Hind III restriction sites. The full length 3 UTR of the human EFNA3 gene was PCR amplified using the following primers: 5 - GGGACTAGTGAGAGATGGGGCGGGGCTTGG-3 and 5 - GGGAAGCTTAAAAAGGCCCAGGAGGATAGGTG-3, giving rise to pluc_ plasmid. EFNA3 gene 3 -UTR sequence 5 - TTTGTCTTCTGTGAAGACAGGACCTATGCAACGCACAGACACTTTTGGAGACCGT-3, containing mir-210 predicted interaction site, gave rise to pluc_ EFNA3 gene 3 -UTR sequence 5 - TTTGTCTTCTGTGAAGACAGGACCTATGCAAACACTTTTGGAGACCGT-3 deleted of the mir-210 seed complementary sequence ( from stop codon) gave rise to pluc_control. Northern blot. To detect mirnas, total RNA was extracted with TRIzol, electrophoresed in a 15% polyacrylamide/7 M urea gel (25 µg/lane) and transferred by electroblotting onto Amersham Hybond- N + membrane (GE Healthcare). Hybridization was performed over-night at 37 C, with terminally 32 P- labeled DNA oligos. To detect mrnas, Northern blotting was performed as previously described (7). Immunofluorescence. HUVEC were fixed with 3% paraformaldehyde and stained with α-ephrin-a3 (EFNA3) antibody (K-19, Santa Cruz or H A01, Abnova) as previously described (7). To obtain a semi-quantitative estimate of EFNA3 expression, random field pictures were taken using the same exposure time by a blinded reader and 50 cells for each sample were quantified using Scion Image software ( Apoptosis and cell cycle analysis. Apoptosis was assessed by measuring the amount of nucleosomes generated during the apoptotic fragmentation of cellular DNA by Cell Death Detection Elisa (Roche), according to manufacturer instructions. For cell cycle analysis HUVEC were incubated for 30 minutes with 20 µm bromodeoxyuridine (BrdUrd, Sigma) and then fixed with 70% ethanol. Cell cycle analysis 2

3 Fasanaro et al. supplementary materials was performed analyzing 1.5x10 4 cells by combined BrdUrd and propidium iodide staining, using a Becton Dickinson flow cytometer. Cell Quest software was used to determine the percentage of BrdUrd-positive cells (7). Capillary-like formation assay and chemotaxis. HUVEC were plated in 16-mm wells (4x10 4 cells per well) that were previously coated with reconstituted basement membrane (Cultrex, Trevigen), in the presence or absence of EGM-2 growth factors. After 6 hours (hrs), the cells were fixed in 3% paraformaldehyde. To quantify capillary-like structures, internodal points formed in 14 fields per well (magnification 10X) were counted by a blinded reader (1). HUVEC chemotaxis on 12 µm collagen IV-coated pore-size polycarbonate filters (Costar) was evaluated in 48-well Boyden s chambers as previously described (8). Migration medium was: RPMI, 25 mm HEPES ph7.4, 0.01% FCS. After staining with Diff-Quick (DADE), the number of migrating cells was determined by counting 6 random fields (magnification 40X) in blind. The migration index (M.I.) was calculated by dividing the number of migrated cells in the presence of 20 ng/ml VEGF (R&D) by the number of migrated cells in migration medium alone. Retroviral infection. Phoenix-ampho cells were transfected with psuper or psuper-mir-210, or with pbabe or pbabe-efna3, together with pmd2-vsvg. The medium containing the pseudotyped emerging retrovirus was harvested 48 and 72 hrs after transfection. To assay for infectious virus, HUVEC were infected and selected in puromycin-containing medium (0.5 µg/ml, Sigma) so that the vast majority of the untransduced cells were eliminated. Over-expression of mir-210 or EFNA3 was confirmed by qpcr. Adenoviral infection. Adenoviral vector infection was performed as previously described (9). Briefly, HUVEC were infected in serum-free medium for 1 hr with 200 MOI of adenoviruses encoding either GFP alone (Ad-GFP) or HIF1α and GFP (Ad- HIF1α, a kind gift of Gabriele Toietta and Silvia Truffa, IDI-IRCCS, Rome) and then cultured for additional 24 hrs before further treatment. SUPPLEMENTARY FIGURE LEGENDS Table S1. Experimental plan and results are summarized. mirnas, measured using a qpcr based assay detecting only mature mirna species, are divided in two groups corresponding to the 96-well format adopted in the assay. For each mirna, the following data are shown: raw data (expressed as Ct values), median-normalized data (expressed as Ct values), and the difference between Ct values of the normoxic and the hypoxic samples (expressed as Ct values). To minimize the number of false positives, only mirnas that were regulated by hypoxia more than 4 fold in at least two consecutive time-points were considered. Table S2. mirnas expressed in normoxic HUVEC. mirnas are ranked according to Ct. Light and dark gray shaded boxes indicate mirnas displaying the same Ct value. mirnas with a Ct value >35 were considered as not expressed. We found that, out of 157 tested, 130 mirna were detectable in normoxic HUVEC, albeit at different levels. Table S3. Bioinformatic prediction of mir-210 and mir-150 targets. An in silico search of potential targets was performed using PicTar, miranda, Sanger MirBase and Targetscan algorithms. Targets recognized by at least 3 softwares are shown. The number of algorithms recognizing each target is indicated. 3

4 Fasanaro et al. supplementary materials Fig. S1. Hypoxia induces growth arrest and cell death. HUVEC (4-5x10 3 /cm 2 ) were plated and the next day exposed to 1% hypoxia for the indicated time (n=5). A) HUVEC growth curve. Data are expressed as % of T0 normoxic control (*P<0.001). At 48 hrs almost 50% of the cells were dead. B) Cells were pulse labeled with BrdUrd for 30 minutes before harvesting, fixed and then stained with propidium iodide and an α-brdurd antibody. Representative FACS-analysis dot plots of 48 hrs samples are shown. C) Bar graph representing BrdUrd incorporation rate during the hypoxic time course. Differences are statistically significant ( # P<0.05; * P<0.005). Fig. S2. mirna regulation by hypoxia. HUVEC were exposed to 1% hypoxia for the indicated times and low-molecular weight RNA was extracted. mirna expression profile was determined by a panel qpcr assays, run in a 96-well format (n= 4-11 each time-point). To detect each mirna, a specific looped primer was used for Reverse Transcription, followed by amplification with a specific primer pair and detection using a TaqMan probe, that added further specificity. Expression data were then normalized according to mir-16 values and expressed as a function of normoxic values using the comparative Ct method. Graphs show expression differences as fold-change compared to normoxic values. A) mir-16 is not modulated by hypoxia (n=11; differences are not significant). B) mir-150 expression is up-regulated by hypoxia ( # P<0.04; *P<0.007). C) mir-328 is induced by hypoxia, however its increase is much slower than suggested by the profiling experiments (*P<0.004; n=8). Fig. S3. Modulation of mir-210 activation. A) HUVEC were exposed to different O 2 concentrations for 24 hrs. The bar graph shows that mir-210 expression increased as O 2 concentration decreased (* P<0.001; n=4). B) Acidosis and oxidative stress are unlikely to play a role in mir-210 up-regulation by hypoxia. Acidification of the culture medium (ph 6.6 and ph 7.0) and HUVEC treatment with 400 µm H 2 O 2 for 8 and 24 hours did not activate mir-210 expression; hyperbuffering of the medium with HEPES ph7.4 did not prevent the hypoxic induction of mir-210 (*P<0.001; # P<0.03; n=4-11). C) Cell confluence may induce a condition of local excessive consumption of oxygen and glucose, leading to pericellular near-anoxia and ATP depletion. To test whether these events were involved in mir-210 activation, HUVEC were plated at very low density (2x10 3 /cm 2 ); the next day, culture medium was supplemented with 10 or 20 mm glucose (total [glucose] = 15 and 25 mm, respectively) and cells were exposed to hypoxia for the indicated time. The bar graph shows that mir-210 expression was strongly induced in all tested conditions (* P<0.001; n=4). Fig. S4. mir-210 regulation by hypoxia is not restricted to EC. Time dependent induction of mir- 210 by hypoxia in U2OS osteosarcoma cell line measured by (A) qpcr (*P<0.001; # P<0.006; n=3) and by (B) northern blotting. Fig. S5. HIF1α positively regulates mir-210 expression. HUVEC were transfected with control sirna or with sirnas targeting HIF1α or HIF2α, either alone or in combination. Afterwards, cells were exposed to hypoxia for 24 hrs and HIF1α and HIF2α and mir-210 levels were measured. sirnas targeting HIF1α (A; *P<0.05; n=3) or HIF2α (B; *P<0.001; n=3) decreased the expression of both targets, each one specifically. However, only the sirna targeting HIF1α decreased mir-210 upregulation, specifically (C; *P<0.006; n=3). D and E) HUVEC were infected with adenoviral vectors encoding either GFP alone (Ad-GFP) or HIF1α and GFP (Ad-HIF1α ). Twentyfour hrs later, the levels of HIF1α (D; *P<0.005; n=5) and mir-210 (E; *P<0.02; n=5) were measured. HIF1α expression induced a small but reproducible activation of mir

5 Fasanaro et al. supplementary materials Fig. S6. mir-210 expression does not affect global gene-expression response to hypoxia. The expression of 11 hypoxia-target genes was measured by qpcr both in HUVEC exposed to hypoxia for 24 hrs and in cells overexpressing mir-210 in normoxic conditions (*P<0.001; *P<0.02; n=4). Fig. S7. EC survival is regulated by mir-210. A) HUVEC (4-5x10 3 /cm 2 ) were plated and the next day exposed to hypoxia. Cells were counted at the indicated time and data are expressed as % of T0 normoxic control. Differences between control and mir-210 expressing cells are not statistically significant, both in hypoxia and in normoxia (n=4). B, C and D) HUVEC (5x10 3 cells/cm 2 ) were transfected with anti-mir-210 or with scramble control and, 24 hrs later, cells were counted (B; *P<0.003; # P<0.02; n=4), apoptosis was measured assessing the apoptotic fragmentation of cellular DNA (C; *P<0.01; n=3) and DNA synthesis rate was measured by BrdUrd incorporation (D; *P<0.001; n=3). The difference in BrdUrd incorporation rate, albeit statistically significant is unlikely to have major biological consequences. Fig. S8. EFNA3 down-modulation in hypoxic cells. A) HUVEC were exposed to hypoxia for 24 and 48 hrs. Then, cells were fixed and stained with both the DNA intercalating agent Hoechst (blue) and an antibody to EFNA3 (H A01, Abnova, green). Size bar = 50 µm. EFNA3 signal was quantified using Scion Image software and after 24 and 48 hrs of hypoxia the decrease of EFNA3 fluorescence was about 80% compared to the normoxic control (*P<0.001; n=3). B) EFNA3 transcript levels are increased by exposure to hypoxia. EFNA3 mrna was measured by qpcr and values are expressed as fold change compared to normoxic control (*P<0.001; n=8). C) EFNA3 mrna levels were not modulated by mir-210 expression. The bar graph shows values expressed as fold change compared to normoxic control. Differences are not statistically significant (n=4). 5

6 Fasanaro et al. supplementary materials REFERENCES 1. D'Arcangelo, D., Facchiano, F., Barlucchi, L. M., Melillo, G., Illi, B., Testolin, L., Gaetano, C., and Capogrossi, M. C. (2000) Circ Res. 86, Zaccagnini, G., Martelli, F., Fasanaro, P., Magenta, A., Gaetano, C., Di Carlo, A., Biglioli, P., Giorgio, M., Martin-Padura, I., Pelicci, P. G., and Capogrossi, M. C. (2004) Circulation. 109, Stern, M. D., Chien, A. M., Capogrossi, M. C., Pelto, D. J., and Lakatta, E. G. (1985) Circ Res. 56, Luo, F., Liu, X., Yan, N., Li, S., Cao, G., Cheng, Q., Xia, Q., and Wang, H. (2006) BMC Cancer. 6, Cheng, A. M., Byrom, M. W., Shelton, J., and Ford, L. P. (2005) Nucleic Acids Res. 33, Morgenstern, J. P., and Land, H. (1990) Nucleic Acids Res. 18, Martelli, F., Hamilton, T., Silver, D. P., Sharpless, N. E., Bardeesy, N., Rokas, M., DePinho, R. A., Livingston, D. M., and Grossman, S. R. (2001) Proc Natl Acad Sci U S A. 98, Germani, A., Di Carlo, A., Mangoni, A., Straino, S., Giacinti, C., Turrini, P., Biglioli, P., and Capogrossi, M. C. (2003) Am J Pathol. 163, Cicchillitti, L., Fasanaro, P., Biglioli, P., Capogrossi, M. C., and Martelli, F. (2003) J Biol Chem. 278,

7 TABLE S1 The goal of the experiment: Experiment Design microrna-210 modulates Endothelial Cell Response to Hypoxia and Ephrin-A3 levels A brief description of the experiment: MicroRNAs (mirnas) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. The aim of the present study was to investigate mirnas regulation and functional role in endothelial cell response to hypoxia. Human Umbelical Vein Endothelial Cells (HUVEC) were exposed to 1% oxygen for 8-48 hours and a selection of 157 mirnas was measured using a real-time PCR assay designed to quantify only mature mirnas. The expression of mir- 210 and mir-150 progressively increased upon exposure to hypoxia. Furthermore, mir-210 up-regulation by hypoxia was not restricted to vascular cells and in HUVEC cultivated in normoxic conditions, neither acidification nor oxidative stress modulated mir-210 level. mir-210 expression in normoxia stimulated cell migration and the formation of capillary-like structures, while its inhibition induced apoptosis. We determined that one relevant target of mir-210 in hypoxia was Ephrin- A3, since mir-210 was necessary and sufficient to down-modulate its expression. Moreover, luciferase reporter assays showed that Ephrin-A3 was a direct target of mir-210. We conclude that mir-210 is a crucial component of endothelial cell re Keywords: Experimental factors: Experimental design: Primers description: microrna; Hypoxia; endothelium; Real Time PCR; comparative Ct method normoxia or hours of hypoxia Human Umbelical Vein Endothelial Cells (HUVEC) were exposed to 1% oxygen for 8-48 hours and a selection of 157 mirnas was measured using a real-time PCR assay designed to quantify only mature mirnas. The basis of TaqMan MicroRNA Assays is a target-specific stem-loop reverse-transcriptase primer. The short length of mature mirnas (~22 nt) prohibits conventional design of a randomprimed retrotranscription step followed by a specific Real- Time assay. The stem-loop accomplishes two goals: 1) specificity for only the mature mirna target, and 2) formation of an RT primer/mature mirna-chimera, extending the 5' end of the mirna. The resulting longer RT amplicon presents a template amenable to Real-Time TaqMan assay. TaqMan mirna assays can between highly homologous targets, with only a single nucleotide mismatch. Samples used, extract preparation and amplification The origin of each biological sample and its characteristics: HUVEC - Umbilical Vein Endothelial Cells. The analyzed population represents a pool of 100 independent donors. Cells were purchased from Clonetics. Manipulation of biological samples and protocols used: HUVEC were grown in EGM-2 (Bio-Whittaker) containing 2% FBS, at 37 C in a humidified atmosphere with 5% CO2/95% air. Hypoxia was induced incubating 60-70% confluent (6-7x103/cm2) cells in a humidified atmosphere of 5% CO2-95% N2, yielding an O2 concentration of about 1% Technical protocols for preparing extract: Total RNA was extracted using TRIzol (Invitrogen) and the small RNAs fraction was enriched using the PureLink mirna Isolation Kit (Invitrogen). RNA concentrations were determined with a NanoDrop Spectrophotometer (NanoDrop Technologies) and 1 ng per sample was used for the assays. Technical protocols for Real-Time PCR: 3 ng per sample were retrotranscribed using The TaqMan MicroRNA Reverse Transcription Kit and specific primers for each mirna. See figure 1 for retrotranscription program. mirna levels were analysed using the TaqMan Real Time PCR method in an Applied Biosystems 7000 Thermocycler (9600 emulation mode), using 1.6 ml of each retrotranscribed sample, the TaqMan Universal PCR Master Mix No AmpErase UNG and specific primers for each mirna. See figure 2 for PCR programall reagents were purchrased from Applied Biosystems. Figure 1: retrotranscription program Figure 2: Real-Time PCR program Measurement data and specifications Software used: Real Time PCR are quantified with ABI Prism 7000 SDS (Applied Biosystems). Raw datas and normalization: - Ct: Raw data are expressed as Cycle Threshold (Ct). The threshold line is setted in the exponential phase of the amplification. The Ct indicates the cycle at which the sample reaches this level. - DCt: mirnas were assayed in a 96-well format and samples were normalized to the median Ct value of each assay. - DDCt: this value indicates the DCT variation vs the control of each experimental point

8 PLATE 1: raw data Ct normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a 21,0 21,1 20,1 20,0 20,5 21,4 21,6 19,7 20,2 20,7 20,1 21,3 20,5 20,2 20,5 20,4 20,4 20,3 20,3 20,4 A2 cel-lin-4 35,8 38,5 36,0 36,0 36,6 37,0 37,5 32,1 35,9 35,6 37,6 38,2 34,5 35,7 36,5 38,3 37,1 35,1 35,2 36,4 A3 control 25,3 26,3 28,0 27,3 26,7 28,9 28,3 27,4 27,7 28,1 27,7 28,1 29,7 29,2 28,7 29,2 30,0 31,1 31,2 30,4 A4 hsa-mir-9 33,2 34,2 31,8 32,8 33,0 35,0 33,9 28,7 30,1 31,9 34,3 34,5 32,2 31,2 33,1 33,3 32,6 32,1 32,0 32,5 A5 hsa-mir-9* 35,0 40,0 35,5 35,1 36,4 37,5 38,0 33,0 35,7 36,1 36,5 38,7 36,2 34,8 36,6 35,6 35,4 37,5 36,8 36,3 A6 hsa-mir-10a 23,9 24,6 24,1 24,2 24,2 25,0 25,1 24,1 24,2 24,6 24,1 24,5 24,1 24,1 24,2 23,7 23,5 24,4 24,5 24,0 A7 control 22,5 23,2 23,3 23,2 23,1 24,0 24,2 24,1 23,0 23,2 23,4 23,3 23,2 22,7 22,8 24,1 24,2 23,4 A8 hsa-mir-15a 21,4 22,3 24,3 24,2 23,0 22,6 22,2 24,1 24,3 23,3 23,1 23,5 24,4 24,3 23,8 22,3 22,6 25,1 25,4 23,8 A9 hsa-mir-15b 21,3 22,4 21,8 21,8 21,8 22,5 22,6 21,3 21,4 21,9 21,6 22,2 22,1 21,9 22,0 21,4 21,8 23,0 23,1 22,3 A10 hsa-mir-16 19,6 20,8 20,6 20,6 20,4 21,1 20,7 20,3 20,3 20,6 20,5 20,4 20,8 20,3 20,5 19,9 20,0 21,7 21,4 20,8 A11 hsa-mir-17-3p 26,3 27,6 26,7 26,5 26,8 28,0 27,9 25,8 26,3 27,0 27,1 26,9 27,0 26,8 26,9 27,2 27,0 27,1 27,2 27,1 A12 hsa-mir-17-5p 20,5 19,8 20,2 20,2 21,7 21,9 19,1 20,0 20,7 20,8 21,4 20,4 19,6 20,5 21,0 21,7 21,2 21,4 21,3 B1 ath-mir159a 37,8 36,2 36,4 37,2 36,9 40,0 36,9 36,3 35,2 37,1 36,9 40,0 34,6 36,9 37,1 39,0 39,7 37,0 37,6 38,3 B2 hsa-mir-19a 20,3 21,4 20,1 20,7 20,6 23,1 23,9 21,4 22,4 22,7 20,5 22,0 24,0 23,4 22,5 20,6 21,9 22,6 24,7 22,4 B3 control 19,7 20,6 18,9 19,1 19,5 20,8 20,6 20,7 20,5 21,0 19,4 19,3 20,0 20,3 20,1 20,1 20,3 20,2 B4 hsa-mir-20 21,4 21,5 21,3 21,5 21,4 22,9 22,1 22,2 21,9 22,3 21,9 22,9 23,0 22,4 22,6 22,3 24,1 22,7 23,7 23,2 B5 hsa-mir-21 17,1 17,6 18,0 18,3 17,7 18,8 18,4 17,1 17,6 18,0 17,6 18,1 18,6 18,2 18,2 17,6 17,7 18,5 19,1 18,2 B6 control 22,0 23,0 22,8 23,3 22,8 23,4 23,1 23,2 22,7 23,3 23,7 23,6 23,3 22,3 22,7 24,4 24,4 23,5 B7 hsa-mir-23a 19,6 20,2 20,6 20,6 20,2 20,9 20,8 20,1 20,5 20,6 19,4 19,9 22,1 21,6 20,7 19,5 20,0 21,4 21,8 20,7 B8 hsa-mir-23b 23,6 23,8 23,6 24,2 23,8 24,6 24,2 23,7 23,9 24,1 24,1 24,2 24,4 24,2 24,2 23,7 23,9 25,1 25,7 24,6 B9 control 19,5 20,8 19,2 19,5 19,7 20,3 20,8 20,5 19,7 20,5 20,0 20,0 20,0 20,0 19,7 20,6 20,9 20,3 B10 hsa-mir-25 22,7 23,6 21,3 22,3 22,5 24,0 24,0 22,1 22,0 23,0 22,9 23,7 22,8 22,4 23,0 23,0 23,2 23,2 23,7 23,3 B11 hsa-mir-26a 22,0 23,2 22,2 22,1 22,4 23,1 22,4 22,1 21,9 22,4 21,8 22,6 22,5 22,0 22,2 21,7 21,8 22,6 22,7 22,2 B12 hsa-mir-26b 23,4 24,6 23,2 23,7 23,7 24,7 24,6 23,7 22,8 24,0 23,0 24,4 23,3 22,5 23,3 23,2 23,4 24,0 24,5 23,8 C1 hsa-mir-27a 21,0 21,8 21,7 21,3 21,4 22,5 22,4 21,0 21,0 21,7 21,4 21,5 21,4 20,7 21,3 21,5 21,6 22,2 22,6 22,0 C2 hsa-mir-27b 22,5 23,1 24,2 24,4 23,5 24,1 24,3 23,9 23,9 24,0 22,6 22,5 24,1 23,7 23,2 22,5 22,8 24,8 25,1 23,8 C3 hsa-mir-28 24,1 25,2 24,6 24,7 24,6 25,5 25,3 24,2 24,4 24,8 24,9 25,3 25,1 24,8 25,0 24,6 24,7 25,3 25,5 25,0 C4 hsa-mir-29a 19,6 20,1 19,9 19,7 19,8 21,3 20,2 19,8 20,2 20,4 19,1 20,3 20,5 20,0 20,0 19,1 19,7 20,4 20,9 20,0 C5 hsa-mir-29b 20,7 21,5 20,9 20,9 21,0 22,1 22,1 20,3 21,3 21,5 21,3 21,5 22,0 21,2 21,5 21,2 21,3 22,1 22,3 21,7 C6 hsa-mir-29c 19,5 20,0 20,8 19,6 20,0 20,8 20,4 19,5 20,2 20,2 19,2 20,6 20,1 20,1 20,0 19,6 19,9 20,6 20,6 20,2 C7 hsa-mir-30a-3p 24,1 25,1 24,3 24,0 24,4 26,2 25,1 23,8 24,3 24,9 24,3 24,9 24,5 24,4 24,5 24,3 24,9 25,5 25,4 25,0 C8 hsa-mir-30b 21,1 22,4 21,8 21,8 21,8 23,1 22,2 22,4 22,3 22,5 22,1 22,5 22,5 22,3 22,3 21,6 22,0 23,1 23,1 22,4 C9 hsa-mir-30c 21,6 22,4 22,3 22,5 22,2 23,0 23,1 22,7 22,7 22,9 22,4 22,3 22,6 22,4 22,4 22,2 22,2 23,3 23,5 22,8 C10 hsa-mir-30d 23,8 24,4 25,2 25,7 24,8 25,4 25,4 24,6 25,6 25,2 24,2 24,5 25,2 24,8 24,7 22,9 24,1 25,4 25,7 24,5 C11 hsa-mir-30e 24,8 26,5 25,7 26,0 25,7 27,1 25,7 26,3 26,3 26,2 26,5 27,5 27,3 26,9 24,9 26,1 27,3 27,6 26,5 C12 hsa-mir-31 21,1 21,9 21,8 21,3 21,5 22,2 22,0 20,8 21,0 21,5 21,3 22,2 21,6 21,4 21,6 21,4 22,1 22,3 22,0 22,0 D1 control 24,5 25,7 26,9 27,8 26,2 27,0 27,1 27,0 24,4 26,9 27,3 27,3 26,5 26,1 26,0 27,9 28,2 27,1 D2 control 27,1 28,1 28,4 28,5 28,0 29,2 29,0 29,1 28,6 28,2 28,7 28,1 28,4 28,1 27,4 28,8 28,8 28,3 D3 hsa-mir-34a 21,4 22,0 21,4 21,4 21,5 22,7 21,7 21,3 21,4 21,8 21,1 21,2 21,9 21,5 21,4 20,7 20,3 21,9 22,0 21,2 D4 hsa-mir-34b 33,6 34,2 33,2 33,1 33,5 35,0 34,9 32,2 30,5 33,1 33,3 34,3 34,2 34,3 34,0 32,6 33,8 32,4 32,6 32,8 D5 hsa-mir-34c 34,6 35,0 32,0 32,0 33,4 36,3 36,0 30,6 31,6 33,6 34,0 33,9 33,4 33,9 33,8 33,0 32,8 32,7 33,1 32,9 D6 hsa-mir-92 21,6 22,7 21,2 21,2 21,7 22,8 22,3 20,8 20,8 21,7 21,6 22,3 21,5 21,2 21,6 21,6 21,5 22,1 22,3 21,9 D7 control 19,6 21,3 20,4 20,5 20,4 22,2 21,9 22,0 21,5 22,4 20,5 20,5 21,2 21,4 22,0 21,6 21,9 21,7 D8 hsa-mir-95 32,1 33,7 33,5 33,6 33,2 34,2 34,2 32,4 34,2 33,8 32,6 33,8 34,0 33,5 33,5 31,7 32,5 34,3 34,6 33,3 D9 hsa-mir-96 34,2 34,7 36,5 35,2 35,2 35,1 34,6 35,5 33,6 34,7 34,5 35,1 36,1 36,7 35,6 33,8 33,5 35,3 36,5 34,8 D10 hsa-mir-98 23,3 24,8 24,0 24,4 24,1 25,1 24,7 24,7 24,5 24,7 24,4 24,7 25,3 25,1 24,9 23,4 24,1 25,7 26,3 24,9 D11 hsa-mir-99a 20,5 21,7 21,7 21,4 21,3 21,3 21,6 20,8 21,1 21,2 20,9 21,6 21,5 21,1 21,3 21,3 21,5 22,3 22,5 21,9 D12 control 25,2 26,0 27,4 27,1 26,4 26,2 25,8 26,0 25,6 26,9 27,2 27,1 26,7 25,3 25,7 27,3 27,8 26,5 E1 hsa-mir ,3 21,3 19,7 20,3 20,4 21,5 21,4 19,4 20,1 20,6 20,3 21,0 20,4 20,2 20,5 21,2 20,8 21,4 21,8 21,3 E2 control 25,4 26,3 25,8 26,1 25,9 26,3 26,5 26,4 25,3 25,7 25,3 24,9 25,3 25,5 25,7 26,1 26,4 25,9 E3 hsa-mir ,3 21,9 21,6 21,5 21,6 22,4 22,1 20,7 20,5 21,4 21,5 21,8 22,3 21,9 21,9 21,4 21,1 22,6 22,6 21,9 E4 hsa-mir ,1 38,4 33,6 33,1 35,1 39,5 38,0 33,2 33,0 35,9 40,0 37,6 34,1 34,6 36,6 37,5 40,0 33,6 32,9 36,0 E5 hsa-mir ,0 37,6 35,2 37,5 36,3 39,8 37,2 36,8 40,0 38,5 35,8 40,0 38,5 38,0 38,1 37,2 37,4 37,2 35,4 36,8 E6 hsa-mir-106a 20,5 21,6 22,2 21,6 21,5 22,2 22,7 21,2 21,4 21,9 20,7 22,2 22,2 21,9 21,8 21,8 22,3 22,7 23,0 22,5 E7 control 21,2 22,0 21,6 21,4 21,6 22,6 22,1 22,3 23,0 22,2 23,8 22,4 22,9 21,9 21,9 22,9 22,9 22,4 E8 hsa-mir ,2 27,0 26,9 27,2 26,8 28,5 28,5 26,9 27,4 27,8 26,9 28,8 27,8 29,2 28,2 28,0 28,1 28,3 28,5 28,2 E9 hsa-mir-122a 37,0 38,2 35,1 38,4 37,2 40,0 40,0 35,5 38,2 38,4 36,8 40,0 36,5 40,0 38,3 40,0 38,6 38,8 39,0 39,1 E10 hsa-mir-124a 33,7 36,9 34,3 33,2 34,5 35,9 35,6 31,4 33,9 34,2 36,8 39,0 34,5 32,4 35,7 36,4 39,0 31,0 32,4 34,7 E11 hsa-mir-124b 30,4 31,1 34,2 33,9 32,4 35,7 34,8 33,2 33,1 34,2 33,0 34,3 31,6 31,3 32,6 33,5 34,1 29,8 29,2 31,6 E12 hsa-mir-125a 22,5 23,4 23,3 23,8 23,2 23,6 22,8 23,1 23,0 23,1 21,7 23,2 23,1 23,0 22,7 22,3 22,4 23,5 23,1 22,8 F1 hsa-mir-125b 21,1 21,5 22,9 22,8 22,1 22,6 22,6 22,1 22,3 22,4 22,1 22,3 23,3 23,4 22,8 22,1 21,7 24,1 23,6 22,9 F2 hsa-mir ,8 19,2 19,2 19,2 18,9 19,5 19,4 19,1 19,4 19,3 18,4 19,0 19,0 18,6 18,8 18,4 18,9 20,3 20,5 19,5 F3 control 19,5 21,2 19,4 20,1 20,1 21,5 21,3 21,4 20,8 21,6 20,6 20,4 20,9 21,0 20,7 20,8 21,3 21,0 F4 hsa-mir ,3 26,5 25,6 25,2 25,6 26,8 26,2 25,1 25,3 25,8 25,4 25,8 26,0 25,8 25,7 25,5 25,2 27,1 26,3 26,0 F5 hsa-mir-128a 27,9 28,6 28,2 28,6 28,3 29,3 29,1 28,2 28,7 28,8 28,5 29,2 28,4 28,8 28,7 29,5 29,5 29,1 29,7 29,4 F6 hsa-mir-128b 29,3 30,2 29,3 29,0 29,4 31,3 31,0 29,3 29,4 30,2 30,1 31,1 30,0 30,0 30,3 32,1 31,3 31,3 32,1 31,7 F7 hsa-mir ,8 34,4 31,8 30,0 32,3 35,6 33,9 30,1 30,7 32,6 34,3 35,0 32,0 30,6 33,0 33,4 33,9 31,0 31,5 32,5 F8 hsa-mir-130a 21,3 22,2 22,0 22,0 21,9 22,6 22,3 22,0 22,3 22,3 21,5 22,4 22,3 22,0 22,0 21,7 21,6 23,2 23,2 22,4 F9 hsa-mir-130b 21,8 22,4 22,0 21,5 21,9 23,0 22,6 21,4 21,6 22,2 21,8 22,9 21,9 21,6 22,0 22,0 22,5 22,9 23,0 22,6 F10 hsa-mir ,7 28,5 27,3 27,4 27,7 28,5 28,7 26,7 27,1 27,7 27,9 28,5 27,1 27,8 27,0 27,0 27,4 27,8 27,3 F11 hsa-mir-133a 37,2 39,1 40,0 40,0 39,1 40,0 36,6 35,1 35,3 36,7 37,0 37,4 38,4 40,0 38,2 37,7 37,9 38,4 37,1 37,8 F12 hsa-mir-133b 37,3 36,6 37,2 36,9 37,0 40,0 37,8 35,8 36,5 37,5 34,4 35,7 35,2 34,7 35,0 36,3 36,6 35,3 35,7 36,0 G1 hsa-mir ,1 27,2 26,8 27,3 27,1 27,7 28,0 26,8 26,3 27,2 26,9 27,7 27,5 26,4 27,1 27,9 27,3 28,1 28,3 27,9 G2 hsa-mir-135a 32,8 34,0 33,3 35,1 33,8 35,1 35,7 36,5 29,8 34,3 35,1 35,5 34,9 34,1 34,9 35,7 35,8 35,0 38,0 36,1 G3 hsa-mir-135b 35,2 38,1 33,8 35,1 35,5 38,4 39,3 34,9 32,7 36,3 36,5 35,7 35,9 34,0 35,5 36,4 35,7 37,6 35,6 36,3 G4 control 31,2 33,6 32,8 32,9 32,6 34,3 33,3 33,8 33,8 33,9 34,8 33,3 34,0 33,4 34,6 34,1 36,5 34,7 G5 hsa-mir ,4 25,4 23,4 23,6 24,2 25,9 25,6 23,7 23,7 24,7 25,1 25,8 24,5 24,0 24,9 25,2 25,3 24,8 25,4 25,2 G6 hsa-mir ,8 37,2 34,0 35,3 35,5 40,0 36,5 32,6 32,3 35,4 37,0 40,0 33,9 33,7 36,1 40,0 40,0 35,1 35,0 37,5 G7 hsa-mir ,6 28,2 28,8 28,8 28,3 28,5 28,4 28,4 28,5 28,5 26,7 27,2 28,7 28,0 27,6 26,4 26,3 28,1 28,2 27,2 G8 hsa-mir ,0 24,9 23,9 23,8 24,1 25,1 25,1 23,6 23,9 24,4 24,7 24,8 24,4 24,1 24,5 24,7 24,6 25,1 25,0 24,9 G9 hsa-mir ,6 32,0 31,4 31,7 31,7 33,2 31,4 30,7 30,0 31,3 33,3 34,0 33,2 31,7 33,0 33,1 33,1 31,9 33,7 32,9 G10 hsa-mir-142-3p 32,8 33,7 33,6 33,0 33,3 34,7 33,8 34,8 32,3 33,9 34,3 34,7 33,1 32,0 33,6 34,1 34,1 32,4 33,8 33,6 G11 hsa-mir-142-5p 36,4 37,9 40,0 40,0 38,6 37,6 40,0 40,0 40,0 39,4 36,0 37,7 40,0 37,3 37,8 37,2 39,9 38,1 40,0 38,8 G12 control 33,0 33,0 33,1 34,2 33,3 34,7 32,9 33,8 33,7 34,1 33,1 32,8 33,4 33,9 34,5 32,7 34,0 33,8 H1 hsa-mir ,0 38,6 36,2 36,2 37,8 40,0 40,0 36,0 33,4 37,4 39,3 39,9 36,3 37,7 38,3 38,6 39,2 36,1 36,2 37,5 H2 hsa-mir ,5 30,2 32,1 29,7 30,4 30,0 30,4 29,3 28,3 29,5 29,1 29,2 29,9 29,4 29,4 28,7 28,8 29,1 30,2 29,2 H3 hsa-mir ,7 24,0 22,3 22,1 22,8 24,0 23,8 23,1 22,4 23,3 22,6 23,4 22,9 22,7 22,9 22,6 22,3 22,3 22,9 22,5 H4 hsa-mir ,8 36,9 35,3 33,3 35,1 35,3 37,5 37,6 34,3 36,2 35,4 35,0 37,6 35,5 35,9 34,6 35,5 33,0 36,1 34,8 H5 hsa-mir-148a 28,6 30,1 29,1 28,7 29,1 30,2 30,2 29,2 28,9 29,6 30,0 30,0 29,6 29,6 29,8 29,6 30,0 30,5 30,8 30,2 H6 control 24,3 25,2 24,4 24,4 24,6 25,8 25,7 25,7 25,2 25,3 24,9 24,4 25,0 25,2 25,3 25,3 25,8 25,4 H7 hsa-mir ,2 31,0 30,4 30,1 30,4 31,0 30,7 30,3 29,7 30,4 29,6 29,4 29,5 29,7 29,5 28,5 28,2 29,3 29,6 28,9 H8 hsa-mir ,4 33,9 33,6 34,4 33,8 34,1 33,4 32,8 32,1 33,1 30,9 31,1 31,7 31,3 31,2 29,7 29,2 30,3 30,5 29,9 H9 hsa-mir ,6 24,3 23,9 23,3 23,8 24,5 24,6 23,2 22,8 23,8 24,0 24,1 23,5 23,1 23,7 23,6 23,4 24,1 24,5 23,9 H10 hsa-mir ,2 26,3 25,6 25,1 26,0 26,3 26,2 25,1 25,2 25,7 25,6 25,2 25,1 25,2 25,3 25,7 25,5 26,5 26,4 26,0 H11 hsa-let-7a 20,6 21,0 21,0 20,7 20,8 22,1 21,6 21,0 21,2 21,5 20,2 21,5 21,4 21,3 21,1 20,3 20,9 21,4 22,4 21,2 H12 hsa-mir-16 20,1 19,9 20,2 20,1 20,1 20,4 20,5 20,1 20,1 20,3 20,8 20,7 20,2 20,4 20,5 19,9 20,7 20,8 21,5 20,7 MEDIAN 24,1 25,2 24,3 24,4 25,6 25,3 24,4 24,4 24,6 25,0 24,9 24,6 24,6 24,8 25,4 25,7

9 PLATE 1: Ct (Ct of each mir - median Ct) normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a -3,1-4,1-4,3-4,4-4,0-4,3-3,7-4,6-4,2-4,2-4,5-3,8-4,4-4,4-4,3-4,2-4,4-5,1-5,4-4,8 A2 cel-lin-4 11,7 13,4 11,7 11,6 12,1 11,4 12,2 7,7 11,5 10,7 13,1 13,1 9,7 11,1 11,8 13,6 12,3 9,8 9,5 11,3 A3 control 1,2 1,1 3,7 2,9 2,2 3,2 3,0 3,0 3,3 3,1 3,1 3,1 4,8 4,6 3,9 4,6 5,2 5,8 5,5 5,3 A4 hsa-mir-9 9,1 9,1 7,5 8,5 8,5 9,4 8,6 4,4 5,6 7,0 9,7 9,5 7,3 6,6 8,3 8,7 7,7 6,7 6,3 7,3 A5 hsa-mir-9* 10,9 14,8 11,2 10,7 11,9 11,9 12,7 8,6 11,3 11,1 11,9 13,7 11,3 10,2 11,8 10,9 10,5 12,1 11,1 11,2 A6 hsa-mir-10a -0,2-0,6-0,3-0,2-0,3-0,6-0,2-0,3-0,3-0,3-0,5-0,5-0,8-0,5-0,6-1,0-1,3-1,0-1,2-1,1 A7 control -1,6-2,0-1,1-1,2-1,4-1,6-1,1-1,3-1,6-1,9-1,5-1,3-1,6-1,9-2,0-1,3-1,5-1,7 A8 hsa-mir-15a -2,7-2,9 0,0-0,2-1,5-3,0-3,1-0,3-0,2-1,6-1,5-1,6-0,4-0,3-1,0-2,4-2,3-0,3-0,3-1,3 A9 hsa-mir-15b -2,8-2,8-2,5-2,6-2,7-3,1-2,7-3,1-3,1-3,0-3,0-2,8-2,8-2,7-2,8-3,2-3,1-2,4-2,6-2,8 A10 hsa-mir-16-4,5-4,4-3,7-3,8-4,1-4,5-4,6-4,1-4,2-4,3-4,0-4,6-4,1-4,3-4,3-4,8-4,8-3,6-4,3-4,4 A11 hsa-mir-17-3p 2,2 2,4 2,3 2,1 2,3 2,4 2,5 1,4 1,9 2,0 2,5 1,8 2,1 2,2 2,2 2,6 2,2 1,8 1,5 2,0 A12 hsa-mir-17-5p -3,6-4,6-4,2-4,1-3,9-3,4-5,3-4,4-4,3-3,8-3,6-4,5-5,0-4,2-3,6-3,2-4,1-4,3-3,8 B1 ath-mir159a 13,7 11,0 12,1 12,8 12,4 14,4 11,6 11,9 10,8 12,2 12,3 15,0 9,7 12,3 12,3 14,3 14,9 11,6 11,9 13,2 B2 hsa-mir-19a -3,8-3,8-4,3-3,7-3,9-2,5-1,5-3,0-2,0-2,2-4,1-3,0-0,9-1,2-2,3-4,0-3,0-2,8-1,0-2,7 B3 control -4,4-4,6-5,5-5,3-5,0-4,8-4,7-4,7-4,0-4,1-5,5-5,3-4,7-4,4-4,7-5,3-5,4-4,9 B4 hsa-mir-20-2,7-3,7-3,1-2,9-3,1-2,7-3,2-2,1-2,5-2,6-2,6-2,1-1,9-2,2-2,2-2,3-0,7-2,7-2,0-1,9 B5 hsa-mir-21-7,0-7,6-6,4-6,1-6,8-6,9-6,9-7,3-6,8-7,0-6,9-6,9-6,3-6,4-6,6-7,0-7,1-6,9-6,6-6,9 B6 control -2,1-2,2-1,6-1,1-1,7-2,2-2,3-2,2-1,8-1,7-1,2-1,0-1,5-2,3-2,1-1,0-1,3-1,7 B7 hsa-mir-23a -4,5-5,0-3,8-3,8-4,3-4,8-4,5-4,3-3,9-4,4-5,2-5,1-2,8-3,0-4,0-5,2-4,9-3,9-3,9-4,5 B8 hsa-mir-23b -0,5-1,3-0,8-0,2-0,7-1,0-1,2-0,7-0,6-0,9-0,4-0,9-0,5-0,4-0,6-0,9-0,9-0,3 0,0-0,5 B9 control -4,6-4,4-5,2-4,9-4,8-5,3-4,5-4,9-4,9-4,5-4,9-4,6-4,7-4,7-5,1-4,8-4,8-4,8 B10 hsa-mir-25-1,4-1,6-3,1-2,1-2,0-1,6-1,3-2,3-2,5-1,9-1,6-1,4-2,1-2,2-1,8-1,6-1,6-2,2-2,0-1,9 B11 hsa-mir-26a -2,1-2,0-2,1-2,3-2,1-2,5-3,0-2,3-2,6-2,6-2,8-2,4-2,4-2,6-2,5-2,9-3,0-2,8-3,0-2,9 B12 hsa-mir-26b -0,7-0,6-1,1-0,7-0,8-1,0-0,7-0,6-1,6-1,0-1,5-0,6-1,6-2,1-1,5-1,4-1,5-1,3-1,2-1,4 C1 hsa-mir-27a -3,1-3,4-2,6-3,1-3,0-3,1-2,9-3,4-3,4-3,2-3,2-3,5-3,5-3,9-3,5-3,2-3,2-3,1-3,1-3,2 C2 hsa-mir-27b -1,6-2,1-0,1 0,0-1,0-1,5-1,1-0,5-0,5-0,9-2,0-2,6-0,8-0,9-1,6-2,2-2,0-0,5-0,6-1,3 C3 hsa-mir-28 0,0 0,0 0,3 0,3 0,1-0,2 0,0-0,2 0,0-0,1 0,3 0,3 0,2 0,2 0,2-0,1-0,1 0,0-0,2-0,1 C4 hsa-mir-29a -4,5-5,1-4,5-4,7-4,7-4,3-5,1-4,6-4,3-4,6-5,5-4,8-4,4-4,6-4,8-5,6-5,1-5,0-4,8-5,1 C5 hsa-mir-29b -3,4-3,7-3,4-3,5-3,5-3,5-3,2-4,1-3,2-3,5-3,2-3,6-2,9-3,4-3,3-3,4-3,5-3,3-3,4-3,4 C6 hsa-mir-29c -4,6-5,1-3,5-4,8-4,5-4,8-4,9-4,9-4,3-4,7-5,4-4,5-4,8-4,5-4,8-5,1-4,9-4,8-5,1-5,0 C7 hsa-mir-30a-3p 0,0-0,1 0,0-0,4-0,1 0,6-0,2-0,6-0,1-0,1-0,2-0,1-0,4-0,2-0,2-0,3 0,1 0,2-0,3-0,1 C8 hsa-mir-30b -3,0-2,8-2,5-2,6-2,7-2,6-3,1-2,0-2,1-2,5-2,5-2,5-2,4-2,3-2,5-3,1-2,8-2,3-2,6-2,7 C9 hsa-mir-30c -2,5-2,7-2,0-1,9-2,3-2,6-2,3-1,7-1,8-2,1-2,1-2,7-2,3-2,2-2,3-2,5-2,7-2,1-2,2-2,3 C10 hsa-mir-30d -0,3-0,7 0,8 1,3 0,3-0,2 0,0 0,2 1,1 0,3-0,4-0,5 0,3 0,2-0,1-1,8-0,7 0,0 0,0-0,6 C11 hsa-mir-30e 0,7 1,3 1,3 1,6 1,2 1,4 1,3 1,8 1,5 1,7 1,5 2,6 2,7 2,1 0,3 1,3 1,9 1,9 1,3 C12 hsa-mir-31-3,0-3,2-2,6-3,1-3,0-3,4-3,3-3,5-3,4-3,4-3,2-2,9-3,3-3,2-3,1-3,2-2,7-3,1-3,7-3,2 D1 control 0,4 0,5 2,5 3,4 1,7 1,4 1,8 1,6-0,2 1,8 2,4 2,7 1,7 1,5 1,2 2,5 2,5 1,9 D2 control 3,0 2,9 4,0 4,1 3,5 3,6 3,7 3,6 4,1 3,2 3,8 3,5 3,6 3,4 2,6 3,4 3,1 3,1 D3 hsa-mir-34a -2,7-3,2-3,0-3,0-3,0-2,9-3,6-3,1-3,0-3,2-3,4-3,8-3,0-3,1-3,3-4,0-4,5-3,5-3,7-3,9 D4 hsa-mir-34b 9,5 9,0 8,9 8,7 9,0 9,4 9,6 7,8 6,1 8,2 8,7 9,2 9,3 9,7 9,3 7,9 8,9 7,0 6,9 7,7 D5 hsa-mir-34c 10,5 9,8 7,7 7,7 8,9 10,7 10,7 6,3 7,1 8,7 9,5 8,8 8,5 9,3 9,0 8,4 7,9 7,4 7,5 7,8 D6 hsa-mir-92-2,5-2,5-3,1-3,2-2,8-2,8-3,0-3,6-3,6-3,3-2,9-2,8-3,4-3,4-3,1-3,0-3,3-3,3-3,4-3,3 D7 control -4,5-3,9-4,0-3,9-4,1-3,5-3,4-3,5-3,1-2,6-4,4-4,1-3,5-3,3-2,8-3,8-3,8-3,4 D8 hsa-mir-95 8,0 8,5 9,2 9,2 8,7 8,6 8,9 8,1 9,7 8,8 8,1 8,7 9,1 8,9 8,7 7,0 7,6 8,9 9,0 8,1 D9 hsa-mir-96 10,1 9,6 12,2 10,8 10,7 9,5 9,3 11,1 9,2 9,8 9,9 10,0 11,2 12,1 10,8 9,1 8,7 10,0 10,8 9,6 D10 hsa-mir-98-0,8-0,4-0,3 0,0-0,4-0,6-0,6 0,3 0,0-0,2-0,1-0,3 0,4 0,5 0,1-1,2-0,7 0,4 0,6-0,2 D11 hsa-mir-99a -3,6-3,4-2,6-3,0-3,2-4,3-3,7-3,6-3,3-3,7-3,6-3,5-3,4-3,5-3,5-3,3-3,3-3,1-3,2-3,2 D12 control 1,1 0,8 3,1 2,7 1,9 0,6 0,5 0,5 1,1 1,9 2,3 2,5 1,9 0,6 0,8 2,0 2,1 1,4 E1 hsa-mir-100-3,8-3,9-4,6-4,1-4,1-4,2-4,0-4,9-4,3-4,3-4,2-4,1-4,5-4,4-4,3-3,5-4,0-4,0-3,9-3,9 E2 control 1,3 1,1 1,4 1,7 1,4 0,7 1,1 0,9 0,8 0,6 0,4 0,3 0,5 0,9 0,9 0,7 0,7 0,8 E3 hsa-mir-103-2,8-3,2-2,8-2,9-2,9-3,3-3,2-3,6-3,9-3,5-3,1-3,2-2,6-2,7-2,9-3,2-3,7-2,8-3,1-3,2 E4 hsa-mir ,0 13,2 9,2 8,7 10,6 13,9 12,7 8,9 8,6 11,0 15,5 12,6 9,2 10,0 11,8 12,8 15,2 8,3 7,3 10,9 E5 hsa-mir ,9 12,5 10,9 13,1 11,8 14,2 11,9 12,5 15,6 13,5 11,3 15,0 13,6 13,4 13,3 12,5 12,5 11,9 9,7 11,7 E6 hsa-mir-106a -3,6-3,5-2,2-2,8-3,0-3,4-2,7-3,2-3,1-3,1-3,8-2,8-2,7-2,7-3,0-2,9-2,5-2,6-2,7-2,7 E7 control -2,9-3,2-2,7-3,0-2,9-3,1-3,2-3,2-1,5-2,8-1,1-2,2-1,9-2,8-2,9-2,5-2,8-2,7 E8 hsa-mir-107 2,1 1,9 2,6 2,8 2,3 2,8 3,2 2,5 3,0 2,9 2,4 3,8 2,9 4,6 3,4 3,3 3,3 2,9 2,8 3,1 E9 hsa-mir-122a 12,9 13,0 10,8 14,0 12,7 14,4 14,7 11,1 13,8 13,5 12,3 15,0 11,6 15,4 13,6 15,4 13,8 13,5 13,3 14,0 E10 hsa-mir-124a 9,6 11,7 10,0 8,8 10,0 10,3 10,3 7,1 9,5 9,3 12,3 14,0 9,6 7,8 10,9 11,7 14,1 5,6 6,7 9,5 E11 hsa-mir-124b 6,3 5,9 9,9 9,5 7,9 10,0 9,5 8,8 8,6 9,2 8,5 9,3 6,8 6,7 7,8 8,8 9,2 4,4 3,5 6,5 E12 hsa-mir-125a -1,6-1,8-1,0-0,6-1,2-2,0-2,6-1,3-1,4-1,8-2,9-1,9-1,8-1,6-2,0-2,4-2,4-1,9-2,6-2,3 F1 hsa-mir-125b -3,0-3,6-1,4-1,6-2,4-3,0-2,7-2,3-2,1-2,5-2,5-2,8-1,6-1,2-2,0-2,5-3,2-1,3-2,1-2,3 F2 hsa-mir-126-6,3-6,0-5,1-5,2-5,6-6,1-5,9-5,3-5,1-5,6-6,2-6,0-5,9-6,0-6,0-6,3-6,0-5,1-5,2-5,6 F3 control -4,6-3,9-4,9-4,3-4,4-4,2-4,0-4,1-3,8-3,4-4,3-4,2-3,9-3,6-4,1-4,6-4,4-4,2 F4 hsa-mir-127 1,2 1,3 1,3 0,8 1,2 1,2 0,9 0,7 0,8 0,9 0,8 0,7 1,1 1,2 1,0 0,9 0,4 1,8 0,6 0,9 F5 hsa-mir-128a 3,8 3,4 3,9 4,2 3,8 3,6 3,8 3,8 4,3 3,9 3,9 4,1 3,5 4,2 3,9 4,9 4,6 3,7 4,0 4,3 F6 hsa-mir-128b 5,2 5,1 5,0 4,6 4,9 5,6 5,7 4,9 4,9 5,3 5,5 6,1 5,1 5,4 5,5 7,4 6,5 5,9 6,4 6,5 F7 hsa-mir-129 8,7 9,2 7,5 5,6 7,8 10,0 8,6 5,7 6,3 7,6 9,7 10,0 7,1 6,0 8,2 8,8 9,1 5,7 5,9 7,3 F8 hsa-mir-130a -2,8-3,0-2,3-2,4-2,6-3,0-3,0-2,4-2,2-2,6-3,1-2,7-2,6-2,6-2,7-3,0-3,2-2,2-2,5-2,7 F9 hsa-mir-130b -2,3-2,8-2,3-2,9-2,6-2,7-2,7-3,0-2,8-2,8-2,7-2,2-3,0-3,0-2,7-2,6-2,3-2,5-2,7-2,5 F10 hsa-mir-132 3,6 3,3 2,9 3,0 3,2 2,8 3,3 2,3 2,7 2,8 3,4 3,5 2,5 3,1 2,4 2,2 2,0 2,1 2,2 F11 hsa-mir-133a 13,1 14,0 15,7 15,6 14,6 14,4 11,3 10,7 10,8 11,8 12,4 12,3 13,5 15,4 13,4 13,0 13,1 13,1 11,5 12,7 F12 hsa-mir-133b 13,2 11,4 12,9 12,5 12,5 14,4 12,5 11,5 12,0 12,6 9,9 10,7 10,3 10,1 10,3 11,7 11,7 9,9 10,1 10,8 G1 hsa-mir-134 3,0 2,0 2,4 2,9 2,6 2,1 2,7 2,4 1,9 2,3 2,3 2,7 2,7 1,8 2,4 3,2 2,5 2,8 2,6 2,8 G2 hsa-mir-135a 8,7 8,9 8,9 10,7 9,3 9,5 10,4 12,2 5,4 9,4 10,5 10,5 10,0 9,5 10,1 11,1 10,9 9,7 12,3 11,0 G3 hsa-mir-135b 11,1 13,0 9,4 10,7 11,0 12,8 14,0 10,5 8,2 11,4 12,0 10,7 11,0 9,4 10,8 11,7 10,9 12,2 9,9 11,2 G4 control 7,1 8,5 8,5 8,5 8,1 8,6 8,0 8,3 9,3 8,8 9,9 8,7 9,2 8,8 9,8 8,7 10,8 9,5 G5 hsa-mir-137 0,3 0,3-1,0-0,8-0,3 0,2 0,3-0,7-0,7-0,2 0,6 0,7-0,4-0,6 0,1 0,6 0,5-0,6-0,3 0,1 G6 hsa-mir ,7 12,0 9,6 10,9 11,0 14,4 11,2 8,3 7,9 10,4 12,4 15,0 9,0 9,1 11,4 15,4 15,2 9,7 9,3 12,4 G7 hsa-mir-139 3,5 3,0 4,4 4,4 3,8 2,9 3,1 4,1 4,0 3,5 2,1 2,2 3,8 3,4 2,9 1,7 1,4 2,7 2,5 2,1 G8 hsa-mir-140-0,1-0,3-0,4-0,6-0,3-0,5-0,2-0,8-0,6-0,5 0,1-0,2-0,5-0,5-0,3 0,1-0,2-0,3-0,7-0,3 G9 hsa-mir-141 7,5 6,8 7,1 7,3 7,2 7,5 6,1 6,3 5,6 6,4 8,8 9,0 8,3 7,1 8,3 8,4 8,3 6,6 8,0 7,8 G10 hsa-mir-142-3p 8,7 8,6 9,3 8,6 8,8 9,0 8,5 10,4 7,8 8,9 9,8 9,7 8,2 7,4 8,8 9,5 9,3 7,0 8,1 8,5 G11 hsa-mir-142-5p 12,3 12,7 15,7 15,6 14,1 12,0 14,7 15,6 15,6 14,5 11,5 12,7 15,1 12,7 13,0 12,5 15,1 12,7 14,3 13,7 G12 control 8,9 7,9 8,8 9,8 8,8 9,0 7,6 8,3 9,2 9,0 8,2 8,2 8,6 9,2 9,7 7,3 8,4 8,6 H1 hsa-mir ,9 13,4 11,9 11,8 13,3 14,4 14,7 11,7 9,0 12,4 14,8 14,9 11,4 13,1 13,5 13,9 14,4 10,8 10,6 12,4 H2 hsa-mir-145 5,4 5,1 7,8 5,3 5,9 4,4 5,0 4,9 3,8 4,5 4,6 4,2 5,0 4,8 4,7 4,1 3,9 3,8 4,5 4,1 H3 hsa-mir-146-1,4-1,2-2,0-2,3-1,7-1,6-1,5-1,3-2,1-1,6-2,0-1,7-2,0-1,9-1,9-2,1-2,5-3,1-2,8-2,6 H4 hsa-mir ,7 11,7 11,0 8,9 10,6 9,7 12,2 13,2 9,8 11,2 10,9 10,0 12,7 10,9 11,1 9,9 10,6 7,7 10,4 9,6 H5 hsa-mir-148a 4,5 5,0 4,8 4,3 4,6 4,6 4,9 4,8 4,4 4,7 5,4 5,0 4,7 5,0 5,0 4,9 5,2 5,2 5,1 5,1 H6 control 0,2 0,1 0,1 0,0 0,1 0,2 0,4 0,3 0,7 0,2 0,0-0,2 0,2 0,6 0,4 0,0 0,1 0,3 H7 hsa-mir-149 6,1 5,9 6,1 5,7 5,9 5,4 5,4 5,9 5,3 5,5 5,0 4,3 4,7 5,1 4,8 3,9 3,4 3,9 3,9 3,8 H8 hsa-mir-150 9,3 8,8 9,3 10,0 9,4 8,5 8,1 8,4 7,6 8,2 6,3 6,0 6,8 6,7 6,5 5,1 4,4 5,0 4,8 4,8 H9 hsa-mir-151-0,5-0,8-0,4-1,1-0,7-1,2-0,7-1,2-1,7-1,2-0,6-1,0-1,4-1,5-1,1-1,0-1,4-1,3-1,2-1,2 H10 hsa-mir-152 3,1 1,1 1,3 0,7 1,5 0,7 0,9 0,8 0,8 0,8 1,1 0,1 0,2 0,6 0,5 1,1 0,6 1,1 0,8 0,9 H11 hsa-let-7a -3,5-4,2-3,4-3,7-3,7-3,5-3,7-3,4-3,2-3,5-4,3-3,5-3,5-3,3-3,7-4,4-4,0-4,0-3,3-3,9 H12 hsa-mir-16-4,0-5,2-4,1-4,3-4,4-5,2-4,8-4,3-4,3-4,7-3,7-4,4-4,7-4,2-4,3-4,7-4,1-4,6-4,2-4,4

10 PLATE 1: Ct ( Ct sample - media Ct normoxia) normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a 0,9-0,1-0,3-0,5 0,0-0,3 0,3-0,7-0,3-0,2-0,5 0,2-0,4-0,5-0,3-0,2-0,4-1,1-1,4-0,8 A2 cel-lin-4-0,4 1,3-0,4-0,5 0,0-0,7 0,1-4,4-0,6-1,4 1,0 1,0-2,4-0,9-0,3 1,5 0,2-2,3-2,6-0,8 A3 control -1,0-1,1 1,5 0,7 0,0 1,0 0,7 0,8 1,0 0,9 0,9 0,8 2,6 2,3 1,7 2,3 2,9 3,5 3,3 3,0 A4 hsa-mir-9 0,6 0,5-1,1-0,1 0,0 0,9 0,1-4,2-2,9-1,5 1,2 0,9-1,2-1,9-0,2 0,1-0,8-1,8-2,2-1,2 A5 hsa-mir-9* -1,0 2,9-0,7-1,2 0,0 0,0 0,8-3,3-0,6-0,8 0,0 1,8-0,6-1,7-0,1-1,0-1,4 0,2-0,8-0,7 A6 hsa-mir-10a 0,1-0,3 0,0 0,1 0,0-0,3 0,1 0,0 0,0 0,0-0,2-0,3-0,5-0,2-0,3-0,7-1,0-0,7-0,9-0,8 A7 control -0,1-0,5 0,4 0,3 0,0-0,2 0,4 0,1-0,1-0,4-0,1 0,1-0,1-0,5-0,6 0,1-0,1-0,2 A8 hsa-mir-15a -1,2-1,4 1,4 1,3 0,0-1,5-1,6 1,2 1,3-0,2 0,0-0,1 1,0 1,1 0,5-0,9-0,8 1,2 1,1 0,2 A9 hsa-mir-15b -0,1-0,1 0,2 0,1 0,0-0,5 0,0-0,4-0,4-0,3-0,3-0,1-0,1 0,0-0,1-0,5-0,4 0,3 0,1-0,1 A10 hsa-mir-16-0,4-0,3 0,4 0,3 0,0-0,4-0,5 0,0-0,1-0,2 0,0-0,5 0,0-0,2-0,2-0,7-0,8 0,5-0,2-0,3 A11 hsa-mir-17-3p -0,1 0,2 0,1-0,2 0,0 0,1 0,3-0,9-0,4-0,2 0,3-0,4-0,2 0,0-0,1 0,3-0,1-0,5-0,7-0,2 A12 hsa-mir-17-5p 0,6-0,5-0,1 0,0 0,2 0,7-1,2-0,3-0,1 0,3 0,5-0,4-0,9-0,1 0,5 0,9 0,0-0,2 0,3 B1 ath-mir159a 1,3-1,4-0,3 0,4 0,0 2,0-0,8-0,5-1,6-0,2-0,1 2,6-2,7-0,1-0,1 1,9 2,4-0,8-0,6 0,7 B2 hsa-mir-19a 0,1 0,1-0,4 0,2 0,0 1,4 2,4 0,9 1,8 1,6-0,2 0,8 3,0 2,7 1,6-0,1 0,9 1,1 2,9 1,2 B3 control 0,5 0,3-0,5-0,4 0,0 0,2 0,3 0,2 0,9 0,9-0,5-0,4 0,2 0,6 0,3-0,3-0,5 0,0 B4 hsa-mir-20 0,4-0,6 0,0 0,2 0,0 0,4-0,1 1,0 0,6 0,5 0,5 1,0 1,2 0,9 0,9 0,8 2,4 0,4 1,1 1,2 B5 hsa-mir-21-0,2-0,9 0,4 0,6 0,0-0,1-0,1-0,5-0,1-0,2-0,2-0,1 0,5 0,4 0,1-0,2-0,4-0,1 0,2-0,1 B6 control -0,3-0,5 0,2 0,6 0,0-0,5-0,5-0,5-0,1 0,0 0,5 0,7 0,3-0,6-0,4 0,7 0,4 0,0 B7 hsa-mir-23a -0,3-0,7 0,5 0,5 0,0-0,5-0,2 0,0 0,3-0,1-0,9-0,8 1,4 1,2 0,2-0,9-0,6 0,3 0,4-0,2 B8 hsa-mir-23b 0,2-0,7-0,1 0,5 0,0-0,3-0,5 0,0 0,1-0,2 0,3-0,2 0,2 0,3 0,1-0,2-0,2 0,4 0,7 0,1 B9 control 0,2 0,3-0,4-0,1 0,0-0,6 0,2-0,2-0,1 0,2-0,1 0,2 0,0 0,1-0,4 0,0 0,0-0,1 B10 hsa-mir-25 0,6 0,4-1,0-0,1 0,0 0,4 0,7-0,3-0,4 0,1 0,4 0,7 0,0-0,1 0,2 0,4 0,4-0,2 0,1 0,2 B11 hsa-mir-26a 0,0 0,1 0,0-0,1 0,0-0,4-0,8-0,2-0,4-0,5-0,6-0,3-0,3-0,5-0,4-0,8-0,9-0,7-0,9-0,8 B12 hsa-mir-26b 0,0 0,2-0,3 0,1 0,0-0,2 0,1 0,2-0,9-0,2-0,8 0,1-0,8-1,3-0,7-0,7-0,7-0,6-0,4-0,6 C1 hsa-mir-27a -0,1-0,4 0,5 0,0 0,0-0,1 0,1-0,4-0,4-0,2-0,1-0,5-0,4-0,8-0,5-0,1-0,2-0,1-0,1-0,1 C2 hsa-mir-27b -0,6-1,1 0,8 0,9 0,0-0,5-0,1 0,5 0,5 0,1-1,0-1,6 0,2 0,0-0,6-1,2-1,0 0,4 0,4-0,4 C3 hsa-mir-28-0,1-0,1 0,1 0,1 0,0-0,3-0,1-0,3-0,2-0,2 0,2 0,1 0,0 0,0 0,1-0,2-0,2-0,2-0,3-0,2 C4 hsa-mir-29a 0,2-0,4 0,2 0,0 0,0 0,4-0,4 0,1 0,4 0,1-0,8-0,1 0,3 0,1-0,1-0,9-0,4-0,3-0,1-0,4 C5 hsa-mir-29b 0,1-0,2 0,1 0,0 0,0 0,0 0,3-0,6 0,3 0,0 0,3-0,1 0,6 0,1 0,2 0,1 0,0 0,2 0,1 0,1 C6 hsa-mir-29c -0,1-0,6 1,0-0,3 0,0-0,3-0,4-0,4 0,2-0,2-0,9 0,0-0,3 0,0-0,3-0,6-0,4-0,3-0,6-0,5 C7 hsa-mir-30a-3p 0,1 0,1 0,1-0,3 0,0 0,7-0,1-0,5 0,0 0,0-0,1 0,0-0,2-0,1-0,1-0,2 0,2 0,3-0,2 0,0 C8 hsa-mir-30b -0,3-0,1 0,2 0,2 0,0 0,1-0,4 0,7 0,6 0,3 0,2 0,2 0,3 0,4 0,3-0,3-0,1 0,4 0,1 0,0 C9 hsa-mir-30c -0,2-0,4 0,3 0,4 0,0-0,3 0,0 0,6 0,5 0,2 0,2-0,4 0,0 0,1 0,0-0,2-0,4 0,2 0,1-0,1 C10 hsa-mir-30d -0,5-1,0 0,6 1,0 0,0-0,5-0,2-0,1 0,9 0,0-0,6-0,8 0,0 0,0-0,3-2,1-1,0-0,2-0,2-0,9 C11 hsa-mir-30e -0,5 0,1 0,1 0,3 0,0 0,2 0,1 0,6 0,3 0,4 0,3 1,4 1,4 0,9-1,0 0,1 0,7 0,7 0,1 C12 hsa-mir-31 0,0-0,3 0,4-0,1 0,0-0,4-0,3-0,6-0,5-0,5-0,3 0,1-0,3-0,3-0,2-0,3 0,2-0,2-0,7-0,2 D1 control -1,3-1,2 0,8 1,7 0,0-0,3 0,0-0,1-1,9 0,1 0,7 1,0 0,0-0,2-0,5 0,8 0,8 0,2 D2 control -0,5-0,6 0,5 0,6 0,0 0,1 0,2 0,1 0,6-0,3 0,3 0,0 0,1-0,1-0,9-0,1-0,4-0,4 D3 hsa-mir-34a 0,3-0,2 0,0-0,1 0,0 0,0-0,7-0,1-0,1-0,2-0,5-0,9 0,0-0,1-0,4-1,0-1,6-0,5-0,8-1,0 D4 hsa-mir-34b 0,5 0,0-0,1-0,3 0,0 0,4 0,6-1,2-3,0-0,8-0,3 0,2 0,3 0,7 0,3-1,1-0,1-2,0-2,1-1,3 D5 hsa-mir-34c 1,6 0,9-1,2-1,3 0,0 1,8 1,8-2,7-1,8-0,2 0,6-0,1-0,4 0,4 0,1-0,5-1,0-1,5-1,5-1,1 D6 hsa-mir-92 0,3 0,3-0,3-0,4 0,0 0,0-0,2-0,8-0,8-0,4-0,1 0,1-0,6-0,6-0,3-0,2-0,5-0,4-0,6-0,4 D7 control -0,4 0,1 0,1 0,2 0,0 0,6 0,6 0,6 1,0 1,4-0,3 0,0 0,5 0,8 1,2 0,2 0,3 0,6 D8 hsa-mir-95-0,7-0,2 0,4 0,5 0,0-0,1 0,2-0,6 1,0 0,1-0,7 0,0 0,4 0,2 0,0-1,7-1,1 0,2 0,2-0,6 D9 hsa-mir-96-0,5-1,1 1,5 0,1 0,0-1,2-1,4 0,5-1,5-0,9-0,8-0,6 0,6 1,5 0,2-1,5-2,0-0,7 0,2-1,0 D10 hsa-mir-98-0,4 0,0 0,1 0,4 0,0-0,2-0,3 0,7 0,4 0,2 0,2 0,0 0,8 0,9 0,5-0,9-0,3 0,7 1,0 0,1 D11 hsa-mir-99a -0,5-0,3 0,6 0,1 0,0-1,1-0,5-0,4-0,1-0,6-0,5-0,3-0,3-0,3-0,3-0,2-0,1 0,1 0,0-0,1 D12 control -0,8-1,1 1,2 0,7 0,0-1,3-1,5-1,4-0,9 0,0 0,3 0,6 0,0-1,3-1,1 0,0 0,2-0,6 E1 hsa-mir-100 0,3 0,2-0,5 0,0 0,0 0,0 0,2-0,8-0,2-0,2-0,1 0,1-0,4-0,2-0,2 0,6 0,1 0,2 0,2 0,3 E2 control -0,1-0,3 0,0 0,3 0,0-0,7-0,2-0,5-0,6-0,8-1,0-1,1-0,8-0,5-0,5-0,7-0,7-0,6 E3 hsa-mir-103 0,1-0,3 0,2 0,0 0,0-0,4-0,3-0,7-1,0-0,6-0,1-0,3 0,3 0,2 0,0-0,3-0,8 0,2-0,2-0,3 E4 hsa-mir-104 0,5 2,7-1,3-1,8 0,0 3,4 2,1-1,7-2,0 0,4 4,9 2,0-1,4-0,5 1,2 2,3 4,6-2,3-3,3 0,3 E5 hsa-mir-105-0,9 0,6-0,9 1,2 0,0 2,3 0,1 0,6 3,7 1,7-0,6 3,1 1,8 1,5 1,5 0,7 0,7 0,0-2,1-0,2 E6 hsa-mir-106a -0,6-0,5 0,9 0,3 0,0-0,4 0,4-0,2 0,0-0,1-0,8 0,2 0,3 0,3 0,0 0,1 0,5 0,4 0,3 0,3 E7 control 0,0-0,2 0,2 0,0 0,0-0,1-0,3-0,2 1,4 0,1 1,8 0,8 1,0 0,2 0,0 0,4 0,1 0,2 E8 hsa-mir-107-0,2-0,5 0,2 0,5 0,0 0,5 0,9 0,2 0,6 0,5 0,0 1,4 0,6 2,3 1,1 1,0 0,9 0,6 0,5 0,7 E9 hsa-mir-122a 0,2 0,3-1,9 1,3 0,0 1,7 2,0-1,6 1,1 0,8-0,4 2,3-1,0 2,7 0,9 2,7 1,2 0,8 0,6 1,3 E10 hsa-mir-124a -0,4 1,7 0,0-1,2 0,0 0,3 0,3-2,9-0,5-0,7 2,3 4,0-0,4-2,2 0,9 1,7 4,1-4,4-3,3-0,5 E11 hsa-mir-124b -1,6-2,0 2,0 1,6 0,0 2,1 1,6 0,9 0,7 1,3 0,5 1,4-1,2-1,2-0,1 0,9 1,3-3,5-4,4-1,4 E12 hsa-mir-125a -0,3-0,6 0,2 0,6 0,0-0,8-1,3-0,1-0,2-0,6-1,6-0,6-0,5-0,4-0,8-1,1-1,2-0,6-1,4-1,1 F1 hsa-mir-125b -0,6-1,2 1,0 0,8 0,0-0,6-0,3 0,1 0,3-0,1-0,1-0,4 0,8 1,2 0,4-0,1-0,8 1,1 0,3 0,1 F2 hsa-mir-126-0,6-0,4 0,5 0,5 0,0-0,5-0,3 0,4 0,5 0,0-0,5-0,4-0,2-0,3-0,4-0,7-0,3 0,5 0,5 0,0 F3 control -0,2 0,5-0,4 0,1 0,0 0,3 0,4 0,4 0,7 1,0 0,2 0,3 0,5 0,8 0,3-0,1 0,0 0,3 F4 hsa-mir-127 0,0 0,1 0,1-0,3 0,0 0,0-0,2-0,5-0,3-0,2-0,3-0,4-0,1 0,0-0,2-0,3-0,8 0,6-0,6-0,3 F5 hsa-mir-128a -0,1-0,4 0,1 0,4 0,0-0,2 0,0 0,0 0,4 0,1 0,1 0,3-0,3 0,3 0,1 1,1 0,8-0,1 0,2 0,5 F6 hsa-mir-128b 0,2 0,1 0,0-0,4 0,0 0,7 0,8 0,0 0,0 0,3 0,6 1,1 0,2 0,4 0,6 2,5 1,5 0,9 1,5 1,6 F7 hsa-mir-129 1,0 1,5-0,3-2,2 0,0 2,2 0,8-2,1-1,5-0,1 2,0 2,2-0,7-1,8 0,4 1,0 1,3-2,1-1,9-0,4 F8 hsa-mir-130a -0,1-0,4 0,3 0,2 0,0-0,4-0,3 0,2 0,5 0,0-0,5 0,0 0,1 0,0-0,1-0,3-0,6 0,5 0,1-0,1 F9 hsa-mir-130b 0,3-0,2 0,3-0,3 0,0-0,1-0,1-0,4-0,2-0,2-0,1 0,4-0,4-0,4-0,1 0,0 0,3 0,1-0,1 0,1 F10 hsa-mir-132 0,4 0,1-0,3-0,2 0,0-0,4 0,1-0,9-0,5-0,4 0,2 0,3-0,8-0,1-0,8-1,1-1,2-1,1-1,1 F11 hsa-mir-133a -1,5-0,6 1,1 1,0 0,0-0,2-3,3-3,9-3,7-2,8-2,1-2,3-1,1 0,8-1,2-1,6-1,5-1,5-3,1-1,9 F12 hsa-mir-133b 0,7-1,1 0,4 0,0 0,0 1,9 0,0-1,0-0,5 0,1-2,6-1,8-2,2-2,4-2,2-0,8-0,8-2,6-2,4-1,6 G1 hsa-mir-134 0,4-0,5-0,1 0,3 0,0-0,5 0,1-0,2-0,7-0,3-0,3 0,1 0,1-0,8-0,2 0,7-0,1 0,2 0,1 0,2 G2 hsa-mir-135a -0,6-0,5-0,4 1,4 0,0 0,2 1,1 2,8-3,9 0,1 1,2 1,2 0,7 0,2 0,8 1,8 1,6 0,4 3,0 1,7 G3 hsa-mir-135b 0,0 1,9-1,6-0,3 0,0 1,8 2,9-0,6-2,8 0,3 0,9-0,4-0,1-1,7-0,3 0,7-0,2 1,1-1,2 0,1 G4 control -1,1 0,3 0,3 0,4 0,0 0,5-0,2 0,2 1,2 0,7 1,8 0,6 1,1 0,6 1,7 0,6 2,7 1,4 G5 hsa-mir-137 0,6 0,6-0,7-0,5 0,0 0,5 0,6-0,4-0,4 0,1 0,9 1,0-0,1-0,2 0,4 0,9 0,8-0,3 0,0 0,4 G6 hsa-mir-138 0,6 1,0-1,4-0,2 0,0 3,3 0,2-2,8-3,2-0,6 1,4 3,9-2,1-1,9 0,3 4,3 4,1-1,3-1,8 1,3 G7 hsa-mir-139-0,4-0,8 0,6 0,6 0,0-1,0-0,8 0,2 0,2-0,3-1,7-1,7-0,1-0,5-1,0-2,1-2,4-1,2-1,3-1,8 G8 hsa-mir-140 0,2 0,0 0,0-0,2 0,0-0,1 0,1-0,5-0,2-0,2 0,5 0,1-0,2-0,1 0,1 0,4 0,1 0,1-0,3 0,1 G9 hsa-mir-141 0,3-0,4-0,1 0,1 0,0 0,3-1,1-0,9-1,6-0,8 1,6 1,8 1,1-0,1 1,1 1,3 1,1-0,6 0,8 0,6 G10 hsa-mir-142-3p -0,1-0,2 0,5-0,2 0,0 0,2-0,3 1,6-1,0 0,2 1,0 0,9-0,5-1,3 0,0 0,7 0,5-1,8-0,7-0,3 G11 hsa-mir-142-5p -1,8-1,3 1,6 1,5 0,0-2,1 0,6 1,5 1,5 0,4-2,6-1,4 1,0-1,4-1,1-1,6 1,0-1,4 0,2-0,4 G12 control 0,1-1,0-0,1 0,9 0,0 0,2-1,2-0,5 0,3 0,2-0,6-0,7-0,2 0,4 0,8-1,5-0,5-0,2 H1 hsa-mir-144 2,6 0,2-1,4-1,4 0,0 1,1 1,4-1,6-4,3-0,8 1,5 1,6-1,9-0,2 0,3 0,7 1,1-2,5-2,7-0,9 H2 hsa-mir-145-0,5-0,8 1,9-0,6 0,0-1,5-0,9-1,0-2,1-1,4-1,3-1,7-0,9-1,1-1,2-1,8-2,0-2,1-1,4-1,8 H3 hsa-mir-146 0,3 0,5-0,3-0,6 0,0 0,1 0,2 0,4-0,3 0,1-0,2 0,1-0,3-0,1-0,1-0,3-0,8-1,3-1,0-0,9 H4 hsa-mir-147 0,1 1,1 0,4-1,7 0,0-0,9 1,6 2,6-0,8 0,6 0,3-0,6 2,1 0,3 0,5-0,7 0,0-3,0-0,2-1,0 H5 hsa-mir-148a -0,1 0,3 0,1-0,3 0,0-0,1 0,2 0,2-0,2 0,0 0,8 0,3 0,1 0,3 0,4 0,3 0,5 0,5 0,4 0,5 H6 control 0,1 0,0 0,0-0,1 0,0 0,1 0,3 0,2 0,6 0,2-0,1-0,2 0,1 0,5 0,4-0,1 0,0 0,2 H7 hsa-mir-149 0,1-0,1 0,2-0,2 0,0-0,5-0,6 0,0-0,6-0,5-0,9-1,6-1,3-0,8-1,2-2,0-2,6-2,1-2,0-2,2 H8 hsa-mir-150 0,0-0,6-0,1 0,7 0,0-0,8-1,3-0,9-1,7-1,2-3,0-3,3-2,6-2,6-2,9-4,3-5,0-4,4-4,6-4,6 H9 hsa-mir-151 0,2-0,1 0,3-0,4 0,0-0,5 0,0-0,5-0,9-0,5 0,1-0,2-0,6-0,7-0,4-0,3-0,7-0,6-0,5-0,5 H10 hsa-mir-152 1,5-0,4-0,2-0,9 0,0-0,9-0,7-0,8-0,8-0,8-0,5-1,4-1,3-1,0-1,0-0,5-0,9-0,5-0,8-0,7 H11 hsa-let-7a 0,2-0,5 0,3 0,0 0,0 0,1 0,0 0,3 0,4 0,2-0,7 0,1 0,2 0,3 0,0-0,7-0,3-0,3 0,4-0,2 H12 hsa-mir-16 0,4-0,8 0,3 0,1 0,0-0,8-0,4 0,1 0,1-0,3 0,7 0,0-0,3 0,2 0,1-0,3 0,3-0,2 0,2 0,0

11 PLATE 2: raw data Ct normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a 21,3 21,7 19,1 19,2 20,3 21,2 21,2 21,1 20,8 21,0 20,6 21,1 21,3 20,6 20,9 20,1 20,2 22,1 21,6 21,0 A2 hsa-mir-16 19,4 19,8 19,4 19,4 19,5 20,8 20,6 20,2 20,1 20,4 20,6 20,3 20,2 20,3 20,4 19,6 19,6 20,9 20,6 20,2 A3 control 40,0 40,0 36,9 40,0 39,2 39,3 37,5 40,0 37,9 38,7 38,5 38,2 39,7 40,0 39,1 36,8 36,6 40,0 40,0 38,4 A4 hsa-mir ,8 27,6 28,0 28,7 28,0 28,8 28,4 29,1 28,3 28,6 28,2 28,2 29,2 28,9 28,6 27,1 27,9 29,8 29,2 28,5 A5 hsa-mir-154* 25,1 25,4 26,0 26,2 25,7 26,2 26,4 26,5 25,9 26,3 27,1 27,4 27,7 27,3 27,3 26,4 27,1 29,3 28,8 27,9 A6 hsa-mir ,1 24,2 23,2 23,5 23,8 25,3 25,0 24,4 24,1 24,7 24,2 24,2 24,7 24,4 24,4 22,7 23,1 24,9 24,9 23,9 A7 hsa-mir-181a 22,5 22,5 22,6 23,0 22,7 22,7 23,1 23,0 22,4 22,8 22,6 22,9 22,6 22,3 22,6 21,0 21,1 22,8 22,1 21,7 A8 hsa-mir-181b 21,3 21,5 20,7 21,0 21,1 22,6 22,1 21,8 21,0 21,9 21,5 22,0 21,4 21,0 21,5 20,4 20,6 22,1 21,7 21,2 A9 hsa-mir-181c 26,3 27,1 27,3 27,8 27,1 27,7 28,0 28,1 27,7 27,9 27,4 27,7 27,4 27,4 27,5 25,4 26,1 28,1 27,1 26,7 A10 hsa-mir ,9 34,1 34,8 33,8 33,9 33,7 35,0 37,6 36,1 35,6 33,8 34,7 36,3 35,7 35,1 32,1 33,7 35,3 34,4 33,9 A11 hsa-mir-182* 38,1 40,0 36,9 40,0 38,7 40,0 39,4 39,9 36,1 38,8 40,0 39,0 39,8 40,0 39,7 37,5 39,7 37,7 36,2 37,8 A12 hsa-mir ,0 37,8 39,1 38,8 38,9 40,0 40,0 40,0 37,4 39,3 39,2 39,7 38,2 40,0 39,3 38,0 37,5 40,0 37,5 38,2 B1 hsa-mir ,3 39,0 40,0 40,0 39,6 38,9 36,7 35,7 35,3 36,7 40,0 40,0 40,0 36,4 39,1 37,3 40,0 40,0 40,0 39,3 B2 hsa-mir ,3 27,3 26,9 27,5 27,2 28,3 28,0 28,5 28,3 28,3 28,1 28,2 28,5 28,3 28,3 27,3 27,6 29,2 29,1 28,3 B3 hsa-mir ,0 22,7 21,8 22,3 22,5 23,4 23,3 22,7 22,1 22,9 23,2 23,3 22,6 22,3 22,9 22,6 22,9 23,1 23,1 22,9 B4 hsa-mir ,1 32,6 33,2 33,4 33,1 34,3 33,5 33,4 33,2 33,6 34,2 33,6 35,1 33,1 34,0 32,1 32,9 34,8 33,2 33,2 B5 control 26,1 26,2 26,7 26,9 26,5 27,3 27,4 28,1 27,8 27,6 27,0 27,7 28,7 28,4 27,9 27,5 28,0 29,6 29,5 28,6 B6 hsa-mir ,2 30,5 32,8 33,4 31,7 32,2 32,0 34,4 33,2 32,9 31,9 31,6 35,2 33,8 33,1 31,1 31,4 34,5 35,9 33,2 B7 hsa-mir ,5 33,2 34,0 35,4 33,8 33,1 34,2 34,5 35,9 34,4 33,2 34,7 37,1 35,0 35,0 32,6 33,6 34,9 36,1 34,3 B8 hsa-mir ,4 23,8 23,9 24,2 23,8 24,3 24,5 24,3 23,9 24,2 23,3 24,5 24,6 23,9 24,1 22,4 23,4 25,1 25,0 24,0 B9 control 27,6 27,6 27,9 28,3 27,8 28,3 28,3 28,4 28,3 28,3 27,8 28,1 28,1 27,5 27,9 27,0 27,1 28,6 27,8 27,6 B10 hsa-mir ,1 24,1 24,9 25,2 24,6 25,2 24,9 26,6 26,3 25,8 24,4 24,3 26,9 26,4 25,5 24,0 23,7 27,1 27,0 25,4 B11 hsa-mir ,0 27,3 27,7 28,0 27,5 27,7 27,6 28,0 28,1 27,8 27,6 27,6 28,3 27,9 27,9 26,6 26,7 27,9 27,9 27,3 B12 hsa-mir ,5 24,1 23,4 23,9 23,7 24,8 24,6 24,6 24,1 24,5 24,2 24,5 24,3 23,5 24,1 22,4 22,9 24,0 23,9 23,3 C1 hsa-mir ,8 28,1 29,1 29,2 28,8 28,6 28,5 29,1 28,2 28,6 28,1 28,0 28,4 29,0 28,4 26,5 26,2 27,6 27,3 26,9 C2 hsa-mir ,7 35,4 34,4 35,3 35,7 36,2 38,1 33,8 34,1 35,6 34,9 37,2 35,0 35,3 35,6 33,1 35,2 34,9 33,6 34,2 C3 hsa-mir-199a 26,3 25,2 26,1 26,2 26,0 26,7 26,5 27,6 26,4 26,8 26,8 26,8 27,7 27,4 27,2 27,3 26,9 28,8 28,3 27,8 C4 hsa-mir-199a* 23,9 23,9 22,7 23,1 23,4 24,6 24,3 24,1 23,7 24,2 24,3 24,2 23,6 23,6 23,9 23,5 23,6 24,3 24,1 23,9 C5 hsa-mir-199b 28,1 28,0 28,7 29,1 28,5 29,0 29,0 29,6 29,1 29,2 29,4 29,7 30,2 29,7 29,8 29,4 29,2 31,0 31,4 30,3 C6 hsa-mir-199-s 24,7 25,6 26,0 26,2 25,6 25,6 26,5 26,5 26,1 26,2 25,4 26,7 27,2 26,7 26,5 25,5 26,5 27,6 27,2 26,7 C7 hsa-mir-200a 32,0 31,8 32,3 33,1 32,3 32,6 32,4 33,3 32,0 32,6 32,3 32,1 33,2 32,5 30,6 30,2 32,6 32,3 31,4 C8 hsa-mir-200b 33,3 33,3 33,1 33,4 33,3 34,5 35,0 33,5 34,2 34,3 34,1 33,3 33,5 32,7 33,4 30,6 31,6 34,2 33,0 32,3 C9 hsa-mir-200c 32,7 32,5 32,6 32,7 32,6 33,0 33,5 31,6 31,9 32,5 32,8 33,1 33,4 32,7 33,0 32,8 32,3 33,4 33,2 32,9 C10 hsa-mir ,5 33,8 33,7 34,5 33,9 34,9 34,5 34,9 35,3 34,9 34,0 34,0 34,6 34,1 34,2 32,4 32,1 34,5 33,5 33,1 C11 hsa-mir ,1 28,1 28,3 28,7 27,8 29,4 28,6 27,2 26,8 28,0 29,0 29,9 27,9 27,7 28,6 28,4 28,6 28,5 31,4 29,2 C12 hsa-mir ,1 40,0 39,4 40,0 39,1 40,0 39,4 39,8 40,0 39,8 38,3 40,0 40,0 40,0 39,6 40,0 38,1 38,3 38,1 38,6 D1 control 36,4 36,4 37,6 36,5 36,7 36,3 36,5 35,3 36,0 36,0 37,3 39,5 36,1 34,3 36,8 35,0 38,1 36,9 34,5 36,2 D2 control 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 38,2 39,6 38,5 40,0 39,4 40,0 39,5 38,2 40,0 39,0 39,1 D3 hsa-mir ,7 25,6 26,1 26,4 25,9 23,6 23,4 23,4 22,4 23,2 21,8 21,8 21,6 21,6 21,7 20,5 20,6 22,0 21,6 21,2 D4 hsa-mir ,2 34,8 34,8 35,6 35,1 37,7 35,5 36,5 35,1 36,2 35,5 36,8 35,4 35,9 35,9 35,4 36,0 35,9 34,7 35,5 D5 hsa-mir ,2 26,2 26,6 27,0 26,5 27,4 27,1 27,2 26,9 27,2 27,4 27,4 27,0 26,8 27,1 26,3 26,3 28,0 27,4 27,0 D6 hsa-mir ,6 25,4 24,9 25,5 25,3 26,1 26,2 25,7 25,5 25,9 26,1 26,1 25,7 25,7 25,9 24,9 25,2 26,1 26,0 25,6 D7 hsa-mir ,7 29,7 30,6 30,8 30,2 30,7 30,7 31,3 30,7 30,9 29,9 29,8 30,3 30,5 30,1 29,9 30,1 31,1 31,0 30,5 D8 hsa-mir ,5 23,6 25,1 25,4 24,4 24,9 24,8 26,3 26,1 25,5 24,5 24,6 25,7 25,6 25,1 23,7 23,8 26,6 26,2 25,1 D9 control 26,5 26,3 27,3 27,5 26,9 28,2 28,2 28,4 28,0 28,2 27,8 27,8 28,1 28,0 27,9 27,2 27,3 29,1 28,4 28,0 D10 hsa-mir ,4 26,3 25,0 25,0 25,7 27,3 27,1 26,0 25,5 26,5 27,3 27,3 26,4 26,2 26,8 26,5 26,4 27,6 27,1 26,9 D11 hsa-mir ,1 31,4 32,2 32,8 31,9 32,7 32,4 32,1 31,9 32,3 32,2 32,4 32,5 32,3 32,3 31,2 31,6 33,7 32,8 32,3 D12 hsa-mir ,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 E1 hsa-mir ,7 20,1 19,5 19,5 19,9 21,2 21,3 20,5 19,7 20,7 21,2 21,5 20,5 20,3 20,9 20,8 21,1 21,3 21,3 21,1 E2 hsa-mir ,8 20,4 20,4 20,4 20,5 21,8 21,6 21,0 20,3 21,2 21,3 21,1 20,7 20,6 20,9 20,1 20,4 21,1 21,0 20,7 E3 hsa-mir ,1 34,4 35,3 36,5 35,3 35,8 36,6 35,0 33,9 35,3 34,7 34,5 34,2 34,2 34,4 34,9 35,6 37,9 36,4 36,2 E4 hsa-mir ,3 25,3 24,7 25,1 25,1 26,4 26,3 25,7 25,2 25,9 25,9 25,9 25,6 25,4 25,7 25,2 25,3 26,6 26,5 25,9 E5 hsa-mir ,1 30,6 32,5 32,2 31,3 30,9 31,1 31,8 31,0 31,2 31,1 31,0 31,5 31,2 31,2 29,4 30,1 32,1 31,4 30,7 E6 hsa-mir ,1 27,3 27,5 28,1 27,5 27,6 28,0 29,2 27,7 28,1 27,5 27,0 28,2 28,1 27,7 26,5 26,6 28,4 28,8 27,6 E7 hsa-mir ,0 23,9 23,7 23,9 24,9 24,9 24,5 24,7 24,7 24,5 24,5 24,3 24,4 23,4 23,9 25,1 24,1 E8 hsa-mir-302a 36,5 40,0 36,2 40,0 38,2 40,0 40,0 40,0 34,9 38,7 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 39,3 39,8 E9 hsa-mir-302b 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 39,3 39,8 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 E10 hsa-mir-302b* 39,8 40,0 40,0 40,0 39,9 40,0 40,0 37,1 34,9 38,0 40,0 40,0 39,6 34,2 38,4 40,0 40,0 34,3 36,2 37,6 E11 hsa-mir-302c 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 39,9 40,0 E12 hsa-mir-302c* 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 F1 hsa-mir-302d 40,0 40,0 40,0 40,0 40,0 40,0 40,0 35,4 38,3 38,4 40,0 40,0 40,0 38,1 39,5 40,0 40,0 37,6 37,0 38,7 F2 hsa-mir ,1 24,5 22,8 23,0 23,9 25,4 25,2 23,7 23,2 24,4 24,9 25,0 24,0 24,1 24,5 23,8 24,1 24,1 23,8 24,0 F3 control 20,2 20,2 20,6 20,9 20,5 22,1 21,9 20,5 20,3 21,2 23,2 22,9 21,9 21,9 22,4 22,6 22,8 24,1 24,1 23,4 F4 hsa-mir ,3 27,7 27,5 27,9 27,6 28,6 28,4 27,1 26,8 27,7 28,3 28,3 27,8 27,6 28,0 27,0 27,8 28,5 28,4 27,9 F5 control 25,4 25,8 25,4 25,4 25,5 26,9 26,9 26,5 25,7 26,5 25,5 26,1 26,7 26,4 26,2 25,0 25,5 27,0 25,8 F6 hsa-mir-324-5p 24,5 24,4 24,1 24,3 24,3 25,7 25,3 24,6 24,2 24,9 25,1 25,1 24,9 24,6 24,9 24,4 24,4 25,6 25,3 24,9 F7 hsa-mir ,6 36,3 38,0 38,6 37,1 36,9 37,9 33,1 31,6 34,9 38,1 40,0 34,9 33,5 36,6 35,4 38,0 33,4 33,2 35,0 F8 hsa-mir ,2 28,6 29,8 30,3 29,5 30,0 29,9 30,2 29,4 29,9 29,7 29,9 30,1 29,9 29,9 28,2 28,4 31,0 30,1 29,4 F9 hsa-mir ,3 32,3 32,0 32,1 32,2 32,8 32,1 31,2 30,6 31,6 31,1 30,9 29,9 29,7 30,4 28,4 28,6 29,4 29,1 28,9 F10 hsa-mir ,0 30,6 31,0 31,3 30,7 31,2 31,5 32,0 31,0 31,4 31,1 31,3 31,4 31,1 31,3 29,7 30,5 32,0 31,3 30,9 F11 hsa-mir ,1 24,6 25,6 25,7 25,0 25,6 25,6 25,6 25,5 25,6 24,7 24,8 26,3 25,5 25,3 24,2 24,2 26,4 26,1 25,2 F12 hsa-mir ,9 27,1 26,6 27,0 26,9 27,6 28,8 27,2 27,3 27,7 27,4 27,9 28,1 27,5 27,7 26,2 27,4 28,8 28,3 27,7 G1 hsa-mir ,4 32,6 32,0 32,2 32,0 31,6 32,8 32,3 32,1 32,2 31,6 32,8 33,3 32,7 32,6 31,0 32,5 33,4 33,7 32,7 G2 hsa-mir ,0 31,2 32,2 32,4 31,7 32,3 32,4 33,4 33,2 32,8 31,4 31,6 33,0 33,3 32,3 30,8 31,0 33,4 33,3 32,1 G3 hsa-mir ,1 25,2 26,7 27,0 26,0 26,0 25,7 26,9 26,7 26,3 25,3 25,3 27,2 27,1 26,2 25,0 24,9 27,3 27,3 26,1 G4 hsa-mir ,2 28,2 28,0 28,3 28,2 29,5 29,3 29,0 28,2 29,0 29,2 29,3 29,0 28,6 29,0 28,3 28,3 29,4 29,4 28,8 G5 hsa-mir ,1 25,1 25,3 25,5 25,3 26,1 25,8 25,9 25,1 25,7 25,4 25,7 25,8 25,5 25,6 23,6 24,5 26,5 26,0 25,1 G6 control 24,0 24,1 25,1 25,3 24,6 25,2 24,8 25,7 25,5 25,3 24,6 25,3 25,4 24,9 25,0 23,5 23,7 25,9 25,7 24,7 G7 control 39,8 40,0 40,0 40,0 40,0 40,0 40,0 40,0 38,5 39,6 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 38,3 39,6 G8 hsa-mir ,2 40,0 40,0 40,0 39,5 40,0 40,0 40,0 37,5 39,4 40,0 40,0 40,0 36,5 39,1 37,7 40,0 40,0 36,5 38,5 G9 hsa-mir ,4 28,8 30,1 29,4 29,2 29,4 29,5 29,9 29,4 29,6 29,7 29,8 29,6 29,4 29,6 29,3 29,5 30,9 30,3 30,0 G10 control 26,1 27,0 27,2 27,4 26,9 27,9 27,9 28,0 27,3 27,8 27,7 27,9 28,2 27,8 27,9 27,6 27,8 29,0 28,3 28,2 G11 hsa-mir ,7 28,2 26,0 26,2 27,0 29,1 29,0 26,3 26,0 27,6 28,2 28,1 26,7 26,3 27,4 27,4 27,7 27,9 27,0 27,5 G12 hsa-mir ,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 39,7 40,0 39,9 40,0 40,0 35,9 36,2 38,0 H1 hsa-mir ,9 40,0 40,0 40,0 39,7 40,0 39,0 40,0 40,0 39,7 40,0 40,0 40,0 36,6 39,1 37,3 38,5 40,0 39,0 38,7 H2 hsa-mir ,2 37,0 35,5 35,4 35,8 37,3 35,7 35,0 34,1 35,5 36,2 37,0 35,2 33,6 35,5 34,7 35,1 33,5 33,4 34,1 H3 hsa-mir-373* 38,5 40,0 40,0 40,0 39,6 40,0 40,0 37,6 37,5 38,8 40,0 40,0 37,2 38,4 38,9 40,0 40,0 38,4 39,5 H4 hsa-mir ,7 23,6 23,8 24,2 23,8 25,0 25,1 25,1 24,7 25,0 24,9 25,2 24,8 24,9 25,0 24,2 24,4 25,3 25,9 24,9 H5 hsa-let-7a 20,5 20,3 19,9 20,1 20,2 21,5 21,5 22,1 21,3 21,6 20,8 21,0 22,0 22,0 21,4 20,4 20,6 22,5 22,5 21,5 H6 hsa-let-7b 25,8 25,3 21,3 21,5 23,5 25,8 25,6 22,7 21,9 24,0 24,6 24,9 22,8 22,4 23,7 23,5 24,1 23,4 23,3 23,6 H7 hsa-let-7d 20,9 20,4 20,1 20,1 20,4 21,8 22,5 22,2 21,4 21,9 20,6 21,7 22,7 22,0 21,7 20,0 21,1 23,0 22,7 21,7 H8 hsa-let-7e 26,1 26,4 25,2 25,2 25,7 27,4 27,4 26,6 26,1 26,9 26,2 26,3 26,4 26,1 26,3 25,4 25,7 27,2 27,2 26,4 H9 cel-mir-2 40,0 40,0 40,0 40,0 40,0 40,0 40,0 40,0 39,3 39,8 40,0 40,0 40,0 40,0 40,0 39,7 40,0 40,0 38,5 39,5 H10 hsa-let-7g 22,2 22,4 21,8 21,8 22,1 23,1 23,1 23,1 22,3 22,9 22,6 22,8 23,1 23,1 22,9 21,5 21,9 23,1 23,2 22,4 H11 has-let-7i 21,8 21,8 21,3 21,5 21,6 22,9 23,0 23,1 22,4 22,9 22,9 23,0 23,3 23,1 23,1 21,6 21,9 23,7 23,5 22,7 H12 hsa-mir-16 20,0 20,3 19,7 19,8 19,9 20,9 20,9 20,7 20,1 20,6 20,6 21,0 20,2 20,3 20,5 19,9 20,1 21,2 21,0 20,5 MEDIAN 27,4 27,7 27,8 28,3 28,6 28,5 28,4 28,1 28,1 28,2 28,4 28,2 27,3 27,8 29,1 28,9

12 PLATE 2: Ct (Ct of each mir - median Ct) normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a -6,1-6,0-8,7-9,1-7,5-7,5-7,3-7,4-7,3-7,4-7,5-7,1-7,1-7,6-7,3-7,3-7,6-7,0-7,3-7,3 A2 hsa-mir-16-8,1-7,9-8,4-8,8-8,3-7,8-7,8-8,2-8,1-8,0-7,5-7,8-8,2-7,9-7,9-7,7-8,2-8,2-8,3-8,1 A3 control 12,6 12,3 9,2 11,8 11,5 10,6 9,1 11,6 9,7 10,3 10,4 10,1 11,4 11,8 10,9 9,5 8,8 10,9 11,1 10,1 A4 hsa-mir-154 0,3 0,0 0,2 0,4 0,2 0,1 0,0 0,7 0,1 0,2 0,1 0,1 0,8 0,6 0,4-0,3 0,1 0,6 0,3 0,2 A5 hsa-mir-154* -2,3-2,3-1,7-2,1-2,1-2,5-2,0-1,9-2,2-2,2-1,1-0,8-0,7-1,0-0,9-0,9-0,7 0,2-0,2-0,4 A6 hsa-mir-155-3,3-3,4-4,6-4,8-4,0-3,3-3,5-4,0-4,1-3,7-3,9-4,0-3,7-3,8-3,9-4,6-4,7-4,2-4,0-4,4 A7 hsa-mir-181a -4,9-5,1-5,2-5,2-5,1-5,9-5,4-5,4-5,7-5,6-5,5-5,3-5,8-5,9-5,6-6,4-6,7-6,3-6,8-6,5 A8 hsa-mir-181b -6,1-6,2-7,1-7,2-6,6-6,1-6,4-6,6-7,1-6,5-6,7-6,1-7,0-7,3-6,8-7,0-7,2-7,1-7,2-7,1 A9 hsa-mir-181c -1,1-0,6-0,4-0,4-0,6-0,9-0,5-0,3-0,4-0,5-0,7-0,4-1,0-0,9-0,7-1,9-1,7-1,0-1,8-1,6 A10 hsa-mir-182 5,4 6,4 7,0 5,6 6,1 5,1 6,6 9,2 7,9 7,2 5,7 6,5 7,9 7,5 6,9 4,8 5,9 6,1 5,5 5,6 A11 hsa-mir-182* 10,6 12,3 9,1 11,8 11,0 11,4 10,9 11,5 8,0 10,4 11,9 10,8 11,4 11,8 11,5 10,2 11,9 8,6 7,3 9,5 A12 hsa-mir ,6 10,1 11,3 10,5 11,1 11,4 11,5 11,6 9,3 10,9 11,0 11,5 9,8 11,8 11,0 10,7 9,7 10,9 8,5 9,9 B1 hsa-mir ,8 11,4 12,2 11,8 11,8 10,3 8,3 7,3 7,2 8,2 11,9 11,9 11,6 8,2 10,9 9,9 12,2 10,9 11,1 11,0 B2 hsa-mir-185-0,1-0,4-0,9-0,8-0,6-0,3-0,4 0,1 0,2-0,1-0,1 0,0 0,2 0,1 0,1 0,0-0,2 0,0 0,2 0,0 B3 hsa-mir-186-4,5-4,9-5,9-6,0-5,3-5,2-5,2-5,7-6,0-5,5-4,9-4,8-5,8-5,9-5,4-4,8-4,9-6,0-5,8-5,4 B4 hsa-mir-187 5,7 4,9 5,4 5,1 5,3 5,7 5,1 5,0 5,1 5,2 6,1 5,4 6,7 4,9 5,8 4,8 5,2 5,6 4,2 5,0 B5 control -1,4-1,4-1,1-1,4-1,3-1,3-1,1-0,3-0,4-0,8-1,1-0,5 0,3 0,2-0,3 0,2 0,3 0,4 0,5 0,3 B6 hsa-mir-189 2,8 2,8 5,1 5,2 3,9 3,5 3,5 6,0 5,1 4,5 3,8 3,5 6,8 5,6 4,9 3,7 3,6 5,4 7,0 4,9 B7 hsa-mir-190 5,1 5,6 6,2 7,2 6,0 4,5 5,7 6,1 7,8 6,0 5,1 6,6 8,7 6,8 6,8 5,3 5,8 5,7 7,2 6,0 B8 hsa-mir-191-4,0-3,9-3,9-4,1-4,0-4,3-4,0-4,1-4,3-4,2-4,8-3,7-3,8-4,4-4,2-4,9-4,4-4,1-3,9-4,3 B9 control 0,1-0,1 0,1 0,0 0,0-0,4-0,2 0,0 0,2-0,1-0,3 0,0-0,3-0,7-0,4-0,4-0,7-0,5-1,1-0,7 B10 hsa-mir-193-3,3-3,5-2,8-3,1-3,2-3,5-3,6-1,8-1,8-2,6-3,7-3,8-1,5-1,8-2,7-3,4-4,0-2,1-1,9-2,9 B11 hsa-mir-194-0,4-0,4-0,1-0,3-0,3-1,0-0,9-0,4 0,0-0,6-0,5-0,6 0,0-0,3-0,4-0,8-1,1-1,2-1,0-1,0 B12 hsa-mir-195-3,9-3,6-4,4-4,4-4,1-3,8-3,9-3,8-4,1-3,9-3,9-3,7-4,1-4,7-4,1-4,9-4,8-5,1-5,0-5,0 C1 hsa-mir-197 1,3 0,4 1,3 0,9 1,0 0,0 0,0 0,7 0,1 0,2-0,1-0,2 0,0 0,8 0,1-0,9-1,6-1,6-1,7-1,4 C2 hsa-mir ,3 7,7 6,7 7,0 7,9 7,6 9,7 5,4 6,0 7,1 6,8 9,1 6,6 7,1 7,4 5,8 7,4 5,8 4,6 5,9 C3 hsa-mir-199a -1,1-2,5-1,7-2,1-1,8-1,9-2,0-0,8-1,7-1,6-1,3-1,4-0,7-0,8-1,1-0,1-0,9-0,4-0,6-0,5 C4 hsa-mir-199a* -3,5-3,7-5,0-5,2-4,4-4,0-4,1-4,3-4,5-4,2-3,8-4,0-4,7-4,7-4,3-3,9-4,2-4,8-4,9-4,4 C5 hsa-mir-199b 0,7 0,4 0,9 0,8 0,7 0,4 0,5 1,2 1,0 0,8 1,3 1,6 1,8 1,5 1,5 2,1 1,4 1,9 2,5 2,0 C6 hsa-mir-199-s -2,8-2,1-1,8-2,1-2,2-3,1-2,0-1,9-2,0-2,2-2,7-1,5-1,2-1,5-1,7-1,8-1,3-1,6-1,7-1,6 C7 hsa-mir-200a 4,5 4,1 4,6 4,9 4,5 3,9 3,9 4,9 3,9 4,2 4,1 3,9 5,0 4,4 3,3 2,4 3,5 3,3 3,1 C8 hsa-mir-200b 5,9 5,6 5,3 5,2 5,5 5,9 6,5 5,1 6,1 5,9 5,9 5,1 5,1 4,5 5,2 3,2 3,8 5,1 4,1 4,1 C9 hsa-mir-200c 5,3 4,8 4,8 4,4 4,8 4,4 5,0 3,2 3,8 4,1 4,7 5,0 5,0 4,5 4,8 5,5 4,5 4,2 4,3 4,6 C10 hsa-mir-203 6,0 6,1 6,0 6,2 6,1 6,3 6,0 6,5 7,1 6,5 5,9 5,8 6,2 5,9 6,0 5,0 4,3 5,4 4,6 4,8 C11 hsa-mir-204-1,4 0,5 0,5 0,4 0,0 0,7 0,2-1,3-1,4-0,4 0,9 1,7-0,5-0,5 0,4 1,1 0,8-0,6 2,4 0,9 C12 hsa-mir-205 9,7 12,3 11,7 11,8 11,4 11,4 10,9 11,4 11,9 11,4 10,2 11,9 11,6 11,8 11,4 12,7 10,3 9,1 9,2 10,3 D1 control 8,9 8,8 9,9 8,3 8,9 7,7 8,0 6,9 7,9 7,6 9,1 11,4 7,7 6,1 8,6 7,7 10,4 7,8 5,6 7,9 D2 control 12,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 10,1 11,1 10,3 11,9 11,0 11,8 11,2 10,9 12,2 9,8 11,0 D3 hsa-mir-210-1,8-2,1-1,7-1,9-1,9-5,0-5,1-5,0-5,7-5,2-6,4-6,3-6,8-6,6-6,5-6,8-7,2-7,1-7,3-7,1 D4 hsa-mir-211 7,7 7,2 7,0 7,3 7,3 9,0 7,0 8,1 7,0 7,8 7,3 8,6 7,0 7,7 7,7 8,1 8,2 6,8 5,8 7,2 D5 hsa-mir-213-1,3-1,4-1,2-1,3-1,3-1,2-1,4-1,2-1,2-1,2-0,7-0,8-1,4-1,4-1,1-1,1-1,5-1,2-1,5-1,3 D6 hsa-mir-214-1,9-2,3-2,9-2,8-2,4-2,5-2,2-2,7-2,6-2,5-2,1-2,0-2,7-2,5-2,3-2,5-2,6-3,0-2,9-2,7 D7 hsa-mir-215 2,2 2,0 2,8 2,6 2,4 2,1 2,2 2,9 2,6 2,5 1,7 1,7 1,9 2,2 1,9 2,6 2,3 1,9 2,1 2,2 D8 hsa-mir-216-3,9-4,1-2,6-2,8-3,4-3,8-3,7-2,1-2,1-2,9-3,7-3,5-2,7-2,7-3,1-3,7-4,0-2,6-2,7-3,2 D9 control -1,0-1,4-0,5-0,7-0,9-0,4-0,2 0,0-0,1-0,2-0,3-0,4-0,3-0,2-0,3-0,1-0,5 0,0-0,5-0,3 D10 hsa-mir-218-1,0-1,4-2,8-3,2-2,1-1,3-1,3-2,4-2,6-1,9-0,8-0,8-2,0-2,1-1,4-0,8-1,4-1,6-1,8-1,4 D11 hsa-mir-219 3,7 3,7 4,4 4,5 4,1 4,1 3,9 3,7 3,8 3,9 4,0 4,3 4,1 4,1 4,1 3,9 3,8 4,6 3,8 4,0 D12 hsa-mir ,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,9 11,6 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 11,1 11,7 E1 hsa-mir-221-6,8-7,6-8,3-8,7-7,8-7,4-7,2-7,9-8,4-7,7-7,0-6,7-7,9-8,0-7,4-6,6-6,6-7,9-7,6-7,2 E2 hsa-mir-222-6,7-7,3-7,4-7,9-7,3-6,8-6,9-7,4-7,8-7,2-6,9-7,0-7,7-7,6-7,3-7,2-7,4-8,1-7,9-7,6 E3 hsa-mir-223 7,7 6,7 7,5 8,2 7,5 7,2 8,1 6,6 5,8 6,9 6,6 6,3 5,8 6,0 6,2 7,5 7,8 8,8 7,4 7,9 E4 hsa-mir-224-2,2-2,4-3,1-3,2-2,7-2,2-2,2-2,7-3,0-2,5-2,2-2,3-2,8-2,8-2,5-2,1-2,5-2,6-2,5-2,4 E5 hsa-mir-296 2,7 3,0 4,7 3,9 3,6 2,3 2,6 3,4 2,9 2,8 2,9 2,9 3,1 3,0 3,0 2,0 2,3 2,9 2,5 2,4 E6 hsa-mir-299-0,3-0,4-0,2-0,2-0,3-1,0-0,4 0,8-0,5-0,3-0,6-1,2-0,1-0,1-0,5-0,8-1,2-0,8-0,2-0,7 E7 hsa-mir-301-3,5-3,7-4,1-3,8-3,8-3,6-3,9-3,4-3,7-3,7-3,6-3,9-3,7-3,9-3,9-4,0-4,0 E8 hsa-mir-302a 9,0 12,3 8,4 11,8 10,4 11,4 11,5 11,6 6,8 10,3 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 10,4 11,5 E9 hsa-mir-302b 12,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,1 11,4 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 11,1 11,7 E10 hsa-mir-302b* 12,3 12,3 12,2 11,8 12,2 11,4 11,5 8,7 6,8 9,6 11,9 11,9 11,2 6,0 10,2 12,7 12,2 5,2 7,3 9,3 E11 hsa-mir-302c 12,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,9 11,6 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 11,0 11,7 E12 hsa-mir-302c* 12,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,9 11,6 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 11,1 11,7 F1 hsa-mir-302d 12,6 12,3 12,2 11,8 12,2 11,4 11,5 7,0 10,1 10,0 11,9 11,9 11,6 9,9 11,3 12,7 12,2 8,5 8,0 10,4 F2 hsa-mir-320-2,4-3,2-5,0-5,2-3,9-3,3-3,3-4,7-4,9-4,0-3,3-3,1-4,4-4,1-3,7-3,6-3,7-5,0-5,1-4,3 F3 control -7,3-7,5-7,2-7,3-7,3-6,5-6,6-7,9-7,8-7,2-5,0-5,3-6,5-6,4-5,8-4,7-5,0-5,1-4,8-4,9 F4 hsa-mir-323-0,2 0,0-0,3-0,4-0,2 0,0 0,0-1,3-1,3-0,7 0,1 0,2-0,6-0,6-0,2-0,3 0,0-0,6-0,5-0,4 F5 control -2,1-1,8-2,4-2,9-2,3-1,7-1,5-1,9-2,4-1,9-2,6-2,1-1,7-1,9-2,1-2,3-2,3-1,9-2,2 F6 hsa-mir-324-5p -3,0-3,3-3,7-3,9-3,5-3,0-3,2-3,9-4,0-3,5-3,1-3,1-3,4-3,7-3,3-3,0-3,4-3,6-3,7-3,4 F7 hsa-mir-325 8,2 8,6 10,3 10,3 9,3 8,2 9,4 4,7 3,5 6,5 10,0 11,9 6,5 5,3 8,4 8,0 10,2 4,3 4,3 6,7 F8 hsa-mir-326 1,7 1,0 2,0 2,1 1,7 1,4 1,4 1,8 1,3 1,5 1,6 1,7 1,7 1,6 1,7 0,8 0,7 1,9 1,2 1,1 F9 hsa-mir-328 4,8 4,6 4,2 3,9 4,4 4,2 3,6 2,8 2,4 3,2 3,0 2,7 1,5 1,5 2,2 1,1 0,8 0,3 0,2 0,6 F10 hsa-mir-330 2,6 2,9 3,3 3,1 3,0 2,6 3,0 3,6 2,9 3,0 3,0 3,2 3,0 2,9 3,0 2,4 2,7 2,8 2,3 2,6 F11 hsa-mir-331-3,3-3,1-2,2-2,6-2,8-3,0-2,8-2,8-2,7-2,8-3,4-3,4-2,1-2,8-2,9-3,1-3,6-2,7-2,9-3,1 F12 hsa-mir-335-0,5-0,5-1,1-1,3-0,9-1,1 0,3-1,2-0,9-0,7-0,7-0,3-0,3-0,7-0,5-1,1-0,4-0,3-0,6-0,6 G1 hsa-mir-337 3,9 4,9 4,2 4,0 4,3 3,0 4,3 3,9 4,0 3,8 3,5 4,6 4,9 4,5 4,3 3,7 4,8 4,3 4,8 4,4 G2 hsa-mir-338 3,6 3,5 4,4 4,1 3,9 3,7 3,9 5,0 5,0 4,4 3,3 3,5 4,7 5,1 4,1 3,4 3,3 4,3 4,4 3,8 G3 hsa-mir-339-2,4-2,4-1,1-1,3-1,8-2,6-2,8-1,5-1,5-2,1-2,8-2,9-1,2-1,2-2,0-2,3-2,9-1,9-1,6-2,2 G4 hsa-mir-340 0,8 0,5 0,2 0,0 0,4 0,9 0,8 0,6 0,0 0,6 1,1 1,1 0,6 0,4 0,8 1,0 0,5 0,2 0,5 0,5 G5 hsa-mir-342-2,4-2,5-2,5-2,7-2,5-2,6-2,7-2,5-3,0-2,7-2,7-2,4-2,6-2,7-2,6-3,7-3,3-2,7-2,9-3,2 G6 control -3,4-3,6-2,7-2,9-3,2-3,4-3,6-2,7-2,6-3,1-3,5-2,9-3,0-3,3-3,2-3,8-4,1-3,2-3,2-3,6 G7 control 12,4 12,3 12,2 11,8 12,2 11,4 11,5 11,6 10,4 11,2 11,9 11,9 11,6 11,8 11,8 12,7 12,2 10,9 9,4 11,3 G8 hsa-mir ,7 12,3 12,2 11,8 11,8 11,4 11,5 11,6 9,3 11,0 11,9 11,9 11,6 8,3 10,9 10,4 12,2 10,9 7,5 10,2 G9 hsa-mir-368 1,0 1,1 2,3 1,2 1,4 0,8 1,0 1,5 1,3 1,1 1,6 1,6 1,2 1,2 1,4 1,9 1,7 1,8 1,4 1,7 G10 control -1,3-0,7-0,6-0,9-0,9-0,7-0,6-0,4-0,8-0,6-0,4-0,3-0,2-0,4-0,3 0,3 0,0-0,1-0,7-0,1 G11 hsa-mir-370 0,3 0,5-1,7-2,0-0,7 0,5 0,6-2,1-2,1-0,8 0,1 0,0-1,6-1,9-0,9 0,1-0,1-1,3-1,9-0,8 G12 hsa-mir ,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,9 11,6 11,9 11,9 11,3 11,8 11,7 12,7 12,2 6,8 7,2 9,7 H1 hsa-mir ,5 12,3 12,2 11,8 11,9 11,4 10,5 11,6 11,9 11,3 11,9 11,9 11,6 8,3 10,9 10,0 10,7 10,9 10,0 10,4 H2 hsa-mir-373 7,8 9,3 7,8 7,1 8,0 8,7 7,2 6,6 5,9 7,1 8,1 8,9 6,8 5,4 7,3 7,3 7,3 4,3 4,4 5,9 H3 hsa-mir-373* 11,1 12,3 12,2 11,8 11,9 11,4 11,5 9,2 9,4 10,4 11,9 11,9 8,8 10,2 10,7 12,7 12,2 9,5 11,5 H4 hsa-mir-374-3,8-4,0-3,9-4,1-4,0-3,6-3,4-3,3-3,4-3,4-3,2-2,9-3,6-3,4-3,3-3,2-3,4-3,8-3,1-3,4 H5 hsa-let-7a -7,0-7,4-7,9-8,1-7,6-7,2-7,0-6,3-6,9-6,8-7,3-7,2-6,4-6,2-6,8-6,9-7,2-6,7-6,4-6,8 H6 hsa-let-7b -1,7-2,4-6,5-6,8-4,3-2,8-2,9-5,7-6,2-4,4-3,6-3,3-5,6-5,8-4,6-3,8-3,7-5,7-5,7-4,7 H7 hsa-let-7d -6,5-7,3-7,7-8,2-7,4-6,8-6,0-6,3-6,7-6,5-7,6-6,5-5,7-6,2-6,5-7,4-6,7-6,1-6,2-6,6 H8 hsa-let-7e -1,4-1,2-2,6-3,0-2,0-1,2-1,1-1,8-2,1-1,6-1,9-1,9-1,9-2,1-2,0-2,0-2,1-1,9-1,7-1,9 H9 cel-mir-2 12,6 12,3 12,2 11,8 12,2 11,4 11,5 11,6 11,2 11,4 11,9 11,9 11,6 11,8 11,8 12,4 12,2 10,9 9,5 11,3 H10 hsa-let-7g -5,3-5,3-6,0-6,4-5,7-5,6-5,4-5,3-5,8-5,5-5,6-5,4-5,3-5,1-5,4-5,8-5,9-6,0-5,7-5,9 H11 has-let-7i -5,6-5,8-6,5-6,7-6,2-5,7-5,5-5,3-5,7-5,5-5,3-5,1-5,1-5,2-5,2-5,7-5,9-5,4-5,5-5,6 H12 hsa-mir-16-7,5-7,4-8,1-8,5-7,9-7,7-7,6-7,7-8,1-7,8-7,6-7,2-8,2-7,9-7,7-7,4-7,7-7,9-8,0-7,8

13 PLATE 2: Ct ( Ct sample - media Ct normoxia) normoxia hypoxia 8 hrs hypoxia 24 hrs hypoxia 48 hrs WELL DETECTOR A B C D ave A B C D ave A B C D ave A B C D ave A1 hsa-let-7a 1,3 1,5-1,2-1,6 0,0 0,0 0,2 0,1 0,1 0,1 0,0 0,4 0,4-0,2 0,1 0,2-0,1 0,4 0,2 0,2 A2 hsa-mir-16 0,2 0,4-0,1-0,6 0,0 0,5 0,5 0,1 0,2 0,3 0,8 0,4 0,1 0,4 0,4 0,6 0,1 0,1 0,0 0,2 A3 control 1,1 0,9-2,3 0,3 0,0-0,8-2,4 0,1-1,7-1,2-1,0-1,4-0,1 0,3-0,5-2,0-2,6-0,6-0,4-1,4 A4 hsa-mir-154 0,1-0,3 0,0 0,2 0,0-0,1-0,3 0,5-0,1 0,0-0,2-0,2 0,5 0,4 0,1-0,5-0,1 0,4 0,1 0,0 A5 hsa-mir-154* -0,2-0,2 0,4 0,0 0,0-0,4 0,1 0,2-0,1 0,0 1,1 1,3 1,4 1,1 1,2 1,2 1,4 2,3 2,0 1,7 A6 hsa-mir-155 0,7 0,6-0,5-0,8 0,0 0,7 0,6 0,1-0,1 0,3 0,1 0,1 0,3 0,2 0,2-0,6-0,7-0,2 0,0-0,4 A7 hsa-mir-181a 0,2 0,0-0,1-0,1 0,0-0,8-0,3-0,3-0,6-0,5-0,4-0,2-0,7-0,8-0,5-1,3-1,6-1,2-1,7-1,4 A8 hsa-mir-181b 0,5 0,5-0,4-0,6 0,0 0,6 0,3 0,1-0,5 0,1 0,0 0,5-0,4-0,6-0,1-0,3-0,5-0,4-0,6-0,5 A9 hsa-mir-181c -0,5 0,1 0,2 0,2 0,0-0,3 0,2 0,3 0,2 0,1 0,0 0,2-0,3-0,2-0,1-1,3-1,0-0,4-1,2-1,0 A10 hsa-mir-182-0,7 0,3 0,9-0,5 0,0-1,0 0,5 3,1 1,8 1,1-0,4 0,4 1,8 1,4 0,8-1,3-0,2 0,0-0,6-0,5 A11 hsa-mir-182* -0,4 1,4-1,8 0,8 0,0 0,4-0,1 0,5-3,0-0,5 0,9-0,1 0,4 0,8 0,5-0,7 1,0-2,4-3,7-1,5 A12 hsa-mir-183 1,4-1,0 0,2-0,6 0,0 0,2 0,4 0,5-1,9-0,2-0,1 0,4-1,3 0,6-0,1-0,4-1,4-0,3-2,6-1,2 B1 hsa-mir-184 0,0-0,4 0,4-0,1 0,0-1,5-3,5-4,6-4,6-3,6 0,1 0,1-0,2-3,6-0,9-1,9 0,4-0,9-0,7-0,8 B2 hsa-mir-185 0,4 0,2-0,4-0,2 0,0 0,2 0,1 0,6 0,7 0,4 0,5 0,6 0,7 0,7 0,6 0,5 0,4 0,6 0,7 0,5 B3 hsa-mir-186 0,9 0,4-0,6-0,6 0,0 0,1 0,2-0,4-0,7-0,2 0,4 0,5-0,4-0,6 0,0 0,6 0,4-0,7-0,5-0,1 B4 hsa-mir-187 0,4-0,4 0,1-0,2 0,0 0,4-0,2-0,3-0,2-0,1 0,8 0,1 1,4-0,4 0,5-0,5-0,1 0,3-1,1-0,3 B5 control 0,0-0,1 0,2-0,1 0,0 0,0 0,2 1,0 1,0 0,6 0,2 0,8 1,6 1,5 1,0 1,5 1,6 1,8 1,8 1,7 B6 hsa-mir-189-1,2-1,2 1,1 1,2 0,0-0,4-0,5 2,0 1,1 0,6-0,2-0,5 2,8 1,7 1,0-0,2-0,4 1,4 3,1 1,0 B7 hsa-mir-190-0,9-0,4 0,2 1,2 0,0-1,5-0,3 0,1 1,8 0,0-0,9 0,6 2,7 0,8 0,8-0,7-0,2-0,3 1,2 0,0 B8 hsa-mir-191-0,1 0,1 0,1-0,1 0,0-0,4 0,0-0,2-0,3-0,2-0,9 0,3 0,2-0,4-0,2-1,0-0,5-0,1 0,0-0,4 B9 control 0,1-0,1 0,1 0,0 0,0-0,4-0,2-0,1 0,2-0,1-0,4-0,1-0,3-0,8-0,4-0,4-0,7-0,5-1,2-0,7 B10 hsa-mir-193-0,1-0,3 0,4 0,1 0,0-0,2-0,4 1,4 1,4 0,6-0,5-0,6 1,7 1,4 0,5-0,2-0,8 1,1 1,3 0,3 B11 hsa-mir-194-0,1-0,1 0,2 0,0 0,0-0,7-0,6-0,1 0,2-0,3-0,2-0,3 0,2-0,1-0,1-0,5-0,8-0,9-0,7-0,7 B12 hsa-mir-195 0,1 0,5-0,3-0,3 0,0 0,2 0,2 0,3 0,0 0,2 0,2 0,4 0,0-0,6 0,0-0,8-0,8-1,1-0,9-0,9 C1 hsa-mir-197 0,3-0,6 0,3-0,1 0,0-1,0-1,0-0,3-0,9-0,8-1,1-1,2-1,0-0,2-0,9-1,9-2,6-2,6-2,7-2,4 C2 hsa-mir-198 2,4-0,2-1,2-0,9 0,0-0,4 1,8-2,5-1,9-0,8-1,1 1,2-1,3-0,9-0,5-2,1-0,5-2,1-3,3-2,0 C3 hsa-mir-199a 0,7-0,6 0,1-0,2 0,0-0,1-0,1 1,0 0,1 0,2 0,5 0,5 1,1 1,0 0,8 1,8 0,9 1,5 1,2 1,3 C4 hsa-mir-199a* 0,8 0,6-0,7-0,8 0,0 0,3 0,2 0,0-0,1 0,1 0,5 0,4-0,4-0,3 0,1 0,5 0,2-0,5-0,5-0,1 C5 hsa-mir-199b 0,0-0,3 0,2 0,1 0,0-0,3-0,2 0,5 0,3 0,1 0,6 0,9 1,1 0,8 0,8 1,4 0,7 1,2 1,8 1,3 C6 hsa-mir-199-s -0,6 0,1 0,4 0,1 0,0-0,9 0,2 0,3 0,2 0,0-0,5 0,7 1,0 0,7 0,5 0,4 0,9 0,6 0,5 0,6 C7 hsa-mir-200a 0,0-0,4 0,0 0,4 0,0-0,6-0,6 0,4-0,6-0,3-0,4-0,6 0,5-0,2-1,2-2,1-1,0-1,2-1,4 C8 hsa-mir-200b 0,4 0,1-0,2-0,3 0,0 0,3 1,0-0,4 0,5 0,4 0,4-0,4-0,4-1,0-0,3-2,3-1,7-0,5-1,4-1,5 C9 hsa-mir-200c 0,4 0,0 0,0-0,4 0,0-0,4 0,2-1,7-1,1-0,8-0,2 0,1 0,2-0,4-0,1 0,7-0,3-0,6-0,6-0,2 C10 hsa-mir-203-0,1 0,0-0,1 0,2 0,0 0,2 0,0 0,4 1,0 0,4-0,2-0,2 0,1-0,2-0,1-1,1-1,7-0,7-1,5-1,2 C11 hsa-mir-204-1,4 0,5 0,5 0,4 0,0 0,7 0,1-1,3-1,4-0,4 0,9 1,7-0,6-0,5 0,4 1,1 0,8-0,6 2,4 0,9 C12 hsa-mir-205-1,7 1,0 0,3 0,4 0,0 0,0-0,4 0,0 0,5 0,0-1,2 0,5 0,3 0,4 0,0 1,3-1,1-2,2-2,2-1,0 D1 control 0,0-0,2 0,9-0,7 0,0-1,2-0,9-2,0-1,1-1,3 0,2 2,4-1,2-2,8-0,4-1,3 1,4-1,1-3,3-1,1 D2 control 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-2,1-1,1-1,9-0,4-1,2-0,4-1,0-1,3 0,0-2,4-1,2 D3 hsa-mir-210 0,1-0,2 0,2 0,0 0,0-3,1-3,2-3,2-3,8-3,3-4,5-4,5-5,0-4,7-4,7-4,9-5,4-5,2-5,5-5,3 D4 hsa-mir-211 0,4-0,2-0,3 0,0 0,0 1,7-0,3 0,8-0,3 0,5 0,0 1,3-0,3 0,3 0,3 0,7 0,9-0,5-1,5-0,1 D5 hsa-mir-213 0,0-0,2 0,1 0,0 0,0 0,1-0,1 0,1 0,1 0,1 0,5 0,5-0,1-0,1 0,2 0,2-0,2 0,1-0,2 0,0 D6 hsa-mir-214 0,6 0,2-0,4-0,3 0,0 0,0 0,2-0,2-0,2-0,1 0,4 0,4-0,2-0,1 0,1 0,0-0,1-0,6-0,4-0,3 D7 hsa-mir-215-0,2-0,4 0,4 0,2 0,0-0,3-0,2 0,5 0,2 0,0-0,7-0,7-0,5-0,2-0,5 0,2-0,1-0,5-0,3-0,2 D8 hsa-mir-216-0,6-0,7 0,7 0,5 0,0-0,4-0,3 1,3 1,3 0,5-0,3-0,2 0,7 0,7 0,2-0,3-0,6 0,8 0,6 0,1 D9 control -0,1-0,5 0,4 0,2 0,0 0,5 0,7 0,9 0,8 0,7 0,6 0,5 0,7 0,7 0,6 0,8 0,4 0,9 0,4 0,6 D10 hsa-mir-218 1,1 0,7-0,7-1,1 0,0 0,8 0,8-0,3-0,5 0,2 1,3 1,3 0,1 0,1 0,7 1,3 0,7 0,5 0,3 0,7 D11 hsa-mir-219-0,4-0,4 0,3 0,4 0,0 0,0-0,2-0,4-0,3-0,2-0,1 0,2 0,0 0,0 0,0-0,2-0,3 0,5-0,3-0,1 D12 hsa-mir-220 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-0,3-0,6-0,3-0,4-0,6-0,4-0,4 0,5 0,0-1,3-1,1-0,5 E1 hsa-mir-221 1,0 0,3-0,4-0,9 0,0 0,4 0,7-0,1-0,6 0,1 0,9 1,2 0,0-0,1 0,5 1,3 1,2 0,0 0,2 0,7 E2 hsa-mir-222 0,6 0,0-0,1-0,6 0,0 0,5 0,4-0,1-0,5 0,1 0,4 0,3-0,4-0,3 0,0 0,1-0,1-0,8-0,6-0,3 E3 hsa-mir-223 0,1-0,8 0,0 0,7 0,0-0,4 0,6-0,9-1,8-0,6-0,9-1,2-1,7-1,6-1,4 0,0 0,3 1,2-0,1 0,3 E4 hsa-mir-224 0,5 0,3-0,4-0,5 0,0 0,5 0,5 0,0-0,2 0,2 0,5 0,5-0,1-0,1 0,2 0,6 0,2 0,2 0,2 0,3 E5 hsa-mir-296-0,9-0,6 1,1 0,3 0,0-1,3-1,0-0,2-0,7-0,8-0,6-0,7-0,5-0,6-0,6-1,5-1,3-0,6-1,1-1,1 E6 hsa-mir-299-0,1-0,1 0,0 0,1 0,0-0,7-0,2 1,1-0,2 0,0-0,4-0,9 0,1 0,2-0,2-0,5-0,9-0,5 0,1-0,4 E7 hsa-mir-301 0,3 0,0-0,3 0,0 0,0 0,2-0,2 0,4 0,1 0,1 0,1-0,1 0,0-0,1-0,2-0,3-0,2 E8 hsa-mir-302a -1,3 2,0-2,0 1,4 0,0 1,0 1,2 1,2-3,6-0,1 1,5 1,5 1,2 1,4 1,4 2,3 1,8 0,5 0,0 1,2 E9 hsa-mir-302b 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-1,1-0,8-0,3-0,4-0,6-0,4-0,4 0,5 0,0-1,3-1,1-0,5 E10 hsa-mir-302b* 0,2 0,2 0,1-0,4 0,0-0,8-0,6-3,5-5,4-2,6-0,3-0,3-1,0-6,2-1,9 0,5 0,1-7,0-4,9-2,8 E11 hsa-mir-302c 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-0,3-0,6-0,3-0,4-0,6-0,4-0,4 0,5 0,0-1,3-1,3-0,5 E12 hsa-mir-302c* 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-0,3-0,6-0,3-0,4-0,6-0,4-0,4 0,5 0,0-1,3-1,1-0,5 F1 hsa-mir-302d 0,3 0,1 0,0-0,5 0,0-0,8-0,7-5,2-2,1-2,2-0,3-0,4-0,6-2,3-0,9 0,5 0,0-3,7-4,2-1,9 F2 hsa-mir-320 1,6 0,8-1,0-1,3 0,0 0,7 0,7-0,8-1,0-0,1 0,7 0,8-0,5-0,2 0,2 0,4 0,2-1,1-1,2-0,4 F3 control 0,1-0,2 0,1 0,0 0,0 0,8 0,7-0,6-0,5 0,1 2,3 2,0 0,8 0,9 1,5 2,6 2,3 2,2 2,5 2,4 F4 hsa-mir-323 0,0 0,2-0,1-0,2 0,0 0,2 0,2-1,1-1,1-0,5 0,3 0,4-0,4-0,4 0,0-0,1 0,2-0,4-0,3-0,1 F5 control 0,2 0,5-0,1-0,6 0,0 0,6 0,8 0,4-0,1 0,4-0,3 0,3 0,6 0,4 0,2 0,0 0,0 0,4 0,1 F6 hsa-mir-324-5p 0,5 0,2-0,2-0,5 0,0 0,5 0,3-0,4-0,5 0,0 0,4 0,4 0,0-0,2 0,1 0,5 0,0-0,1-0,2 0,0 F7 hsa-mir-325-1,2-0,7 0,9 1,0 0,0-1,1 0,1-4,7-5,8-2,9 0,7 2,5-2,9-4,0-0,9-1,3 0,9-5,0-5,1-2,6 F8 hsa-mir-326 0,0-0,7 0,3 0,4 0,0-0,3-0,3 0,1-0,4-0,2-0,1 0,0 0,0-0,1 0,0-0,9-1,0 0,2-0,5-0,6 F9 hsa-mir-328 0,5 0,2-0,1-0,5 0,0-0,2-0,8-1,6-1,9-1,1-1,4-1,7-2,9-2,9-2,2-3,3-3,6-4,1-4,2-3,8 F10 hsa-mir-330-0,4 0,0 0,3 0,1 0,0-0,4 0,1 0,6-0,1 0,0 0,1 0,2 0,1-0,1 0,1-0,6-0,2-0,1-0,6-0,4 F11 hsa-mir-331-0,6-0,3 0,6 0,2 0,0-0,2-0,1 0,0 0,1 0,0-0,6-0,6 0,7 0,0-0,1-0,3-0,8 0,1-0,1-0,3 F12 hsa-mir-335 0,4 0,3-0,3-0,4 0,0-0,2 1,2-0,4 0,0 0,2 0,1 0,6 0,6 0,2 0,4-0,2 0,4 0,5 0,3 0,2 G1 hsa-mir-337-0,3 0,7 0,0-0,3 0,0-1,3 0,0-0,3-0,2-0,5-0,8 0,3 0,6 0,2 0,1-0,6 0,5 0,0 0,5 0,1 G2 hsa-mir-338-0,3-0,4 0,5 0,2 0,0-0,2 0,0 1,1 1,1 0,5-0,6-0,4 0,8 1,2 0,2-0,5-0,7 0,4 0,5-0,1 G3 hsa-mir-339-0,6-0,6 0,7 0,5 0,0-0,8-1,0 0,3 0,3-0,3-1,0-1,1 0,6 0,6-0,2-0,5-1,1-0,1 0,2-0,4 G4 hsa-mir-340 0,4 0,1-0,2-0,4 0,0 0,5 0,4 0,2-0,3 0,2 0,7 0,7 0,2 0,0 0,4 0,6 0,1-0,2 0,1 0,2 G5 hsa-mir-342 0,2 0,0 0,1-0,2 0,0 0,0-0,2 0,0-0,5-0,2-0,2 0,1 0,0-0,2-0,1-1,2-0,8-0,2-0,4-0,6 G6 control -0,3-0,4 0,5 0,2 0,0-0,2-0,5 0,5 0,5 0,1-0,4 0,3 0,2-0,2 0,0-0,6-0,9-0,1-0,1-0,4 G7 control 0,2 0,2 0,1-0,4 0,0-0,8-0,6-0,6-1,8-1,0-0,3-0,3-0,6-0,4-0,4 0,5 0,0-1,3-2,8-0,9 G8 hsa-mir-367-1,0 0,6 0,5 0,0 0,0-0,4-0,2-0,2-2,4-0,8 0,1 0,1-0,1-3,5-0,9-1,4 0,5-0,9-4,2-1,5 G9 hsa-mir-368-0,4-0,3 0,9-0,2 0,0-0,6-0,4 0,1-0,1-0,2 0,2 0,2-0,2-0,2 0,0 0,5 0,4 0,4 0,0 0,3 G10 control -0,5 0,2 0,3 0,0 0,0 0,1 0,3 0,5 0,1 0,2 0,4 0,6 0,7 0,5 0,5 1,1 0,8 0,8 0,2 0,7 G11 hsa-mir-370 1,0 1,3-1,0-1,3 0,0 1,2 1,3-1,3-1,4 0,0 0,8 0,7-0,9-1,2-0,1 0,8 0,6-0,5-1,2-0,1 G12 hsa-mir-371 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-0,3-0,6-0,3-0,4-0,9-0,4-0,5 0,5 0,0-5,4-5,0-2,5 H1 hsa-mir-372-0,5 0,4 0,3-0,2 0,0-0,6-1,4-0,3-0,1-0,6-0,1-0,1-0,3-3,6-1,0-2,0-1,2-1,1-1,9-1,6 H2 hsa-mir-373-0,2 1,3-0,2-0,9 0,0 0,7-0,8-1,4-2,1-0,9 0,1 0,9-1,2-2,6-0,7-0,7-0,7-3,7-3,6-2,1 H3 hsa-mir-373* -0,8 0,5 0,4-0,1 0,0-0,5-0,3-2,7-2,5-1,5 0,0 0,0-3,1-1,7-1,2 0,8 0,4-2,3-0,4 H4 hsa-mir-374 0,2-0,1 0,0-0,1 0,0 0,3 0,6 0,7 0,6 0,5 0,8 1,0 0,4 0,6 0,7 0,8 0,6 0,2 0,9 0,6 H5 hsa-let-7a 0,6 0,2-0,3-0,6 0,0 0,4 0,6 1,3 0,7 0,8 0,3 0,4 1,2 1,4 0,8 0,7 0,4 0,9 1,2 0,8 H6 hsa-let-7b 2,7 1,9-2,1-2,5 0,0 1,5 1,4-1,4-1,9-0,1 0,7 1,1-1,3-1,5-0,2 0,5 0,6-1,4-1,3-0,4 H7 hsa-let-7d 0,9 0,1-0,2-0,7 0,0 0,6 1,4 1,2 0,7 0,9-0,1 0,9 1,7 1,2 0,9 0,1 0,7 1,3 1,2 0,8 H8 hsa-let-7e 0,7 0,8-0,5-1,0 0,0 0,8 0,9 0,2 0,0 0,5 0,1 0,2 0,1 0,0 0,1 0,1 0,0 0,1 0,3 0,1 H9 cel-mir-2 0,3 0,1 0,0-0,5 0,0-0,8-0,7-0,6-1,0-0,8-0,3-0,4-0,6-0,4-0,4 0,2 0,0-1,3-2,7-1,0 H10 hsa-let-7g 0,5 0,5-0,2-0,7 0,0 0,2 0,3 0,4-0,1 0,2 0,2 0,4 0,4 0,6 0,4-0,1-0,1-0,3 0,0-0,1 H11 has-let-7i 0,5 0,3-0,3-0,6 0,0 0,5 0,7 0,9 0,5 0,6 0,9 1,1 1,0 1,0 1,0 0,5 0,3 0,8 0,7 0,6 H12 hsa-mir-16 0,4 0,5-0,3-0,6 0,0 0,2 0,2 0,1-0,2 0,1 0,3 0,7-0,3 0,0 0,1 0,4 0,2-0,1-0,1 0,1

14 Table S2

15 Table S3 Gene name mir-210 Gene symbol # of algorithms expression ephrin-a3 EFNA3 4 ubiquitous glycerol-3-phosphate dehydrogenase 1-like GPD1L 4 ubiquitous neuronal pentraxin 1 NPTX1 4 neuronal huntingtin interacting protein B transcript variant 1 SETD2 3 ubiquitous chondroadherin CHAD 3 chondrocytes mir-150 # of Gene name Gene symbol expression algorithms v-myb myeloblastosis viral oncogene homolog (avian) MYB 3 ubiquitous ELK1, member of ETS oncogene family ELK1 3 ubiquitous GDP dissociation inhibitor 1 GDI1 3 ubiquitous transmembrane protein 24 TMEM24 3 ubiquitous (not vascular)

16 Figure S1 A B C

17 Figure S2 A B C

18 Figure S3 A B C

19 Figure S4 A B

20 Figure S5 A B C D E

21 Figure S6

22 Figure S7 A B C D

23 Figure S8 A B C

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:

Διαβάστε περισσότερα

HOMEWORK 4 = G. In order to plot the stress versus the stretch we define a normalized stretch:

HOMEWORK 4 = G. In order to plot the stress versus the stretch we define a normalized stretch: HOMEWORK 4 Problem a For the fast loading case, we want to derive the relationship between P zz and λ z. We know that the nominal stress is expressed as: P zz = ψ λ z where λ z = λ λ z. Therefore, applying

Διαβάστε περισσότερα

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines... III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση

Διαβάστε περισσότερα

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =

Διαβάστε περισσότερα

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΟΛΟΚΛΗΡΩΜΕΝΗ ΑΝΑΠΤΥΞΗ & ΔΙΑΧΕΙΡΙΣΗ ΤΟΥ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ» ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Οικονομετρική διερεύνηση

Διαβάστε περισσότερα

EE512: Error Control Coding

EE512: Error Control Coding EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3

Διαβάστε περισσότερα

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός

Διαβάστε περισσότερα

2 Composition. Invertible Mappings

2 Composition. Invertible Mappings Arkansas Tech University MATH 4033: Elementary Modern Algebra Dr. Marcel B. Finan Composition. Invertible Mappings In this section we discuss two procedures for creating new mappings from old ones, namely,

Διαβάστε περισσότερα

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ»

«ΑΓΡΟΤΟΥΡΙΣΜΟΣ ΚΑΙ ΤΟΠΙΚΗ ΑΝΑΠΤΥΞΗ: Ο ΡΟΛΟΣ ΤΩΝ ΝΕΩΝ ΤΕΧΝΟΛΟΓΙΩΝ ΣΤΗΝ ΠΡΟΩΘΗΣΗ ΤΩΝ ΓΥΝΑΙΚΕΙΩΝ ΣΥΝΕΤΑΙΡΙΣΜΩΝ» I ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΝΟΜΙΚΩΝ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΠΟΛΙΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΟΙΚΟΝΟΜΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΗΝ «ΔΙΟΙΚΗΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΑ» ΚΑΤΕΥΘΥΝΣΗ: ΟΙΚΟΝΟΜΙΚΗ

Διαβάστε περισσότερα

svari Real-time RT-PCR RSV

svari Real-time RT-PCR RSV 19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV

Διαβάστε περισσότερα

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement J. Jpn. Soc. Soil Phys. No. 33, p.//0-,**/ ******* * Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement Masami OHTSUBO*, Hidekazu ISHIDA**, Hisakatsu

Διαβάστε περισσότερα

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007

ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 19/5/2007 Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Αν κάπου κάνετε κάποιες υποθέσεις να αναφερθούν στη σχετική ερώτηση. Όλα τα αρχεία που αναφέρονται στα προβλήματα βρίσκονται στον ίδιο φάκελο με το εκτελέσιμο

Διαβάστε περισσότερα

Daewoo Technopark A-403, Dodang-dong, Wonmi-gu, Bucheon-city, Gyeonggido, Korea LM-80 Test Report

Daewoo Technopark A-403, Dodang-dong, Wonmi-gu, Bucheon-city, Gyeonggido, Korea LM-80 Test Report LM-80 Test Report Approved Method: Measuring Lumen Maintenance of LED Light Sources Project Number: KILT1212-U00216 Date: September 17 th, 2013 Requested by: Dongbu LED Co., Ltd 90-1, Bongmyeong-Ri, Namsa-Myeon,

Διαβάστε περισσότερα

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines 1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,

Διαβάστε περισσότερα

[1] P Q. Fig. 3.1

[1] P Q. Fig. 3.1 1 (a) Define resistance....... [1] (b) The smallest conductor within a computer processing chip can be represented as a rectangular block that is one atom high, four atoms wide and twenty atoms long. One

Διαβάστε περισσότερα

Phys460.nb Solution for the t-dependent Schrodinger s equation How did we find the solution? (not required)

Phys460.nb Solution for the t-dependent Schrodinger s equation How did we find the solution? (not required) Phys460.nb 81 ψ n (t) is still the (same) eigenstate of H But for tdependent H. The answer is NO. 5.5.5. Solution for the tdependent Schrodinger s equation If we assume that at time t 0, the electron starts

Διαβάστε περισσότερα

Section 8.3 Trigonometric Equations

Section 8.3 Trigonometric Equations 99 Section 8. Trigonometric Equations Objective 1: Solve Equations Involving One Trigonometric Function. In this section and the next, we will exple how to solving equations involving trigonometric functions.

Διαβάστε περισσότερα

Math 6 SL Probability Distributions Practice Test Mark Scheme

Math 6 SL Probability Distributions Practice Test Mark Scheme Math 6 SL Probability Distributions Practice Test Mark Scheme. (a) Note: Award A for vertical line to right of mean, A for shading to right of their vertical line. AA N (b) evidence of recognizing symmetry

Διαβάστε περισσότερα

Assalamu `alaikum wr. wb.

Assalamu `alaikum wr. wb. LUMP SUM Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. Assalamu `alaikum wr. wb. LUMP SUM Wassalamu alaikum wr. wb. LUMP SUM Lump sum lump sum lump sum. lump sum fixed price lump sum lump

Διαβάστε περισσότερα

4.6 Autoregressive Moving Average Model ARMA(1,1)

4.6 Autoregressive Moving Average Model ARMA(1,1) 84 CHAPTER 4. STATIONARY TS MODELS 4.6 Autoregressive Moving Average Model ARMA(,) This section is an introduction to a wide class of models ARMA(p,q) which we will consider in more detail later in this

Διαβάστε περισσότερα

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΗΛΕΚΤΡΟΜΑΓΝΗΤΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΗΛΕΚΤΡΟΟΠΤΙΚΗΣ & ΗΛΕΚΤΡΟΝΙΚΩΝ ΥΛΙΚΩΝ Μελέτη Επίδρασης Υπεριώδους Ακτινοβολίας σε Λεπτά

Διαβάστε περισσότερα

Aluminum Electrolytic Capacitors (Large Can Type)

Aluminum Electrolytic Capacitors (Large Can Type) Aluminum Electrolytic Capacitors (Large Can Type) Snap-In, 85 C TS-U ECE-S (U) Series: TS-U Features General purpose Wide CV value range (33 ~ 47,000 µf/16 4V) Various case sizes Top vent construction

Διαβάστε περισσότερα

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα

Διαβάστε περισσότερα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.

Διαβάστε περισσότερα

Identification of Fish Species using DNA Method

Identification of Fish Species using DNA Method 5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,

Διαβάστε περισσότερα

Αξιολόγηση των Φασματικού Διαχωρισμού στην Διάκριση Διαφορετικών Τύπων Εδάφους ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Σπίγγος Γεώργιος

Αξιολόγηση των Φασματικού Διαχωρισμού στην Διάκριση Διαφορετικών Τύπων Εδάφους ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. Σπίγγος Γεώργιος ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΤΜΗΜΑ ΑΓΡΟΝΟΜΩΝ ΤΟΠΟΓΡΑΦΩΝ ΜΗΧΑΝΙΚΩΝ ΤΟΜΕΑΣ ΤΟΠΟΓΡΑΦΙΑΣ-ΕΡΓΑΣΤΗΡΙΟ ΤΗΛΕΠΙΣΚΟΠΗΣΗΣ Αξιολόγηση των Φασματικού Διαχωρισμού στην Διάκριση Διαφορετικών Τύπων Εδάφους ΔΙΠΛΩΜΑΤΙΚΗ

Διαβάστε περισσότερα

Electronic Supplementary Information (ESI)

Electronic Supplementary Information (ESI) Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Cyclopentadienyl iron dicarbonyl (CpFe(CO) 2 ) derivatives

Διαβάστε περισσότερα

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,

Διαβάστε περισσότερα

Capacitors - Capacitance, Charge and Potential Difference

Capacitors - Capacitance, Charge and Potential Difference Capacitors - Capacitance, Charge and Potential Difference Capacitors store electric charge. This ability to store electric charge is known as capacitance. A simple capacitor consists of 2 parallel metal

Διαβάστε περισσότερα

Aluminum Electrolytic Capacitors

Aluminum Electrolytic Capacitors Aluminum Electrolytic Capacitors Snap-In, Mini., 105 C, High Ripple APS TS-NH ECE-S (G) Series: TS-NH Features Long life: 105 C 2,000 hours; high ripple current handling ability Wide CV value range (47

Διαβάστε περισσότερα

Διερεύνηση και αξιολόγηση μεθόδων ομογενοποίησης υδροκλιματικών δεδομένων ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Διερεύνηση και αξιολόγηση μεθόδων ομογενοποίησης υδροκλιματικών δεδομένων ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΕΘΝΙΚΟ ΜΕΤΣΟΒΕΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ Τομέας Υδατικών Πόρων και Περιβάλλοντος Εύα- Στυλιανή Στείρου Διερεύνηση και αξιολόγηση μεθόδων ομογενοποίησης υδροκλιματικών δεδομένων ΔΙΠΛΩΜΑΤΙΚΗ

Διαβάστε περισσότερα

Correction Table for an Alcoholometer Calibrated at 20 o C

Correction Table for an Alcoholometer Calibrated at 20 o C An alcoholometer is a device that measures the concentration of ethanol in a water-ethanol mixture (often in units of %abv percent alcohol by volume). The depth to which an alcoholometer sinks in a water-ethanol

Διαβάστε περισσότερα

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE

Διαβάστε περισσότερα

NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS

NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS INTERDICIPLINARY POSTGRADUATE PROGRAMME "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"

Διαβάστε περισσότερα

Διερεύνηση ακουστικών ιδιοτήτων Νεκρομαντείου Αχέροντα

Διερεύνηση ακουστικών ιδιοτήτων Νεκρομαντείου Αχέροντα Διερεύνηση ακουστικών ιδιοτήτων Νεκρομαντείου Αχέροντα Βασίλειος Α. Ζαφρανάς Παναγιώτης Σ. Καραμπατζάκης ΠΕΡΙΛΗΨΗ H εργασία αφορά μία σειρά μετρήσεων του χρόνου αντήχησης της υπόγειας κρύπτης του «Νεκρομαντείου»

Διαβάστε περισσότερα

Reminders: linear functions

Reminders: linear functions Reminders: linear functions Let U and V be vector spaces over the same field F. Definition A function f : U V is linear if for every u 1, u 2 U, f (u 1 + u 2 ) = f (u 1 ) + f (u 2 ), and for every u U

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ ΕΙΣΑΓΩΓΗ ΣΤΗ ΣΤΑΤΙΣΤΙΚΗ ΑΝΑΛΥΣΗ ΕΛΕΝΑ ΦΛΟΚΑ Επίκουρος Καθηγήτρια Τµήµα Φυσικής, Τοµέας Φυσικής Περιβάλλοντος- Μετεωρολογίας ΓΕΝΙΚΟΙ ΟΡΙΣΜΟΙ Πληθυσµός Σύνολο ατόµων ή αντικειµένων στα οποία αναφέρονται

Διαβάστε περισσότερα

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil 354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate

Διαβάστε περισσότερα

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate

Διαβάστε περισσότερα

w o = R 1 p. (1) R = p =. = 1

w o = R 1 p. (1) R = p =. = 1 Πανεπιστήµιο Κρήτης - Τµήµα Επιστήµης Υπολογιστών ΗΥ-570: Στατιστική Επεξεργασία Σήµατος 205 ιδάσκων : Α. Μουχτάρης Τριτη Σειρά Ασκήσεων Λύσεις Ασκηση 3. 5.2 (a) From the Wiener-Hopf equation we have:

Διαβάστε περισσότερα

DESIGN OF MACHINERY SOLUTION MANUAL h in h 4 0.

DESIGN OF MACHINERY SOLUTION MANUAL h in h 4 0. DESIGN OF MACHINERY SOLUTION MANUAL -7-1! PROBLEM -7 Statement: Design a double-dwell cam to move a follower from to 25 6, dwell for 12, fall 25 and dwell for the remader The total cycle must take 4 sec

Διαβάστε περισσότερα

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ

Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΚΑΒΑΛΑΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΚΩΝ ΕΦΑΡΜΟΓΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΑΙΘΑΝΟΛΗΣ,ΤΗΣ ΜΕΘΑΝΟΛΗΣ ΚΑΙ ΤΟΥ ΑΙΘΥΛΟΤΡΙΤΟΤΑΓΗ ΒΟΥΤΥΛΑΙΘΕΡΑ ΣΤΙΣ ΙΔΙΟΤΗΤΕΣ ΤΗΣ ΒΕΝΖΙΝΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ

Διαβάστε περισσότερα

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13, in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro

Διαβάστε περισσότερα

The challenges of non-stable predicates

The challenges of non-stable predicates The challenges of non-stable predicates Consider a non-stable predicate Φ encoding, say, a safety property. We want to determine whether Φ holds for our program. The challenges of non-stable predicates

Διαβάστε περισσότερα

MSM Men who have Sex with Men HIV -

MSM Men who have Sex with Men HIV - ,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men

Διαβάστε περισσότερα

Supplementary Table 1. Construct List with key Biophysical Properties of the expression

Supplementary Table 1. Construct List with key Biophysical Properties of the expression SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease

Διαβάστε περισσότερα

C.S. 430 Assignment 6, Sample Solutions

C.S. 430 Assignment 6, Sample Solutions C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order

Διαβάστε περισσότερα

Second Order RLC Filters

Second Order RLC Filters ECEN 60 Circuits/Electronics Spring 007-0-07 P. Mathys Second Order RLC Filters RLC Lowpass Filter A passive RLC lowpass filter (LPF) circuit is shown in the following schematic. R L C v O (t) Using phasor

Διαβάστε περισσότερα

«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).»

«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).» ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΤΟΜΕΑΣ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΛΕΝΗ Π. ΠΑΠΑΤΣΑΡΟΥΧΑ Πτυχιούχος Τεχνολόγος Τροφίμων της Γεωπονικής Σχολής (Α.Π.Θ.) «Συντήρηση αχλαδιών σε

Διαβάστε περισσότερα

Nowhere-zero flows Let be a digraph, Abelian group. A Γ-circulation in is a mapping : such that, where, and : tail in X, head in

Nowhere-zero flows Let be a digraph, Abelian group. A Γ-circulation in is a mapping : such that, where, and : tail in X, head in Nowhere-zero flows Let be a digraph, Abelian group. A Γ-circulation in is a mapping : such that, where, and : tail in X, head in : tail in X, head in A nowhere-zero Γ-flow is a Γ-circulation such that

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1

ΠΕΡΙΕΧΟΜΕΝΑ. Μάρκετινγκ Αθλητικών Τουριστικών Προορισμών 1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΔΙΟΙΚΗΣΗΣ ΤΜΗΜΑ ΔΙΟΙΚΗΣΗΣ ΕΠΙΧΕΙΡΗΣΕΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Σχεδιασμός, Διοίκηση και Πολιτική του Τουρισμού» ΜΑΡΚΕΤΙΝΓΚ ΑΘΛΗΤΙΚΩΝ ΤΟΥΡΙΣΤΙΚΩΝ

Διαβάστε περισσότερα

6.1. Dirac Equation. Hamiltonian. Dirac Eq.

6.1. Dirac Equation. Hamiltonian. Dirac Eq. 6.1. Dirac Equation Ref: M.Kaku, Quantum Field Theory, Oxford Univ Press (1993) η μν = η μν = diag(1, -1, -1, -1) p 0 = p 0 p = p i = -p i p μ p μ = p 0 p 0 + p i p i = E c 2 - p 2 = (m c) 2 H = c p 2

Διαβάστε περισσότερα

Strain gauge and rosettes

Strain gauge and rosettes Strain gauge and rosettes Introduction A strain gauge is a device which is used to measure strain (deformation) on an object subjected to forces. Strain can be measured using various types of devices classified

Διαβάστε περισσότερα

ANSWERSHEET (TOPIC = DIFFERENTIAL CALCULUS) COLLECTION #2. h 0 h h 0 h h 0 ( ) g k = g 0 + g 1 + g g 2009 =?

ANSWERSHEET (TOPIC = DIFFERENTIAL CALCULUS) COLLECTION #2. h 0 h h 0 h h 0 ( ) g k = g 0 + g 1 + g g 2009 =? Teko Classes IITJEE/AIEEE Maths by SUHAAG SIR, Bhopal, Ph (0755) 3 00 000 www.tekoclasses.com ANSWERSHEET (TOPIC DIFFERENTIAL CALCULUS) COLLECTION # Question Type A.Single Correct Type Q. (A) Sol least

Διαβάστε περισσότερα

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.

Διαβάστε περισσότερα

1) Formulation of the Problem as a Linear Programming Model

1) Formulation of the Problem as a Linear Programming Model 1) Formulation of the Problem as a Linear Programming Model Let xi = the amount of money invested in each of the potential investments in, where (i=1,2, ) x1 = the amount of money invested in Savings Account

Διαβάστε περισσότερα

Problem Set 9 Solutions. θ + 1. θ 2 + cotθ ( ) sinθ e iφ is an eigenfunction of the ˆ L 2 operator. / θ 2. φ 2. sin 2 θ φ 2. ( ) = e iφ. = e iφ cosθ.

Problem Set 9 Solutions. θ + 1. θ 2 + cotθ ( ) sinθ e iφ is an eigenfunction of the ˆ L 2 operator. / θ 2. φ 2. sin 2 θ φ 2. ( ) = e iφ. = e iφ cosθ. Chemistry 362 Dr Jean M Standard Problem Set 9 Solutions The ˆ L 2 operator is defined as Verify that the angular wavefunction Y θ,φ) Also verify that the eigenvalue is given by 2! 2 & L ˆ 2! 2 2 θ 2 +

Διαβάστε περισσότερα

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION

Διαβάστε περισσότερα

Potential Dividers. 46 minutes. 46 marks. Page 1 of 11

Potential Dividers. 46 minutes. 46 marks. Page 1 of 11 Potential Dividers 46 minutes 46 marks Page 1 of 11 Q1. In the circuit shown in the figure below, the battery, of negligible internal resistance, has an emf of 30 V. The pd across the lamp is 6.0 V and

Διαβάστε περισσότερα

Jesse Maassen and Mark Lundstrom Purdue University November 25, 2013

Jesse Maassen and Mark Lundstrom Purdue University November 25, 2013 Notes on Average Scattering imes and Hall Factors Jesse Maassen and Mar Lundstrom Purdue University November 5, 13 I. Introduction 1 II. Solution of the BE 1 III. Exercises: Woring out average scattering

Διαβάστε περισσότερα

Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B) ΣΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΤΟΜΑΤΑΣ

Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B) ΣΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΤΟΜΑΤΑΣ ΑΛΕΞΑΝΔΡΕΙΟ Τ.Ε.Ι. ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΔΙΑΤΡΟΦΗΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΑΝΑΤΟΜΙΑΣ ΚΑΙ ΦΥΣΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B)

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ

Διαβάστε περισσότερα

CHAPTER 101 FOURIER SERIES FOR PERIODIC FUNCTIONS OF PERIOD

CHAPTER 101 FOURIER SERIES FOR PERIODIC FUNCTIONS OF PERIOD CHAPTER FOURIER SERIES FOR PERIODIC FUNCTIONS OF PERIOD EXERCISE 36 Page 66. Determine the Fourier series for the periodic function: f(x), when x +, when x which is periodic outside this rge of period.

Διαβάστε περισσότερα

ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΓΝΩΣΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΧΡΙ ΚΑΙ 10 ΧΡΟΝΩΝ

ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΓΝΩΣΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΧΡΙ ΚΑΙ 10 ΧΡΟΝΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΜΗΤΡΙΚΟΣ ΘΗΛΑΣΜΟΣ ΚΑΙ ΓΝΩΣΤΙΚΗ ΑΝΑΠΤΥΞΗ ΜΕΧΡΙ ΚΑΙ 10 ΧΡΟΝΩΝ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Ονοματεπώνυμο Κεντούλλα Πέτρου Αριθμός Φοιτητικής Ταυτότητας 2008761539 Κύπρος

Διαβάστε περισσότερα

Simon et al. Supplemental Data Page 1

Simon et al. Supplemental Data Page 1 Simon et al. Supplemental Data Page 1 Supplemental Data Acute hemodynamic effects of inhaled sodium nitrite in pulmonary hypertension associated with heart failure with preserved ejection fraction Short

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΣΥΓΚΡΑΤΗΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΟΡΙΣΜΕΝΩΝ ΠΡΟΚΑΤΑΣΚΕΥΑΣΜΕΝΩΝ ΣΥΝΔΕΣΜΩΝ ΑΚΡΙΒΕΙΑΣ

Διαβάστε περισσότερα

the total number of electrons passing through the lamp.

the total number of electrons passing through the lamp. 1. A 12 V 36 W lamp is lit to normal brightness using a 12 V car battery of negligible internal resistance. The lamp is switched on for one hour (3600 s). For the time of 1 hour, calculate (i) the energy

Διαβάστε περισσότερα

Homework 3 Solutions

Homework 3 Solutions Homework 3 Solutions Igor Yanovsky (Math 151A TA) Problem 1: Compute the absolute error and relative error in approximations of p by p. (Use calculator!) a) p π, p 22/7; b) p π, p 3.141. Solution: For

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΤΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΣΥΝΤΑΓΟΓΡΑΦΗΣΗΣ ΚΑΙ Η ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΣΤΗΝ ΕΛΛΑΔΑ: Ο.Α.Ε.Ε. ΠΕΡΙΦΕΡΕΙΑ ΠΕΛΟΠΟΝΝΗΣΟΥ ΚΑΣΚΑΦΕΤΟΥ ΣΩΤΗΡΙΑ

ΜΕΛΕΤΗ ΤΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΣΥΝΤΑΓΟΓΡΑΦΗΣΗΣ ΚΑΙ Η ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΣΤΗΝ ΕΛΛΑΔΑ: Ο.Α.Ε.Ε. ΠΕΡΙΦΕΡΕΙΑ ΠΕΛΟΠΟΝΝΗΣΟΥ ΚΑΣΚΑΦΕΤΟΥ ΣΩΤΗΡΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΕΙΡΑΙΩΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΔΙΟΙΚΗΣΗ ΤΗΣ ΥΓΕΙΑΣ ΤΕΙ ΠΕΙΡΑΙΑ ΜΕΛΕΤΗ ΤΗΣ ΗΛΕΚΤΡΟΝΙΚΗΣ ΣΥΝΤΑΓΟΓΡΑΦΗΣΗΣ ΚΑΙ Η ΔΙΕΡΕΥΝΗΣΗ ΤΗΣ ΕΦΑΡΜΟΓΗΣ ΤΗΣ ΣΤΗΝ ΕΛΛΑΔΑ: Ο.Α.Ε.Ε. ΠΕΡΙΦΕΡΕΙΑ ΠΕΛΟΠΟΝΝΗΣΟΥ

Διαβάστε περισσότερα

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array 7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS

Διαβάστε περισσότερα

Μελέτη οξείας τοξικότητας σε καρκινοειδή οργανισμούς, χρόνιας τοξικότητας σε φυτά και οιστρογονικότητας της λουπανίνης

Μελέτη οξείας τοξικότητας σε καρκινοειδή οργανισμούς, χρόνιας τοξικότητας σε φυτά και οιστρογονικότητας της λουπανίνης Σχολή Γεωτεχνικών Επιστημών και Διαχείρισης Περιβάλλοντος Πτυχιακή εργασία Μελέτη οξείας τοξικότητας σε καρκινοειδή οργανισμούς, χρόνιας τοξικότητας σε φυτά και οιστρογονικότητας της λουπανίνης Ειρήνη

Διαβάστε περισσότερα

Approximation of distance between locations on earth given by latitude and longitude

Approximation of distance between locations on earth given by latitude and longitude Approximation of distance between locations on earth given by latitude and longitude Jan Behrens 2012-12-31 In this paper we shall provide a method to approximate distances between two points on earth

Διαβάστε περισσότερα

Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ

Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ Μειέηε, θαηαζθεπή θαη πξνζνκνίσζε ηεο ιεηηνπξγίαο κηθξήο αλεκνγελλήηξηαο αμνληθήο ξνήο ΓΗΠΛΩΜΑΣΗΚΖ ΔΡΓΑΗΑ Κνηζακπφπνπινο Υ. Παλαγηψηεο Δπηβιέπσλ: Νηθφιανο Υαηδεαξγπξίνπ Καζεγεηήο Δ.Μ.Π Αζήλα, Μάξηηνο 2010

Διαβάστε περισσότερα

ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ

ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ Γηπισκαηηθή Δξγαζία ηνπ Φνηηεηή ηνπ ηκήκαηνο Ζιεθηξνιόγσλ Μεραληθώλ θαη Σερλνινγίαο Ζιεθηξνληθώλ

Διαβάστε περισσότερα

Calculating the propagation delay of coaxial cable

Calculating the propagation delay of coaxial cable Your source for quality GNSS Networking Solutions and Design Services! Page 1 of 5 Calculating the propagation delay of coaxial cable The delay of a cable or velocity factor is determined by the dielectric

Διαβάστε περισσότερα

Practice Exam 2. Conceptual Questions. 1. State a Basic identity and then verify it. (a) Identity: Solution: One identity is csc(θ) = 1

Practice Exam 2. Conceptual Questions. 1. State a Basic identity and then verify it. (a) Identity: Solution: One identity is csc(θ) = 1 Conceptual Questions. State a Basic identity and then verify it. a) Identity: Solution: One identity is cscθ) = sinθ) Practice Exam b) Verification: Solution: Given the point of intersection x, y) of the

Διαβάστε περισσότερα

TABLE OF CONTENTS Page

TABLE OF CONTENTS Page TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...

Διαβάστε περισσότερα

NMBTC.COM /

NMBTC.COM / Common Common Vibration Test:... Conforms to JIS C 60068-2-6, Amplitude: 1.5mm, Frequency 10 to 55 Hz, 1 hour in each of the X, Y and Z directions. Shock Test:...Conforms to JIS C 60068-2-27, Acceleration

Διαβάστε περισσότερα

Srednicki Chapter 55

Srednicki Chapter 55 Srednicki Chapter 55 QFT Problems & Solutions A. George August 3, 03 Srednicki 55.. Use equations 55.3-55.0 and A i, A j ] = Π i, Π j ] = 0 (at equal times) to verify equations 55.-55.3. This is our third

Διαβάστε περισσότερα

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.

Διαβάστε περισσότερα

Other Test Constructions: Likelihood Ratio & Bayes Tests

Other Test Constructions: Likelihood Ratio & Bayes Tests Other Test Constructions: Likelihood Ratio & Bayes Tests Side-Note: So far we have seen a few approaches for creating tests such as Neyman-Pearson Lemma ( most powerful tests of H 0 : θ = θ 0 vs H 1 :

Διαβάστε περισσότερα

Example Sheet 3 Solutions

Example Sheet 3 Solutions Example Sheet 3 Solutions. i Regular Sturm-Liouville. ii Singular Sturm-Liouville mixed boundary conditions. iii Not Sturm-Liouville ODE is not in Sturm-Liouville form. iv Regular Sturm-Liouville note

Διαβάστε περισσότερα

ΤΕΧΝΙΚΕΣ ΔΙΑΓΝΩΣΗΣ ΤΗΣ ΝΟΣΟΥ ΑΛΤΣΧΑΙΜΕΡ ΜΕ FMRI

ΤΕΧΝΙΚΕΣ ΔΙΑΓΝΩΣΗΣ ΤΗΣ ΝΟΣΟΥ ΑΛΤΣΧΑΙΜΕΡ ΜΕ FMRI ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ ΤΕΧΝΙΚΕΣ ΔΙΑΓΝΩΣΗΣ ΤΗΣ ΝΟΣΟΥ ΑΛΤΣΧΑΙΜΕΡ ΜΕ FMRI ΔΙΠΛΩΜΑΤΙΚΗ

Διαβάστε περισσότερα

Supplementary Materials for. Kinetic and Computational Studies on Pd(I) Dimer- Mediated Halogen Exchange of Aryl Iodides

Supplementary Materials for. Kinetic and Computational Studies on Pd(I) Dimer- Mediated Halogen Exchange of Aryl Iodides Supplementary Materials for Kinetic and Computational Studies on Pd(I) Dimer- Mediated Halogen Exchange of Aryl Iodides Indrek Kalvet, a Karl J. Bonney, a and Franziska Schoenebeck a * a Institute of Organic

Διαβάστε περισσότερα

k A = [k, k]( )[a 1, a 2 ] = [ka 1,ka 2 ] 4For the division of two intervals of confidence in R +

k A = [k, k]( )[a 1, a 2 ] = [ka 1,ka 2 ] 4For the division of two intervals of confidence in R + Chapter 3. Fuzzy Arithmetic 3- Fuzzy arithmetic: ~Addition(+) and subtraction (-): Let A = [a and B = [b, b in R If x [a and y [b, b than x+y [a +b +b Symbolically,we write A(+)B = [a (+)[b, b = [a +b

Διαβάστε περισσότερα

Code Breaker. TEACHER s NOTES

Code Breaker. TEACHER s NOTES TEACHER s NOTES Time: 50 minutes Learning Outcomes: To relate the genetic code to the assembly of proteins To summarize factors that lead to different types of mutations To distinguish among positive,

Διαβάστε περισσότερα

Απόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ.

Απόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ. Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο The time integral of a force is referred to as impulse, is determined by and is obtained from: Newton s 2 nd Law of motion states that the action

Διαβάστε περισσότερα

ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα

ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ. Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή. Αζαλαζηάδνπ Βαξβάξα ΣΔΥΝΟΛΟΓΙΚΟ ΔΚΠΑΙΓΔΤΣΙΚΟ ΙΓΡΤΜΑ ΘΔΑΛΟΝΙΚΗ ΥΟΛΗ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ & ΓΙΑΣΡΟΦΗ ΣΜΗΜΑ ΣΔΥΝΟΛΟΓΙΑ ΣΡΟΦΙΜΩΝ ΠΣΤΥΙΑΚΗ ΔΡΓΑΙΑ Μειέηε Υξόλνπ Απνζηείξσζεο Κνλζέξβαο κε Τπνινγηζηηθή Ρεπζηνδπλακηθή Αζαλαζηάδνπ Βαξβάξα

Διαβάστε περισσότερα

ΔΙΑΜΟΡΦΩΣΗ ΣΧΟΛΙΚΩΝ ΧΩΡΩΝ: ΒΑΖΟΥΜΕ ΤΟ ΠΡΑΣΙΝΟ ΣΤΗ ΖΩΗ ΜΑΣ!

ΔΙΑΜΟΡΦΩΣΗ ΣΧΟΛΙΚΩΝ ΧΩΡΩΝ: ΒΑΖΟΥΜΕ ΤΟ ΠΡΑΣΙΝΟ ΣΤΗ ΖΩΗ ΜΑΣ! ΔΙΑΜΟΡΦΩΣΗ ΣΧΟΛΙΚΩΝ ΧΩΡΩΝ: ΒΑΖΟΥΜΕ ΤΟ ΠΡΑΣΙΝΟ ΣΤΗ ΖΩΗ ΜΑΣ! ΘΥΜΑΡΑ Μ. Μ. 11 Ο Γυμνάσιο Πειραιά, Δ/νση Β/Θμιας Εκπ/σης Πειραιά e-mail: margthym@yahoo.gr ΠΕΡΙΛΗΨΗ Το πρόγραμμα της διαμόρφωσης των σχολικών

Διαβάστε περισσότερα

5.4 The Poisson Distribution.

5.4 The Poisson Distribution. The worst thing you can do about a situation is nothing. Sr. O Shea Jackson 5.4 The Poisson Distribution. Description of the Poisson Distribution Discrete probability distribution. The random variable

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ ΚΑΙ ΒΕΛΤΙΩΣΗΣ ΤΩΝ ΦΥΤΩΝ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ ΚΑΙ ΒΕΛΤΙΩΣΗΣ ΤΩΝ ΦΥΤΩΝ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΓΕΩΠΟΝΙΚΗ ΣΧΟΛΗ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΕΤΙΚΗΣ ΚΑΙ ΒΕΛΤΙΩΣΗΣ ΤΩΝ ΦΥΤΩΝ ΜΕΛΕΤΗ ΤΩΝ ΕΜΒΟΛΙΑΣΜΕΝΩΝ ΦΥΤΑΡΙΩΝ ΣΤΗΝ ΠΙΠΕΡΙΑ (Capsicum annuum L.) ΑΘΑΝΑΣΙΑΔΗΣ ΧΡΗΣΤΟΣ ΓΕΩΠΟΝΟΣ ΜΕΤΑΠΤΥΧΙΑΚΗ

Διαβάστε περισσότερα

Supporting Information

Supporting Information Supporting Information rigin of the Regio- and Stereoselectivity of Allylic Substitution of rganocopper Reagents Naohiko Yoshikai, Song-Lin Zhang, and Eiichi Nakamura* Department of Chemistry, The University

Διαβάστε περισσότερα

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Molecular evolutionary dynamics of respiratory syncytial virus group A in Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama

Διαβάστε περισσότερα

Review Test 3. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

Review Test 3. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Review Test MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Find the exact value of the expression. 1) sin - 11π 1 1) + - + - - ) sin 11π 1 ) ( -

Διαβάστε περισσότερα

Nuclear Physics 5. Name: Date: 8 (1)

Nuclear Physics 5. Name: Date: 8 (1) Name: Date: Nuclear Physics 5. A sample of radioactive carbon-4 decays into a stable isotope of nitrogen. As the carbon-4 decays, the rate at which the amount of nitrogen is produced A. decreases linearly

Διαβάστε περισσότερα

ΕΚΤΙΜΗΣΗ ΤΟΥ ΚΟΣΤΟΥΣ ΤΩΝ ΟΔΙΚΩΝ ΑΤΥΧΗΜΑΤΩΝ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΑΡΑΓΟΝΤΩΝ ΕΠΙΡΡΟΗΣ ΤΟΥ

ΕΚΤΙΜΗΣΗ ΤΟΥ ΚΟΣΤΟΥΣ ΤΩΝ ΟΔΙΚΩΝ ΑΤΥΧΗΜΑΤΩΝ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΑΡΑΓΟΝΤΩΝ ΕΠΙΡΡΟΗΣ ΤΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΠΟΛΙΤΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΕΚΤΙΜΗΣΗ ΤΟΥ ΚΟΣΤΟΥΣ ΤΩΝ ΟΔΙΚΩΝ ΑΤΥΧΗΜΑΤΩΝ ΚΑΙ ΔΙΕΡΕΥΝΗΣΗ ΤΩΝ ΠΑΡΑΓΟΝΤΩΝ ΕΠΙΡΡΟΗΣ ΤΟΥ ΔΙΑΤΡΙΒΗ ΔΙΠΛΩΜΑΤΟΣ ΕΙΔΙΚΕΥΣΗΣ ΔΗΜΗΤΡΙΟΥ Ν. ΠΙΤΕΡΟΥ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία ΕΠΙΔΡΑΣΗ ΥΠΕΡΗΧΩΝ ΣΤΗΝ LISTERIA GRAYI ΣΤΟ ΓΑΛΑ: ΕΠΙΒΙΩΣΗ ΚΑΙ ΦΥΣΙΚΟΧΗΜΙΚΕΣ ΕΠΙΔΡΑΣΕΙΣ. Άρτεμις

Διαβάστε περισσότερα