http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology breast cancer resistance protein BCRP ATP p53 p53
|
|
- Πολωνα Παπαδόπουλος
- 7 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 157 p53 * breast cancer resistance protein BCRP ATP p53 wild type p53wt-p53 MCF-7 wt-p53 -κb nuclear factor-κbnf-κb BCRP p53 Saos-2 wtp53 BCRP p53 wt-p53 BCRP MatInspector BCRP p53 IκB Saos-2 NF-κB Saos-2 NF-κB p53 BCRP p53 Saos-2 BCRP NF-κB p53 -κb R730 Q753 Transcriptional Regulation of Breast Cancer Resistance Protein BCRP by p53 in p53-null Saos-2 cells WU Xin-Gang * PENG Shu-BinL Si-PingZHANG Nian-FengZOU Jin Department of Basic Medical SciencesYueyang Higher Vocational and Technical CollegeYueyang Hunan China Abstract Breast cancer resistance protein BCRP is a member of the ATP-binding cassette ABC transporter superfamily BCRP confers drug resistance in cancer by transporting chemotherapeutic agents such as mitoxantronetopotecanand methotrexate Although a recent study demonstrated that wild type p53 wt-p53 may suppress BCRP expression through the nuclear factor-κb NF-κB pathway in breast cancer cell line MCF-7which expresses wt-p53 at low levelthe detailed molecular mechanisms of transcriptional regulation on BCRP remain unclear Herewe set out to reveal the exogenous p53's role on the expression of BCRP In the human osteosarcoma cell line Saos-2a p53-null cell linetransient transfection assays showed that the BCRP expression was activated by wt-p53 but not p53 mutants p53 R175H and p53 R248W We further co-transfected the p53 expression plasmid with BCRP luciferase promoter reporter construct into the Saos-2 celland the results revealed that wt-p53 may facilitate the BCRP promoter activity Howeverwe did not find any p53 binding site by applying MatInspector StrikinglyNF-κB activity inhibition downplayed the activation effect of BCRP promoter activity by wtp53 These results suggested that transcriptional activation of BCRP by wt-p53 is NF-κB- dependent Key words breast cancer resistance protein BCRP p53 nuclear factor-κb NF-κB No YZ1104G * Tel wu_alwin@ yahoo com cn Received November Accepted December Supported by Yueyang Higher Vocational and Technical College No YZ1104G * Corresponding author Tel wu_alwin@ yahoo com cn
2 2 p multidrug resistancemdr p53 BCRP MDR ATP P P- 1 glycoproteinp-gp multidrug resistance proteinmrp breast 1 1 cancer resistance proteinbcrp Saos-2 ATCC BCRP 1998 Doyle 10% RPMI-1640 Gibco BRL MCF-7 / AdrVp 37 5% CO 2 pc53-sn3 pc pc p53 p53 p53 R175H p53 R248W pbcrp-luc 50% p53 BCRP pbabe / 60% IκBα NF-κB IκBα 70% p53 MCF p53 NF-κB BCRP Primer 3 3 p53 Saos-2 Invitrogen Table 1 Table 1 Primers used to perform reverse transcription PCR Primer Sequence 5' 3' Length of PCR product / bp p53 Forward CCAGCCAAAGAAGAAACCAC 194 Reverse TATGGCGGGAGG TAGACTGA BCRP Forward CACCTTATTGGCCTCAGGAA 206 Reverse CCTGCTTGGAAGGCTCTATG β-actin Forward ACCGTGGAGAAGAGCTACGA 309 Reverse GTACTTGCGCTCAGAAGGAG 1 3 Lipofectamine 2000 Invitrogen 1 d 24 2 μg 10 5 / RNA 90% ~ 95% μl 1 5 RT-PCR 5 μl 5 min 20 RevertAid Fermantas min 4 ~ 6 h RNA 1 5 μg Oligo dt 15 1 μl 48 h 1 4 RNA 70% r / min 5 min DEPC 0 5 μg / μl RNase-free 12 μl 70 5 min 5 min 5 TRIzol Gibco BRL 4 μl 10 mmol / L dntp 2 μl RNA PBS TRIzol 1 μl 20 U 37 5 min MMV 1 5 ml EP 5 min 1 μl 15U min min r / min min RT-PCR 1 μl 10 PCR 15 min Mg μl 2 mmol / L dntp min r / min 20 minμl 1 μl 1μL Taq
3 μl 20 μl PCR 94 5 min 94 1 min 55 1 min72 1 min min 1 5% PBS p53 Saos-2 BCRP r / min 10 min PBS p53 Saos mmol / L NaCl 50 mmol / L Tris-HCl ph % NP-40 1mmol / L PMSF 50 ~ 100 μl 30 min 30 s r / min 30 min Bio-Rad Western 50 μg 5 Fig 1 Effects of exogenous p53 on BCRP 0 35 mol / L Tris-HClpH6 8 36% expression p53-null Saos-2 cells were transfected 0 012% 10 28% SDS 5% with 2μg of p53 expression plasmids or empty vectors β- 5 min 10% SDS pcmv-bam-neo After 48 hoursthe cells were 100 V 2 h V harvested A Total RNA was extracted First-strand 80 min PBST 5% 2 cdna was synthesized with 1 5 μg of total RNA and a BCRP cdna fragment 206 bp was amplified by PCR h p53 Santa Cruz β-actin was used as an internal control B Cell BCRP ALEXIS β- lysates were prepared Proteins were separated by 10% Actin Sigma % SDS-PAGEtransferred onto nitrocelluloseand 1 h PBST HRP immunoblotted with an anti-bcrp monoclonal antibody ZYMED BXP-21and followed by ECL detection β-actin was ZYMED % used as a loading control 1 h PBST SuperSignal Pierce d 10 5 / Saos-2 Fig % ~ 95% p53 BCRP p53 48 h 0 3 μg p53 BCRP 1 PBS 200 μl 0 3 μg p53 BCRP Promega Saos-2 EP r / min 10 min p53 BCRP 20 μl 100 μl 2 3 NF-κB p53 BCRP Promega Lumi-Scint SPSS 14 0 t BCRP mrna p53 BCRP Fig p53 BCRP p53 BCRP IκB-α Bioscan 10 s NF-κB NF-κB 30 s 50 μl 50 μl 2 β- Fig 3 NF-κB 1 33 mg ONPG 200 mmol / L p53 BCRP Na 2 HPO 4 2 mmol / L MgCl mmol / L β- PBS ph nm 630 nm 3 ELx800 Bio-Tek BCRP ABC
4 2 p Fig 2 Effects of exogenous p53 on BCRP promoter activity A Saos-2 cells were transfected with different dose of wild type p53 wt-p53 expression plasmids pc53-sn3 and BCRP luciferase promoter reporter construct The total concentration of DNA was adjusted to 1 μg with empty vector pcmv-bam-neo Luciferase activity was measured after 48 hours of transfection and normalized by β-galactosidase activity Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 B Saos-2 cells were transfected with 0 3μg of wt-p53 or mutant p53 expression plasmids and BCRP luciferase promoter reporter construct Luciferase activity was measured after 48 hours of transfection Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 Fig 3 NF-κB plays an important role in p53- mediated BCRP repression Saos-2 cells were transfected with wt-p53 expression plasmids or empty vector BCRP luciferase promoter reporter construct and different dose of a dominant-negative IκB-α mutant expression plasmid pbabe / IκB Luciferase activity was measured after 48 hours Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector and without pbabe-iκb Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 populationsp SP 1 2 BCRP 4 ~ 6 BCRP estrogen response elementere progesterone response elementpre BCRP BCRP -1 hypoxiainducible factor 1HIF-1 7 / HIF-2 8 BCRP hypoxia response elementhre PTEN / PI3K / AKT 9 MEK-ERK-RSK IL-1βIL-6 TNF-α c-myc 12 k-ras 13 cjun 14 MSX2 15 -β TGF-β BCRP 3 p53 MCF-7 p53 BCRP MDR p53 Saos-2 9- SN38 p53 BCRP p53 Imatinib - p53 R175H - Gefitinib Erlotinib BCRP DNA p53 R248W BCRP BCRP side p53
5 p53 p53 p53 consensus binding sites 2 5' -RRRCWWGYYYN-3' R = G AW = T A Y = C T N = A C T G 0 ~ 13 MatInspector BCRP p53 p53 BCRP Ryan 19 Re-introduction p53 Saos-2 RKO -κb nuclear factor-κbnf-κb Benoit 20 p53 NF-κB -2 cyclooxygenase-2 Cox-2 NF-κB Cox-2 p53 NF-κB J J Pharmacol Exp Ther 3 MCF-7 p53 BCRP NF-κB BCRP p50 BCRP 21 p53 NFκB p53 NF-κB MCF-7 / MX J Inflamm Res Saos-2 p53 BCRP NF-κB IκBα NF-κB NF-κB NF-κB p53 BCRP NF-κB p53 BCRP References 1 Ding XWWu JHJiang CP ABCG2 a potential marker of stem cells and novel target in stem cell and cancer therapy J Life Sci Ishikawa TNakagawa H Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics J J Exp Ther Oncol Wang XWu XWang Cet al Transcriptional suppression of breast cancer resistance protein BCRP by wild-type p53 through the NF-κB pathway in MCF-7 cells J FEBS Lett Yasuda SKobayashi MItagaki Set al Response of the ABCG2 promoter in T47D cells and BeWo cells to sex hormone treatment J Mol Biol Rep Wang HUnadkat JDMao Q Hormonal regulation of BCRP expression in human placental BeWo cells J Pharm Res Wang HZhou LGupta Aet al Regulation of BCRP / ABCG2 expression by progesterone and 17beta- estradiol in human placental BeWo cells J Am J Physiol Endocrinol Metab E Krishnamurthy PRoss D DNakanishi Tet al The stem cell member Bcrp / ABCG2 enhances hypoxic cell survival through interations with hemej J Biol Chem Martin CMFerdous AGallardo Tet al Hypoxia-inducible factor-2alpha transactivates Abcg2 and promotes cytoprotection in cardiac side population cells J Circ Res Hartz AMMadole EKMiller DSet al Estrogen receptor beta signaling through phosphatase and tensin homolog / phosphoinositide 3-kinase / Akt / glycogen synthase kinase 3 downregulates blood-brain barrier breast cancer resistance protein Imai YOhmori KYasuda Set al Breast cancer resistance protein / ABCG2 is differentially regulated downstream of extracellular signal-regulated kinase J Cancer Sci Mosaffa FLage HAfshari JTet al Interleukin-1β and tumor necrosis factor-α increase ABCG2 expression in MCF-7 breast carcinoma cell line and its mitoxantrone-resistant derivative Porro AIraci NSoverini Set al c-myc oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34 + hematopoietic progenitor cells J Mol Cancer Res Meyer SEHasenstein JRBaktula Aet al Kruppel-like factor 5 is not required for K-RasG12D lung tumorigenesisbut represses ABCG2 expression and is associated with better diseasespecific survival J Am J Pathol Bark HXu HDKim SHet al P-glycoprotein down-regulates expression of breast cancer resistance protein in a drug-free state J FEBS Lett Hamada SSatoh KHirota Met al The homeobox gene MSX2 determines chemosensitivity of pancreatic cancer cells via the regulation of transporter gene ABCG2 J J Cell Physiol Ehata SJohansson EKatayama Ret al Transforming growth factor-β decreases the cancer-initiating cell population within diffuse-type gastric carcinoma cells J Oncogene Liu XJing XYJin Set al Insulin suppresses the expression and function of breast cancer resistance protein in primary cultures of rat brain microvessel endothelial cellsj Pharmacol Rep Tan KPWang BYang Met al Aryl hydrocarbon receptor is a transcriptional activator of the human breast cancer resistance protein BCRP / ABCG2 J Mol Pharmacol
6 2 p Ryan KMErnst MKRice NRet al Role of NF-κB in p53- mediated programmed cell death J Nature Benoit Vde Moraes EDar NAet al Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-κbj Oncogene BATF2 / SARI p53 NF-κB J Lu ZhaoZheng Shao-PengNiu Jinget al BATF2 / SARI induces tumor cell apoptosis by inhibiting p53- dependent NF-κB activity J Chin J Biochem Mol Biol Webster GAPerkins ND Transcriptional cross talk between NFκB and p53 J Mol Cell Biol DNA Cell CTCF CTCF CTCF DNA CTCF CTCF CTCF DNA CTCF DNA DNA - Paul Flicek CTCF CTCF CTCF Duncan Odom CTCF CTCF CTCF Science DailyJan
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 5 27 5 426 ~ 430 X HBxΔ127 ERK 1 * * 300071 hepatitis B virus HBV X HBx HBx HBxΔ127 1
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1044 ~ 1050 AKT2 * 350025 AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver
Nagoya Med. J., 137 Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver KAZUO IKEDA Department of Anatomy and Cell Biology, Graduate School of Medical Sciences, Nagoya City University
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr
* TGF-β1 215600 diabetic nephropathies DN 24 urine protein quantitation in 24 hours 24hUTP serum creatinine Scr -β1 transforming growth factor-β1 TGFβ1 STZ DN SD 10 10 10 8 24hUTP Scr HE ELISA TGF-β1 24hUTP
[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
NF-κB TSLP. Expression of TSLP and NF-κB in patients with adenomyosis
NF-κB 7 963 doi 10. 3969 /j. issn. 1000-484X. 2014. 07. 021 1 NF- κb 2 3 4 2 030001 R711. 71 A 1000-484X 2014 07-0963-05 NF-κB SABC 35 20 NF-κB p65 ELISA 20 NF-κB p65 P < 0. 01 NF-κB p65 P < 0. 01 NF-κB
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ» ΑΡΝΗΤΙΚΗ ΡΥΘΜΙΣΗ ΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΟΥ ΣΗΜΑΤΟΣ ΤΗΣ
Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ ΡΑΣΗ ΤΟΥ ΓΑΣΤΡΙΚΟΥ ΒΛΕΝΝΟΓΟΝΟΥ ΣΤΗ ΛΟΙΜΩΞΗ ΜΕ ΕΛΙΚΟΒΑΚΤΗΡΙ ΙΟ ΤΟΥ ΠΥΛΩΡΟΥ ΠΡΙΝ ΚΑΙ ΜΕΤΑ ΤΗ ΘΕΡΑΠΕΙΑ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΟΜΕΑΣ ΥΓΕΙΑΣ ΕΡΓΑΣΤΗΡΙΑΚΟΣ ΙΕΥΘΥΝΤΗΣ: Ο ΚΑΘΗΓΗΤΗΣ ΓΕΩΡΓΙΟΣ ΚΑΡΚΑΒΕΛΑΣ ΠΑΝΕΠ. ΕΤΟΣ 2008-2009 Αριθµ. 2084 Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ
Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών
Ιούλιος 2005 Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών ρ. Α. Προµπονά Εργαστήριο Ρύθµισης της Μεταγραφής από το Βιολογικό Ρολόι Κιρκαδικό Ρολόι Ρυθµοί µε περίοδο ~ 24 ωρών
A X All-trans retinoic acid ATRA LS174T
318 2014 30 doi10. 3969 /j. issn. 1000-484X. 2014. 03. 006 1 ERK1 /2 23 2 4 361100 R363 A 1000-484X201403-0318-05 All-trans retinoic acidatra ERK1 /2 MTT ATRA RT-PCR Western blot ATRA LS174T MEK1 /2 /ERK1
Construction and Evaluation of Lentiviral Vector pita-hbp1
ISSN 1007-7626 CN 11-3870 / Q 2010 11 Chinese Journal of Biochemistry and Molecular Biology 26 11 1044 ~ 1049 pita-hbp1 1 2 3 4 4 * 1 100191 2 100086 3 050031 4 100191 1 HBP1 pita-hbp1 Western HBP1 Q78
nasopharyngeal carcinoma NPC 30% 20% CNE-2R CNE-2 Human-6v3. 0 CNE-2R 2 CNE-2R CNE-2 2 Toll
2011 4 31 2 Chin J Radiol Med Prot April 2011 Vol. 31 No. 2 167 CNE-2R CNE-2 CNE-2R Human-6v3. 0 2 CNE-2R CNE-2 2 374 Kegg Biocarta Toll IL-1R 13 JUN MYD88 CCL5 CXCL10 STAT1 LY96 FOS CCL3 IL-6 IL-8 IL-1α
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Aβ42 Alzheimer's disease AD insulin degrading enzyme IDE.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 1 29 1 70 ~ 75 PPARγ IDE TNF-α Aβ42 430030 metformin MET MET β- β-amyloid Aβ Alzheimer's
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Chapter 1. Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes
Chapter 1 Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes 1 1 1 1 CHAPTER SUMMARY FINGOLIMOD ATTENUATES CERAMIDE PRODUCTION
TGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3
adult (Schnurri, Shn)3/Hivep3 Runx2 Shn/Hivep Shn3 Shn3 Shn3 Shn3 Shn1 Shn2 Shn3 gain-of-function loss-of-function Shn3 in vivo mimic MC3T3-E1 ST-2 ATDC5 C3H10T1/2 ALP RT-PCR alcian blue RT-PCR Affymetrix
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
BGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Chinese Journal of Biochemistry and Molecular Biology RNA.
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2009 8 25 (8) :759 763 RNA 1), 2), 1) 3, 1) 1),2), ( 1), 400014 ; 2), 400014) RNA, (CTGF) RNA. EcoR Hind, ptm12 CTGF PCR
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Biapenem BIPM Lot No g mg
MexAB-OprM 1 1 1 1 16 4 9 16 5 11 BIPM imipenemcilastatinipmcs MEPM 3 MexAB-OprM BIPM IPMCS MEPM MexAB-OprM MexCD-OprJ BIPM MEPM IPMCS BIPM IPMCS MEPM 10 5 order CFUlung BIPMIPM CS MEPM 10 6 order CFUlung
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Chinese Journal of Biochemistry and Molecular Biology. p38mapk
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :537 542 Grx1 HEK293T H 2 O 2 p38mapk 1), 2), 1), 1), 3), 1), 1) 3 ( 1), 150081 ; 2), 150081 ; 3), 161042)
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2
588 HepG2 2 2 53002 E-mail huan_chaos@ hotmail. com 2 3602 HepG2 MTT PI HepG2 Western Blot HepG2 Bid Bcl-2 HepG2 HepG2 G0 /G Bid Bcl-2 Bax Bid Bcl-2 Bax HepG2 HepG2 R 735. 7 A 0253-4304 204-588-05 DOI
Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
19 Ενδοκρινολόγος. Φάρµακα που στοχεύουν το β- κύτταρο ΕΥΡΥΔΙΚΗ ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΙΣΑΓΩΓΗ ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ
Φάρµακα που στοχεύουν το β- κύτταρο ΕΥΡΥΔΙΚΗ ΠΑΠΑΔΟΠΟΥΛΟΥ 19 Ενδοκρινολόγος ΕΙΣΑΓΩΓΗ Οι σουλφονυλουρίες είναι η πρώτη κατηγορία υπογλυκαιμικών φαρμάκων που χορηγήθηκαν για την αντιμετώπιση του διαβήτη
2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Supporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine
Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine... 3 1.1 Psychoneuroimmunology (PNI) and Systems Biology...
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου. Ερευνήτρια Β βαθμίδας. B.Sc.
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου Ερευνήτρια Β βαθμίδας 04/17/1962 ΣΠΟΥΔΕΣ-ΤΙΤΛΟΙ Πανεπιστημιακό Ίδρυμα Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης,
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Cdk6 Cdk6
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 10 28 10 958 ~ 965 Cdk6 ES * 100048 6 cyclin-dependent kinase 6 Cdk6 embryonic stem ES
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth
Experimental Research Chin J Curr Adv Gen Surg Survivin sirna 253 1 2 1 3 1 1 1 1 266003 266003 : survivin sirna survivin sirna BXPC- 3 : BXPC- 3 BXPC- 3 4 survivin sirna survivin sirna RT- PCR survivin
Βιταμίνη D και καρκίνος
Βιταμίνη D και καρκίνος Αντώνης Πολυμέρης Ενδοκρινολόγος Επιμελητής Α Β Ενδοκρινολογικό Τμήμα ΓΝΑ «Αλεξάνδρα» Ιστορικό Αυξημένη επίπτωση καρκίνου παχέος εντέρου στον Βορρά σε σχέση με τον Νότο στις ΗΠΑ
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
4T1 BALB /c Western GFP. Establishment of a mouse mammary cancer model stably expressing human HER2 / neu gene and luciferase gene
2012 2 36 2 Mil Med Sci Vol 36 No 2 Feb 2012 133 neu 1 2 2 2 2 2 neu neu 4T1 G418 Western neu 4T1 BALB /c 1. 5 10 6 G418 4T1 Western neu GFP 4T1 neu neu R737. 9 1674-9960 2012 02-0133-05 A Establishment
Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.
Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα
PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Vol. 35 No Journal of South-Central University for Nationalities Nat. Sci. Edition Jun TNFα. . MDSCs
35 2 Vol 35 No 2 2016 6 Journal of South-Central University for Nationalities Nat Sci Edition Jun 2016 ASICs TNF-α 1 1 2 3 4 * 1 430074 2 437100 3 430200 4 437100 ASICs TNFα PCR ph 7 3 ph 5 5 ASICs TNF-α
0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm
22 Journal of Ningxia Medical University 34 1 2012 1 1674-6309 2012 01-0022 - 03 1 2 1 3 1. 750004 2. 750004 3. 750004 60 SD 300 ± 20 g 5 S ICH M 2 M 4 M 8 12 Deinsberger S M 2 4 8 - ICH 10min 2 4 8 mg
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF
2003123 (6) Basic Medical Sciences and Clinics 625 : 100126325 ( 2003) 0620625205 GDNF 3,,,,, (, 050000) : ( GDNF) (DRGn), MTT 1 g/ L 10 g/ L 50 g/ L 100 g/ L GDNF : GDNF GDNF : ; ; :R32912 :A (glial cell
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 5 32 5 578 ~ 586 DOI 10. 13865 /j. cnki. cjbmb. 2016. 05. 14 α- * 030801 α- α-melanocyte-stimulating
SUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα
ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ, ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΔ ΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ & ΔΙΑΙΤΟΛΟΓΙΑΣ ΠΑΡΕΜΒΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΔΙΑΤΡΟΦΙΚΗΣ ΑΓΩΓΗΣ ΣΤΟΝ ΔΗΜΟ ΚΑΒΑΛΑΣ Πτυχιακή
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue. Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) Dopaminergic Markers TH CTG GCC ATT GAT GTA CTG GA ACA CAC ATG GGA
Effect of extract method on pharmacokinetics of baicalin and berberine in dogs
7. J. 54-66. 2009 305 351-353. 12Yu LBridgers APolli Jet al. Vitamin E-TPGS increases ab- 8. sorption flux of an HIV protease inhibitor by enhancing its solubility and permeability J. J Pharm J. 2007234
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
B16F10 SDS-PAGE. Annexin V-FITC /PI
NRP1 B16F10 * 361005 1 neuropilin1 NRP1 NRP1 mab B16F10 SDS-PAGE 1 1 B16F10 1 Annexin V-FITC /PI 1 1 1 B16F10 1 1 B16F10 P < 0. 05 1 B16F10 P < 0. 05 B16F10 Akt ERK1 /2 Bcl-2 Caspase 3 Bax 1 B16F10 1 PI3K
Chinese Journal of Biochemistry and Molecular Biology. psilencer 2. 0-FucT Ⅶ 2
ISSN 1007-7626 CN 11-3870 / Q 2010 3 Chinese Journal of Biochemistry and Molecular Biology 26 3 290 ~ 294 RNA FucT VII HT-29 HUVECs 1 2 1 1 1 * 1 161006 2 150040 RNA RNAi Ⅶ FucT Ⅶ HT-29 HUVEC 3 FucT Ⅶ
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 1 retinoblastoma gene 1 RB1 NMD
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 2 31 2 168 ~ 174 DOI 10 13865 /j cnki cjbmb 2015 02 09 PTC NMD * 030006 mrna nonsense-mediated
Chinese Bulletin of Life Sciences. mtor mtor mtor. mtor signaling pathway and cancer. ZHENG Jie
18 3 2006 6 Chinese Bulletin of Life Sciences Vol. 18, No. 3 Jun., 2006 1004-0374(2006)03-0261-05 mtor 210009 mtor mtor mtor mtor R329.2 + 8; R730.23 A mtor signaling pathway and cancer ZHENG Jie (Institute
coronary heart disease CHD 40% [1] atherosclero- sis AS 52.27±5.3 2~6. / polycyclic aromatic hydrocarbons PAHs
140 1674-6309 2017 02-0140-04 1 2 1 AhR rs2066853-205 190 - AS-PCR AhR rs2066853 AhR rs2066853 χ 2 AhR rs2066853 OR 95%CI AhR rs2066853 AA AG GG χ 2 =6.48 P
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών
Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231
KLT SMMC Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC and the mechanism study
2012 4 20 4 MODERN ONCOLOGY Apr. 2012 VOI. 20 NO. 04 693 SMMC - 7721 珮 Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC - 7721 and the mechanism study YIN Beipei
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ & ΤΕΧΝΟΛΟΓΙΑΣ ΤΡΟΦΙΜΩΝ ΕΡΓΑΣΤΗΡΙΟ ΠΟΙΟΤΙΚΟΥ ΕΛΕΓΧΟΥ & ΥΓΙΕΙΝΗΣ ΤΡΟΦΙΜΩΝ ΚΑΙ ΠΟΤΩΝ Π.Μ.Σ. «ΕΠΙΣΤΗΜΗ & ΤΕΧΝΟΛΟΓΙΑ ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗ ΤΟΥ ΑΝΘΡΩΠΟΥ» Η ΕΠΙΔΡΑΣΗ
w o = R 1 p. (1) R = p =. = 1
Πανεπιστήµιο Κρήτης - Τµήµα Επιστήµης Υπολογιστών ΗΥ-570: Στατιστική Επεξεργασία Σήµατος 205 ιδάσκων : Α. Μουχτάρης Τριτη Σειρά Ασκήσεων Λύσεις Ασκηση 3. 5.2 (a) From the Wiener-Hopf equation we have:
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology ELISA Tnf-α mrna Il-1β mrna TNF-α IL-1β 12 h
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 2 27 2 168 ~ 173-3- TNF-α IL-β * 453002 -α tumor necrosis factor-αtnf-α -1β interleukin-1βil-1β
Conductivity Logging for Thermal Spring Well
/.,**. 25 +,1- **-- 0/2,,,1- **-- 0/2, +,, +/., +0 /,* Conductivity Logging for Thermal Spring Well Koji SATO +, Tadashi TAKAYA,, Tadashi CHIBA, + Nihon Chika Kenkyuusho Co. Ltd., 0/2,, Hongo, Funabashi,
SABiosciences PCR Array Catalog #: PAHS-021 SA+ SCF 4h stimulaton AVG(Ct) Position Unigene Refseq Symbol Description shcontr shcontr-4h shgskβ A01
SABiosciences PCR Array Catalog #: PAHS-021 SA+ SCF 4h stimulaton AVG(Ct) Position Unigene Refseq Symbol Description shcontr shcontr-4h shgskβ A01 Hs.1274 NM_006129 BMP1 Bone morphogenetic protein 1 25.25
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Κόπωση και ποιότητα ζωής ασθενών με καρκίνο Μαργαρίτα Μάου Λευκωσία 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC
ISSN 100727626 CN 1123870ΠQ 2007 2 Chinese Journal of Biochemistry and Molecular Biology 23 (2) :130 135 hfgl2 SARS,,,,, (,, 430030) 3 SARS hfgl2, PCR Western hfgl2 mrna SARS, hfgl2 5, hfgl2, SARS CHO,
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «ΟΛΟΚΛΗΡΩΜΕΝΗ ΑΝΑΠΤΥΞΗ & ΔΙΑΧΕΙΡΙΣΗ ΤΟΥ ΑΓΡΟΤΙΚΟΥ ΧΩΡΟΥ» ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ «Οικονομετρική διερεύνηση
Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression.
Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression. Gene Exon Forward primer Reverse primer Temp ( C) HRAS 2-3 ATGACGGAATATAAGCTGGT ATGGCAAACACACACAGGAA
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 7 27 7 671 ~ 678 PUMA sirna / 1 2 1 1 * 1 330006 2 330006 p53 p53 up-regulated modulator
Effects of ginkgolide B on the development of embryonic rat midbrain neurons
21 4 2011 7 Journal of Jiangsu UniversityMedicine Edition Vol. 21 No. 4 Jul. 2011 B 1 2 1. 2120012. 215006 B ginkgolide B GB kainic acid KA NGF B NGF + KA GB + KA MTT 72 h B P < 0. 05 P < 0. 01 3 d P
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
< (0.999) Graft (0.698) (0.483) <0.001 (0.698) (<0.001) (<0.001) 3 months (0.999) (0.483) (<0.001) 6 months (<0.
Supplementary table 1. Correlation of endothelial cell density among graft, 3, 6, and 12 months after Descemet s automated stripping endothelial keratoplasty. Graft 3 months 6 months 12 months Graft
M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna
2010 32 4 0797-0801 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com DX01 1 2 2* 1. 337000 2. 310058 DX01 Methanothermobacter marburgensis DX01 DX01