http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology breast cancer resistance protein BCRP ATP p53 p53

Transcript

1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 157 p53 * breast cancer resistance protein BCRP ATP p53 wild type p53wt-p53 MCF-7 wt-p53 -κb nuclear factor-κbnf-κb BCRP p53 Saos-2 wtp53 BCRP p53 wt-p53 BCRP MatInspector BCRP p53 IκB Saos-2 NF-κB Saos-2 NF-κB p53 BCRP p53 Saos-2 BCRP NF-κB p53 -κb R730 Q753 Transcriptional Regulation of Breast Cancer Resistance Protein BCRP by p53 in p53-null Saos-2 cells WU Xin-Gang * PENG Shu-BinL Si-PingZHANG Nian-FengZOU Jin Department of Basic Medical SciencesYueyang Higher Vocational and Technical CollegeYueyang Hunan China Abstract Breast cancer resistance protein BCRP is a member of the ATP-binding cassette ABC transporter superfamily BCRP confers drug resistance in cancer by transporting chemotherapeutic agents such as mitoxantronetopotecanand methotrexate Although a recent study demonstrated that wild type p53 wt-p53 may suppress BCRP expression through the nuclear factor-κb NF-κB pathway in breast cancer cell line MCF-7which expresses wt-p53 at low levelthe detailed molecular mechanisms of transcriptional regulation on BCRP remain unclear Herewe set out to reveal the exogenous p53's role on the expression of BCRP In the human osteosarcoma cell line Saos-2a p53-null cell linetransient transfection assays showed that the BCRP expression was activated by wt-p53 but not p53 mutants p53 R175H and p53 R248W We further co-transfected the p53 expression plasmid with BCRP luciferase promoter reporter construct into the Saos-2 celland the results revealed that wt-p53 may facilitate the BCRP promoter activity Howeverwe did not find any p53 binding site by applying MatInspector StrikinglyNF-κB activity inhibition downplayed the activation effect of BCRP promoter activity by wtp53 These results suggested that transcriptional activation of BCRP by wt-p53 is NF-κB- dependent Key words breast cancer resistance protein BCRP p53 nuclear factor-κb NF-κB No YZ1104G * Tel wu_alwin@ yahoo com cn Received November Accepted December Supported by Yueyang Higher Vocational and Technical College No YZ1104G * Corresponding author Tel wu_alwin@ yahoo com cn

2 2 p multidrug resistancemdr p53 BCRP MDR ATP P P- 1 glycoproteinp-gp multidrug resistance proteinmrp breast 1 1 cancer resistance proteinbcrp Saos-2 ATCC BCRP 1998 Doyle 10% RPMI-1640 Gibco BRL MCF-7 / AdrVp 37 5% CO 2 pc53-sn3 pc pc p53 p53 p53 R175H p53 R248W pbcrp-luc 50% p53 BCRP pbabe / 60% IκBα NF-κB IκBα 70% p53 MCF p53 NF-κB BCRP Primer 3 3 p53 Saos-2 Invitrogen Table 1 Table 1 Primers used to perform reverse transcription PCR Primer Sequence 5' 3' Length of PCR product / bp p53 Forward CCAGCCAAAGAAGAAACCAC 194 Reverse TATGGCGGGAGG TAGACTGA BCRP Forward CACCTTATTGGCCTCAGGAA 206 Reverse CCTGCTTGGAAGGCTCTATG β-actin Forward ACCGTGGAGAAGAGCTACGA 309 Reverse GTACTTGCGCTCAGAAGGAG 1 3 Lipofectamine 2000 Invitrogen 1 d 24 2 μg 10 5 / RNA 90% ~ 95% μl 1 5 RT-PCR 5 μl 5 min 20 RevertAid Fermantas min 4 ~ 6 h RNA 1 5 μg Oligo dt 15 1 μl 48 h 1 4 RNA 70% r / min 5 min DEPC 0 5 μg / μl RNase-free 12 μl 70 5 min 5 min 5 TRIzol Gibco BRL 4 μl 10 mmol / L dntp 2 μl RNA PBS TRIzol 1 μl 20 U 37 5 min MMV 1 5 ml EP 5 min 1 μl 15U min min r / min min RT-PCR 1 μl 10 PCR 15 min Mg μl 2 mmol / L dntp min r / min 20 minμl 1 μl 1μL Taq

3 μl 20 μl PCR 94 5 min 94 1 min 55 1 min72 1 min min 1 5% PBS p53 Saos-2 BCRP r / min 10 min PBS p53 Saos mmol / L NaCl 50 mmol / L Tris-HCl ph % NP-40 1mmol / L PMSF 50 ~ 100 μl 30 min 30 s r / min 30 min Bio-Rad Western 50 μg 5 Fig 1 Effects of exogenous p53 on BCRP 0 35 mol / L Tris-HClpH6 8 36% expression p53-null Saos-2 cells were transfected 0 012% 10 28% SDS 5% with 2μg of p53 expression plasmids or empty vectors β- 5 min 10% SDS pcmv-bam-neo After 48 hoursthe cells were 100 V 2 h V harvested A Total RNA was extracted First-strand 80 min PBST 5% 2 cdna was synthesized with 1 5 μg of total RNA and a BCRP cdna fragment 206 bp was amplified by PCR h p53 Santa Cruz β-actin was used as an internal control B Cell BCRP ALEXIS β- lysates were prepared Proteins were separated by 10% Actin Sigma % SDS-PAGEtransferred onto nitrocelluloseand 1 h PBST HRP immunoblotted with an anti-bcrp monoclonal antibody ZYMED BXP-21and followed by ECL detection β-actin was ZYMED % used as a loading control 1 h PBST SuperSignal Pierce d 10 5 / Saos-2 Fig % ~ 95% p53 BCRP p53 48 h 0 3 μg p53 BCRP 1 PBS 200 μl 0 3 μg p53 BCRP Promega Saos-2 EP r / min 10 min p53 BCRP 20 μl 100 μl 2 3 NF-κB p53 BCRP Promega Lumi-Scint SPSS 14 0 t BCRP mrna p53 BCRP Fig p53 BCRP p53 BCRP IκB-α Bioscan 10 s NF-κB NF-κB 30 s 50 μl 50 μl 2 β- Fig 3 NF-κB 1 33 mg ONPG 200 mmol / L p53 BCRP Na 2 HPO 4 2 mmol / L MgCl mmol / L β- PBS ph nm 630 nm 3 ELx800 Bio-Tek BCRP ABC

4 2 p Fig 2 Effects of exogenous p53 on BCRP promoter activity A Saos-2 cells were transfected with different dose of wild type p53 wt-p53 expression plasmids pc53-sn3 and BCRP luciferase promoter reporter construct The total concentration of DNA was adjusted to 1 μg with empty vector pcmv-bam-neo Luciferase activity was measured after 48 hours of transfection and normalized by β-galactosidase activity Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 B Saos-2 cells were transfected with 0 3μg of wt-p53 or mutant p53 expression plasmids and BCRP luciferase promoter reporter construct Luciferase activity was measured after 48 hours of transfection Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 Fig 3 NF-κB plays an important role in p53- mediated BCRP repression Saos-2 cells were transfected with wt-p53 expression plasmids or empty vector BCRP luciferase promoter reporter construct and different dose of a dominant-negative IκB-α mutant expression plasmid pbabe / IκB Luciferase activity was measured after 48 hours Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector and without pbabe-iκb Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 populationsp SP 1 2 BCRP 4 ~ 6 BCRP estrogen response elementere progesterone response elementpre BCRP BCRP -1 hypoxiainducible factor 1HIF-1 7 / HIF-2 8 BCRP hypoxia response elementhre PTEN / PI3K / AKT 9 MEK-ERK-RSK IL-1βIL-6 TNF-α c-myc 12 k-ras 13 cjun 14 MSX2 15 -β TGF-β BCRP 3 p53 MCF-7 p53 BCRP MDR p53 Saos-2 9- SN38 p53 BCRP p53 Imatinib - p53 R175H - Gefitinib Erlotinib BCRP DNA p53 R248W BCRP BCRP side p53

5 p53 p53 p53 consensus binding sites 2 5' -RRRCWWGYYYN-3' R = G AW = T A Y = C T N = A C T G 0 ~ 13 MatInspector BCRP p53 p53 BCRP Ryan 19 Re-introduction p53 Saos-2 RKO -κb nuclear factor-κbnf-κb Benoit 20 p53 NF-κB -2 cyclooxygenase-2 Cox-2 NF-κB Cox-2 p53 NF-κB J J Pharmacol Exp Ther 3 MCF-7 p53 BCRP NF-κB BCRP p50 BCRP 21 p53 NFκB p53 NF-κB MCF-7 / MX J Inflamm Res Saos-2 p53 BCRP NF-κB IκBα NF-κB NF-κB NF-κB p53 BCRP NF-κB p53 BCRP References 1 Ding XWWu JHJiang CP ABCG2 a potential marker of stem cells and novel target in stem cell and cancer therapy J Life Sci Ishikawa TNakagawa H Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics J J Exp Ther Oncol Wang XWu XWang Cet al Transcriptional suppression of breast cancer resistance protein BCRP by wild-type p53 through the NF-κB pathway in MCF-7 cells J FEBS Lett Yasuda SKobayashi MItagaki Set al Response of the ABCG2 promoter in T47D cells and BeWo cells to sex hormone treatment J Mol Biol Rep Wang HUnadkat JDMao Q Hormonal regulation of BCRP expression in human placental BeWo cells J Pharm Res Wang HZhou LGupta Aet al Regulation of BCRP / ABCG2 expression by progesterone and 17beta- estradiol in human placental BeWo cells J Am J Physiol Endocrinol Metab E Krishnamurthy PRoss D DNakanishi Tet al The stem cell member Bcrp / ABCG2 enhances hypoxic cell survival through interations with hemej J Biol Chem Martin CMFerdous AGallardo Tet al Hypoxia-inducible factor-2alpha transactivates Abcg2 and promotes cytoprotection in cardiac side population cells J Circ Res Hartz AMMadole EKMiller DSet al Estrogen receptor beta signaling through phosphatase and tensin homolog / phosphoinositide 3-kinase / Akt / glycogen synthase kinase 3 downregulates blood-brain barrier breast cancer resistance protein Imai YOhmori KYasuda Set al Breast cancer resistance protein / ABCG2 is differentially regulated downstream of extracellular signal-regulated kinase J Cancer Sci Mosaffa FLage HAfshari JTet al Interleukin-1β and tumor necrosis factor-α increase ABCG2 expression in MCF-7 breast carcinoma cell line and its mitoxantrone-resistant derivative Porro AIraci NSoverini Set al c-myc oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34 + hematopoietic progenitor cells J Mol Cancer Res Meyer SEHasenstein JRBaktula Aet al Kruppel-like factor 5 is not required for K-RasG12D lung tumorigenesisbut represses ABCG2 expression and is associated with better diseasespecific survival J Am J Pathol Bark HXu HDKim SHet al P-glycoprotein down-regulates expression of breast cancer resistance protein in a drug-free state J FEBS Lett Hamada SSatoh KHirota Met al The homeobox gene MSX2 determines chemosensitivity of pancreatic cancer cells via the regulation of transporter gene ABCG2 J J Cell Physiol Ehata SJohansson EKatayama Ret al Transforming growth factor-β decreases the cancer-initiating cell population within diffuse-type gastric carcinoma cells J Oncogene Liu XJing XYJin Set al Insulin suppresses the expression and function of breast cancer resistance protein in primary cultures of rat brain microvessel endothelial cellsj Pharmacol Rep Tan KPWang BYang Met al Aryl hydrocarbon receptor is a transcriptional activator of the human breast cancer resistance protein BCRP / ABCG2 J Mol Pharmacol

6 2 p Ryan KMErnst MKRice NRet al Role of NF-κB in p53- mediated programmed cell death J Nature Benoit Vde Moraes EDar NAet al Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-κbj Oncogene BATF2 / SARI p53 NF-κB J Lu ZhaoZheng Shao-PengNiu Jinget al BATF2 / SARI induces tumor cell apoptosis by inhibiting p53- dependent NF-κB activity J Chin J Biochem Mol Biol Webster GAPerkins ND Transcriptional cross talk between NFκB and p53 J Mol Cell Biol DNA Cell CTCF CTCF CTCF DNA CTCF CTCF CTCF DNA CTCF DNA DNA - Paul Flicek CTCF CTCF CTCF Duncan Odom CTCF CTCF CTCF Science DailyJan