ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 11 24 (11) :1058 1063 ( A549) PGC21 1), 2), 3), 1), 3), 1), 1) 3 ( 1), 510663 ; 2), 510650 ; 3), 100049) (A549) PGC21,, p GL32PGC21 promoter, A549, PGC21 ; PCR PGC21 mrna ; Mitotracker green, ; A549., p GL32PGC21 promoter, A549 PGC21 mrna, ( P < 0105). PGC21 IC 50 ( 80 molπl), A549 IC 50 ( 80 molπl). A549 PGC21,. A549. ; (A549 ) ; PGC21 ; Q786 Rosiglitazone Suppresses the Expression of PGC21 and Proliferation of A549 Cells WANG Yan2Fei 1), 2), 3), CHEN Li2Hua 1), 3), ZHOU Xi 1), HUANG Zhi2Wei 1) 3 ( 1) Laboratory of Nuclear Hormone Receptor, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510663, China ; 2) South China Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China ; 3) Graduate School of Chinese Academy of Sciences, Beijing 100049, China) Abstract Rosiglitazone ( Rosi ), an anti2diabetic agonist for peroxisome proliferator2activated receptor (PPAR ), has been recently investigated for its inhibitory role in cell proliferation involving PPAR coactivator21 (PGC21 ). In our study, we first studied the effects of Rosi on cell proliferation in association with the PGC21 expression in lung cancer cell line A549. The PGC1 promoter2driven luciferase activity was determined by fluorescent intensity and the PGC21 mrna level was assayed by real2time PCR. Our results showed that Rosi dose2dependently repressed the activity of PGC21 promoter and decreased the mrna expression level of PGC21. As PGC21 was also known to control mitochondrial biogenesis, we further detected the mitochondrial mass changes by Mitotracker Green staining, and the data suggested that Rosi suppressed mitochondrial biogenesis. The effect of Rosi on cell proliferation was evaluated by cell counting, which correlated well with the IC 50 of PGC21 inhibition and the loss of mitochondrial mass. These evidences collectively suggested that the Rosi inhibition of cell proliferation might be mediated by the depression of PGC2 1 expression and its activity. Key words rosiglitazone ; A549 cell line ; PGC21 ; mitochondrial mass : 2008205209 ; :2008208219 3 Tel : 020232290256 ; E2mail :wong - chiwai @gibh. ac. cn Received : May 9,2008 ; Accepted : August 19,2008 3 Corresponding author Tel :0202 32290256 ; E2mail :wong - chiwai @gibh. ac. cn
11 : (A549) PGC21 1059 (rosiglitazone, Rosi) (thiazolidinedione,tzd), (peroxisome proliferators2 activated receptor, PPAR )., TZD PPAR.,,TZD PPAR [1 ]. PGC21 (peroxisome proliferator2activated receptor coactivator21 ) PPAR, PPAR, PPAR, [2,3 ]. [4,5 ], (3T32L1) (C3H10T1Π2), TZD PGC21, (A549)., A549 PGC21, (mitochondrial mass), A549. 1 1. 1 (A549) ATCC,RPMI1640 ( PS) OPTI2 MEM Gibco, ( FBS) Hyclone,pFR2Luciferase p GL32Basic Stratagene, MitoTracker Green FM probe Trizol Lipofectamine TM 2000 Invitrogen,SYBR premix Ex Taq TaKaRa, Cayman, ( Renilla2luciferase) DualGlo (A3800) Promega, DNA. 1. 2 A549 DNA, PGC21 promoter ( - 2685, + 78). :5 2GTA GGTACC CATTTAAGTTCTCCTGA GAA AAG23, Kpn ; 5 2GTACTCGAG TGACGCCAGTCAAGCTTTTTC23, Xho. PCR, p GL32Basic, top10, PCR.,,. 1. 3 37 5 % CO 2, 10 % (FBS) 1 10 5 U/ L ( P) 1 10 5 U/ L (S) RPMI1640,0125 % ( 0102 % EDTA), 2 d 1,. 1. 4 2 10 4 Π 96, 85 % 90 %,. : p GL32PGC21 promoter : 25 ngπ, 3 ngπ ;Lipofectamine TM 2000 0125 lπ ; Invitrogen. 8 h,, 24 h.,. 3, 3. 1. 5 PCR( real2time PCR) 2 10 5 Π 6,16 h, 24 h, Trizol RNA, Promega cdna, MJ PCR PCR. 18S rrna : 5 2GGT GAA ATTCTT GGACCGGC23, : 5 2GAC TTT GGTTTC CCGGAAGC 23, 159 bp ; PGC21 :5 2TCAGTCCTCACTGGTGGACA23, :5 2TGCTTCGTCGTCAAAAACAG23, 350 bp. : 95 20 s,pcr :95 15 s,60 20 s,72 5 s,44. PCR. 2 %,. 3, 3. 1. 6 Mitotracker Green( MG), 8 10 4 Π 24, 115 ; ( PBS), 150 nmolπl MG,,37 30 min ;PBS 3 PBS, ( 488 nm, 516 nm, 112 10 4 ). 3, 3. 1. 7 215 10 4 Π 24,16 h, 24 h 48 h,,pbs 2,0. 25 %
1060 24,,,,. 3. 1. 8,, P < 0105 ( 3 P < 0105, 3 3 P < 0101, 3 3 3 P < 01005). SPSS 810 IC 50. 2 2. 1 PGC21 promoter PGC21, PGC21 Π p GL32PGC21 promoter. A549,., 1 molπl,, ; 10 molπl, PGC21 promoter, DMSO ( P < 0105) (Fig. 1). 2. 2 PGC21 mrna PGC21,,A549 Fig. 1 Rosiglitazone inhibits the activity of pgl32pgc21 promoter in A549 cells After transfection of pgl32pgc21 promoter and renilla luciferase reporter gene for 8 hours, the cells were treated with rosiglitazone for 24 hours, the activity of pgl32pgc21 promoter was normalized to that of internal control renilla luciferase activity. The results of treated cells were further expressed as the percent of DMSO control. Results represent triplicate samples and three independent experiments. P < 0105 for the activity inhibition is indicated by asterisk 3 and P < 01005 indicated by asterisk 333 PGC21 mrna., PGC21 ; 40 80 160 320 475 molπl, 20145 % 30120 % 42117 % 50126 % 73151 %,, ( P < 0101) (Fig. 2B). Fig. 2 Rosiglitazone represses the mrna level of PGC21 Before mrna was extracted, A549 cells were treated with different concentration of rosiglitazone for 24 hours. The cdna was generated with random primer by reverse transcription kits (Promega) using 1 g total RNA. The resulting cdna was subsequently analyzed with SYBR green kit (TaKaRa,) on an MJ Real2 Time PCR System using the Ct threshold cycle method. (A) PCR products of PGC21 and 18S rrna by 2 % agarose gel electrophoresis. 1 : DMSO control ; 2 6 : Rosi (40, 80, 160, 320, 475 molπl) ; (B) Fluorescence intensity analysis of PCR products. The intensity of PGC21 was normalized to that of 18S rrna. The results of treated cells were further expressed as the ratio of DMSO control. Results represent triplicate samples and three independent experiments. P < 0101 is indicated by asterisk 3 3 and P < 01005 indicated by asterisk 3 3 3
11 : (A549) PGC21 1061 2. 3 A549 PGC21 [3, 6 ]. A549 PGC21,.,,.,40 80 160 320 475 molπl, 115 % 712 % 1119 % 1219 % 1613 %, ; 80 molπl, ( P < 0105) (Fig. 3). Fig. 3 Rosiglitazone decreases mitochondrial mass in A549 cells After seeded at a density of 8 10 4 cells per well in 242well plates for 16 hours, A549 cells were treated with different concentration of rosiglitazone for 24 hours. Then mitochondrial mass was determined by the stain of Mitotracker Green and analyzed with a FACS calibur (excitation at 488 nm, emission at 516 nm). (A) Representative flow cytometry analysis curves for quantification of mitochondrial mass in A549 cells treated by rosiglitazone for 24 hours. 1 : DMSO ; 2 : Rosi 80 molπl ; 3 : Rosi 320 molπl ; (B) Mitochondrial mass determined using the fluorescent dye Mitotracker Green was quantified by flow cytometry. Results represent triplicate samples and three independent experiments. P < 0105 is indicated by asterisk 3, P < 0101 indicated by asterisk 3 3 and P < 01005 indicated by asterisk 3 3 3 2. 4 A549,, PGC21, A549.,A549 Fig. 4 Morphologic change of A549 cells after treatment with rosiglitazone for 48 hours ( 1 000 ) After seeded at a density of 215 10 4 cells per well in 242well plates for 16 hours, A549 cells were treated with different concentration of rosiglitazone for 48 hours. The pictures of treated cells were taken by a Leica microscope companied with acamera. (A) DMSO ; (B) Rosi 80 molπl ; (C) Rosi 160 molπl ; (D) Rosi 320 molπl
1062 24 24 h,, ;48 h,,,,, ( Fig. 4)., :24 h, 40 molπl 98148 % 475 molπl 44114 % ;48 h, 40 molπl 90151 % 475 molπl 15173 %, 2 (Fig. 5). Fig. 5 Rosiglitazone reduces proliferation of A549 cells After seeded at a density of 215 10 4 cells per well in 242well plates for 16 hours, A549 cells were treated with different dose of rosiglitazone for 24 hours or 48 hours and then were detached and counted using a hemocytometer. Results represent three independent experiments 3 PGC21 PGC21, PPAR,, [2 4 ]., PGC21 promoter, PGC21 ; PCR PGC21 mrna.,. Guan [4 ], Burgermeister [5 ], (3T32L1) (C3H10T1Π2), TZD PGC21., [7 ]., Guan Burgermeister E 6 8 d ; 1 2 d.. PGC21, Mitotracker Green.,, PGC21 mrna.,pgc21 (UCP),,, [6, 8 ].,PGC21, GPX1 SOD2, [9 ]., PPAR [10 12 ] ;,, A549 PGC21,, UCP GPx1 SOD2,,., A549 IC 50 ( 80 molπl) PGC21 IC 50 ( 80 molπl),. TZD PPAR. PPAR,, : PPAR EC50 ( nmolπl ) IC 50 ( molπl ) PPAR PPAR [1,13 ]., A549 PGC1,, A549, A549, TZD. ( References) [ 1 ] Girnun G D, Smith W M, Drori S, et al. APC2dependent suppression of colon carcinogenesis by PPAR [J ]. Proc Natl Acad Sci USA, 2002, 99(21) : 13771213776
11 : (A549) PGC21 1063 [ 2 ] Puigserver P, Wu Z, Park C W, et al. A cold2inducible coactivator of nuclear receptors linked to adaptive thermogenesis [ J ]. Cell, 1998, 92 (6) : 8292839 [ 3 ] Benton C R, Han X X, Febbraio M, et al. Inverse relationship between PGC21 protein expression and triacylglycerol accumulation in rodent skeletal muscle [J ]. J Appl Physiol, 2006,100 (2) : 3772 383 [ 4 ] Guan HP, Ishizuka T, Chui PC, Corepressors selectively control the transcriptional activity of PPAR in adipocytes [ J ]. Genes Dev, 2005, 19 (4) : 4532461 [ 5 ] Burgermeister E, Schnoebelen A, Flament A, et al. A novel partial agonist of peroxisome proliferator2activated receptor ( ppar ) recruits ppar 2coactivator21a, prevents triglyceride accumulation,and potentiates insulin signaling in vitro[j ]. Mol Endocrinol, 2006, 20 (4) : 8092830 [ 6 ] Wu Z, Puigserver P, Andersson U, et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC21[J ]. Cell, 1999, 98(1) : 1152124 [ 7 ] Bianchi N O, Bianchi M S, Richard S M. Mitochondrial genome instability in human cancers[j ]. Mutat Res,2001, 488(1) : 9223 [ 8 ] Scarpulla R C. Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells [ J ]. Gene, 2002, 286(1) : 81289 [ 9 ] St2Pierre J, Drori S, Uldry M. Suppression of reactive oxygen species and neurodegeneration by the pgc21 transcriptional coactivators [J ]. Cell, 2006, 127(2) : 3972408 [10 ] P rez2ortiz J M, Tranque P, Vaquero C F, Glitazones differentially regulate primary astrocyte and glioma cell survival [ J ]. J Biol Chem., 279(10) : 897628985 [11 ] P rez2ortiz J M, Tranque P, Burgos M, et al. Glitazones induce astroglioma cell death by releasing reactive oxygen species from mitochondria: modulation of cytotoxicity by nitric oxide [ J ]. Mol Pharmacol, 2007, 72 (2) : 4072417 [12 ] Kim YH, Jung EM, Lee TJ, et al. Rosiglitazone promotes tumor necrosis factor2related apoptosis2inducing ligand2induced apoptosis by reactive oxygen species2mediated up2regulation of death receptor 5 and down2regulation of c2flip[j ]. Free Radic Biol Med, 2008, 44 (6) : 105521068 [13 ] Emery M N, Leontiou C, Bonner S E, et al. PPAR2 expression in pituitary tumours and the functional activity of the glitazones : evidence that any anti2proliferative effect of the glitazones is independent of the PPAR2 receptor [ J ]. Clin Endocrinol ( Oxf ), 2006, 65 (3) : 3892395