2 103 2 1,2 1 2 2 2 2 2 (11, 100050 ; 21, 100071) : 2 05ZY0913,05ZY0936 05ZY, 0913 0936 504 bp,549 bp,pset4s,dh5, 09132pSET4S,09362pSET4S, 09132pSET4S 09362pSET4S 2,, PCR 100gΠml,PCR, (0913 0936 ) 2 2, :; ; ; ; Construction Streptococcus Suis Type 2 Mutant Strains by Insertional Inactivation LU Ling2ling, LI Rong, LI Wen2jun, YUAN Yuan, ZHENG Yu2ling, WANG Heng2liang, J IANG Yong2qiang (National Institute for Nutrition and Food Safety, Chinese CDC, Beijing 100050, China) Abstract : Objective To construct the mutant strains of Streptococcus suis type 2 05ZY0913, 05ZY0936. Method Using the genomic DNA of 05ZY as the template, 504 bp, 549 bp fragments in the 0913, 0936 were amplified respectively as homologous arms, and linked with pset4s, and then the linked products were transferred into DH5competent cells to build the vectors 09132pSET4S, 09362pSET4S. Then using the method of insertional inactivation, the vectors of 09132pSET4S and 09362 pset4s were introducted into competent cells of Streptococcus suis type 2 by electrotransformation. And the transformants were screened on the plates containing spectinomycin and detected by PCR. Results The selected strains could resist spectinomycin whose concentration was 100gΠml. Through PCR verification, the selected strains were the mutants of Streptococcus suis type 2 whose purposed fragments were inactivated. foundation of studying function of the purposed fragments. Key word : Streptococcus suis ; Gene Silencing ;Mutagenesis, Insertional Conclusion Two mutant strains were successfully constructed, which laid the ( Streptococcus suis),, [1 ] 1968, [2 ] 1998,, 2005 6, 2005 8 3 12,204, 38 [3 ],, : (30600023) ; 863 (2006AA02Z404) ; (2006BAD06A02) : : 35,2 [4 ] 05ZY,0913 ATP, 0936 GTP Anita Verma,, ATP Pt1H [5 ] ;Jayesh,,GTP,, [6 ],, 0913 - pset4s,0936 - pset4s,, 0913 0936,0913 0936 05ZY0913,05ZY0936
104 CHINESE JOURNAL OF FOOD HYGIENE 2008 20 2 1 111 11111 05ZY,THB (Todd2Hewitt Broth) pset4s [7 ] Daisuke Takamatsu,( Spectinomycin, Spc), ( Escherichia coli) DH5,LB (Luria2 Bertani),, 100gΠml [7 ] 11112 EcoR BamH Sal,T4 Taq DNA DNA ( 2 000 1 000 750 500 250 100 bp) ( ) ;THB Bacto ;1,4 - (PIPES) dl - Sigma ; ( EB) AMRESCO (0492-1G) ; ; Promega, (chemical transformation buffer,ctb) :55 mmolπl 15 mmolπl 250 mmolπl 10 mmolπl PIPES,pH 617 ; (electroportation buffer, EB) :013 molπl 2 mmolπl, ph 814 11113 (NU - 440-400E, NUAIR ) (MCO - 17A1, ) (VersaDoc Model 4000,Bio - Rad ) ( HZS - H,) PCR (Tpersonal, Biometra) (himae CF16RX, ) ( Gene Pluser Xcell,Bio - Rad ) 112 11211 PCR 05ZY, 0913A1 0913A2 0936A1 0936A2, 0913 0936 504 bp 549 bp,0913 A 0936 A, pset4s P1 P2 P3 P4 ;MRP MRP1MRP2 ; 05ZY0913, 05ZY0936 0913B1 0913C1 0936B1 0936C1,4 05ZY 0913 0936, 0913 A 0936 A, pset4s MRP 0913 B C 0936 B C,6 ( 1) 1 1 05ZY0913 05ZY0936 PCR 94 7 min ;94 1 min, 60 1 min, 72 1 min, 29 72 7 min,4,, T4 PCR 1 %,( EB) 11212 37 4 h 0913 A 0936 A pset4s, EcoR BamH 0913 A pset4s,,t4 ; EcoR Sal 0936 A pset4s,0913 - pset4s,0936 - pset4s DH5, Spc (100gΠml) LB,37 24 h 0913 - pset4s - DH5 0936 - pset4s - DH5 PCR, Spc (100gΠml) LB PCR
2 105 1 05ZY (5-3 ) (bp) 0913 A 0913A1 GCGAATTCAGATCAGGTCAAACCCATTC EcoR 504 0913A2 GCGGATCCATGCCACCCTCAACTTCTTT BamH 0913 B 0913B1 CGCTATTCACATCAGCAGTA 1057 P4 CTGTGGATAACCGTATTA 0913 C 0913C1 GTTCTTATCCGAACCTTCCT 1097 P3 TTTTTATTTTGGTTTGATGTT 0936 A 0936A1 GCGAATTCCTATCTTACTTGGAGGACAA EcoR 549 0936A2 GCGTCGACCATCAATTTCAGAATCATAG Sal 0936 B 0936B1 AGCGAACCATTCGGGCTTTA 962 P4 CTGTGGATAACCGTATTA 0936 C 0936C1 TTCCTGTCCGGCCTTCAACA 1068 P3 TTTTTATTTTGGTTTGATGTT pset4s P1 ACTAGTTATCGGCATAATCG 1000 P2 TCTATTGTTACAGGATTTCG MRP MRP1 ACTAAAGCCGTTCAAGGTCC 1450 MRP2 TTGGGTCAAATGGGTAAGGT, 11213 05ZY [1 ] 8 h05zy 40 mmolπl dl - 20 ml THB,37 A 600 = 013 015,5 ml CTB ;, 5 ml CTB, 30 min ;,5 ml ; 3, 15 % 500 l, - 80 4 18 000 g 10 min 2 l 0913 - pset4s 0936 - pset4s 50 l 05ZY,118 kv 200 25F, 30 120 rπmin 3 h,spc ( 100gΠml) THB,30 5 % CO 2 24 h 11214 Spc (100gΠml) THB, 30 37, PCR 2 211 0913 A 0936 A DNA, DNA, ; 0135 kb215 kb, DNA, [8 ] 05ZY,PCR 0913 A 0936 A, 504bp,549bp PCR ( 2) 212 M,DNA 2 05ZY 0913 A 0936 A 21211 0913 - pset4s - DH5 0936 - pset4s - DH5 pset4s, LacZπ 11,35 pset4s ColE1,, 37,, pset4s 28,37 [7 ],,37,, pset4s
106 CHINESE JOURNAL OF FOOD HYGIENE 2008 20 2 5 0913 - pset4s - DH5 PCR 3,,1 3 4 5 PCR 4, 0913 A pset4s M,DNA ;+ : ;- : ;15 :5 3 0936 - pset4s - DH5 PCR (4) 1, 0936 A pset4s 3 0913 - pset4s - DH5 PCR M,DNA ;+ : ;- : ; 1 :MRP ;2 :pset4s ;3 :0913 C;4 :0913 B 5 05ZY0913 M,DNA ;+ : ; - : ;13 :3 4 0936 - pset4s - DH5 PCR 21212 05ZY0913 05ZY0936,(DNA ),, 2,,,4 PCR, :MRP,,; pset4s,, pset4s ;0913 B 0936 B 0913 C 0936 C,0913 0936 05ZY0913, 05ZY0936 05ZY 0913 05ZY 0936,PCR 5 6 MRP 10002000 bp, 1450 bp ; pset4s 1000 bp,1000 bp ; 0913 C 1000 bp, 1097 bp ;0913 B 1000 bp,1057 bp 05ZY0913 M,DNA ;+ : ;- : ; 1 :MRP ;2 :pset4s ;3 :0936 C;4 :0936 B 6 05ZY0936 MRP 10002000 bp, 1450 bp ; pset4s 1000 bp,1000 bp ; 0936 C 1000 bp, 1068 bp ;0936 B 1000 bp,962 bp 05ZY0936, 05ZY0913 05ZY0936, 0913 0936, [1 ] DAISUKE TAKAMATSU, MAKOTO OSAKI, TSUTOMU SEKIZAKI. Construction and characterization of Streptococcus suis2escherichia coli shuttle cloning vectors[j ]. Plasmid, 2001, (45) :1012113.
31-35 107 31-35 (, 100069) : A 31-35, 24 hwistar, 48 h A 31-35 A 25-35 24 h,(ptp) ; GSHΠGSSG;(ROS), A 31-35 A 25-35 ( P < 0105), (FSC) (SSC), ;A 31-35 A 25-35 GSHΠGSSG, ( P < 0101) ;A 31-35 A 25-35 ROS,( P < 0101) A 31-35 A 25-35, A : ;;; Study on Damage and Mechanism of Mitochondria of Neurons Induced by A31-35 LI Li, ZHANGJie, YU Huan2ling, XIANGLi, FENGJin2fang, YUAN Lin2hong, XIAO Rong (School of Public Health and Family Medicine, Capital Medical University, Beijing 100069, China) Abstract: Objective To study the damage of mitochondria of neurons induced by A 31235 and explore its possible mechanism. Method Cerebral cortexes of newborn 24 h Wistar rats were dissected to get neurons for primary culture. The neurons were planted into 2 ml culture plate at a density of 2 10 5 cellsπml to grow for 48 h. Then, A 31235 and A25235 were respectively added into the medium to establish mitochondria damaged model of neurons. After treating neurons with A31235 or A25235 for 24 h, the mitochondrial permeability transition pore ( PTP) of neurons was investigated by flow cytometry. The relative value of GSHΠGSSG in mitochondria of neurons was measured by assay kit ; Confocal microscopy was used to detect the level of reactive oxygen species (ROS). Each experiment was repeated 3 times. Results Comparing with control group, A312 35 and A25235 treatment group caused significant decrease of the mitochondrial membrane potential ( P < 0105) and the relative [2 ] PERCH B, KRISTJANSEN P, SKADHAUGE K. Group rstreptococci pathogenic for man[j ]. Acta pathol Microbiol Scand,1968,74 :69276. [3 ]. II [J ]., 2005, 22 (4) : 38239. [4 ],,,. 2 [J ]., 2007,23 (1) : 89291. [5 ] ANITA VERMA, DRUSILLA L BURNS. Requirements for assembly of PtlH with the pertussis toxin transporter apparatus of Bordetella pertussis [J ]. American Society for Microbiology, 2007, 75(5) : 229722306. [6 ] PATEL J C, GAL N J E. Differential activation and function of Rho GTPases during Salmonella2host cell interactions[j ]. The journal of cell biology, 2006, 175 (3) : 4532463. [7 ] DAISUKE TAKAMATSU, MAKOTO OSAKI, TSUTOMU SEKIZAKI. Thermosensitive suicide vector for gene replacement in Strepcoccus suis [J ]. Plasmid, 2001, (46) :1402148. [8 ] INDRANIL BISWAS, ALEXANDRA GRUSS, DUSKO EHRLICH, et al. High2efficiency gene inactivation and replacement system for gram2 positive bacteria[j ]. Journel of bacteriology, 1993,175 (11) : 36282 3635. [ :2007-10 - 08 ] :R15 ;S855111 :A :1004-8456 (2008) 02-0103 - 05 : (30571560) ; ( KM200610025010) ; ( KZ200710025011) : :