,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
|
|
- Μελπομένη Δαγκλής
- 5 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 18 (2) : HLA2B ) ( 2) ) HLA2B HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B % F0 HLA2B % F0 F HLA2B2704 mrna HLA2B HLA2 B2704 HLA2B2704 Q33 Q78 The Technique of Producing HLA2B2704 Gene Transgenic Mice CHEN Zhan2kun LΒ Hou2shan 3 J IANG Dong2fang WANG Dong AI Jing DING Hai2ming WANG Shen2wu 2) ( Arthritis Research Cencer 2) Central Laboratory Peking University People s Hospital Beijing China) Abstract To produce HLA2B2704 transgenic mice by microinjection 286 Kunming female mice were induced to give superovulation by injecting hormone The fertilized eggs were collected and microinjected with genomic DNA fragment containing HLA2B2704 DNA into their pronucleus After microinjection the survial and two2cell fertilized eggs were implanted into the oviducts of pseudopregnant female mice to let them develop and produce progeny The intergration of the target gene in F0 and F1 mice was analyzed by PCR The expression of HLA2 B2704 transgene at mrna level was comfirmed by RT2PCR fertilized eggs were collected of them were microinjected The number of survial and two2cell eggs was after microinjection The survial rate was 6417 % These eggs were implanted into 153 pseudopregnant female mice 26 of which were pregnant and 101 offsprings were obtained at last PCR analysis showed that genomes of 10 F0 transgenic mice were integrated with the HLA2B2704 gene The integration rate was 919 % Among 78 F1 of positive F0 transgenic mice 15 F1 mice carried the HLA2B2704 gene HLA2B2704 gene was expressed at the mrna level in skin colon testicle and spleen tissues of the transgenic mice In the positive HLA2B2704 transgenic mice six mice were detersile One mouse showed tumescent at podosoma and toes Two mice appeared photophobia One mouse arised diar2 : : (No ) 3 Tel : Tel : (010) Received :August ;Accepted :October Supported by National Natural Science Foundation of China No Corresponding author Tel : (010)
2 rhea The transgenic mice carrying the HLA2B2704 genotype and phenotype were produced successfully Key words transgene HLA2B2704 gene mice microinjection 1980 Gordon [1 ] 30 lπ gπml HSV2TK [4 ] ( HLA2B2704 [2 ] : g 4 5 ; d (2) : HLA2B IU PMS 46 h HLA2B IU HCG 1 1 (3) :6 8 ( 30 g ) ( 6 8 : 8 :00 30 min PMS ( ) ml ; (c) M16 20 ; (d) HCG( ) l M2 HLA2B2704 pbr % ( ) AutΩnoma Castro 1 cm M2 M16 SINGMA [3 ] DIAPHOT PBS PN230 TRANSTOMER SN MICRO2 10 g L l ( 013 g FORGE MF290 BURNER L - 1 ) 10 NIKON CO 2 ( SANYO) G GD21 (NARISHIGE) PCR (PE2480) HLA2B2704 DNA 9 M2 9 (3) :M2 HLA2B2704 DNA pbr322 EcoR M16 CO h 8 g L V 5 h 615 kb HLA2B2704 DNA Agarose Gel DNA Extraction kit (QIAGEN) DNA 20 : : ( (1 ( Fig 1 4 ) 2 ; (2) 2 ; (3) 1Π10 2 mol L - 1 NaCl 3-20 ; (4) 70 % ( ) 2 ; (5) [ 7 mmol L - 1 Tris (ph 714) 0115 mmol L CO 2 : (a) PBS 115 ml ; ( b) M2 2 5 min (2) : M2 4 (4) : 13 : EDTA] DNA ; (6) DNA ; (7) 0122 m M16
3 2 : HLA2B CO h 20 g L - 1 (5) : RT2PCR HLA2B2704 mrna 75 %( ) ( RNA : 015 cm 018 cm 018 HLA2B2704 cm Trizol Reagent ; (2) RT2PCR : HLA2B bp :5 2GGGTCTCACAC2 CCTCCAGAAT23 : 5 2CGGCGGTCCAGGAGCT2 3 : min 96 2 min :M2 M2 30 M2 (96 30 s 65 1 min s) min ( ; (2) ; (3) 1 ; (4) Table % Table 1 Number of used kunming mice and collected eggs per month Fig 1 A microinjection pipette was inserted into the male pronu2 cleus of a fertilized egg for injecting DNA solution (Light field 40 ) Month Number of injected kunming mice (a) Number of mating (b) bπa ( %) Number Number of collected of injectable egg(c) eggs(d) dπc ( %) ( DNA F0 F1 3 4 DNA ; 2 mm 200 l PCR ( nonionic detergents PBND) 115 ml ; l 10 g L - 1 K 55 3 h ; d min K; 50 l PCR 2 l DNA (2) PCR : Dominguez HLA2B d bp 3 5 2GGGTCTCACACCCTCCAGAAT CGGCGGTCCAGGAGCT23 PCR : 213 PCR 97 2 min ( s F0 HLA2B2704 DNA Fig F s s) % F min 10 l PCR F1
4 HLA2B2704 mrna Fig 3 Fig 2 Integration detection of HLA2B2704 gene by PCR in transgenic mice M:100 bp DNA ladder ; 1 2 :Negative control (genomic DNA of normal mice) ;3 4 : Genomic DNA of HLA2B2704 transgenic mice ; 5 : Positive control ( human genomic DNA containing HLA2B27 gene) ;6 :Blank control Fig 3 Tissue specific expression of HLA2B2704 gene by RT2PCR analysis M:100 bp DNA ladder ; : Total mrna extracted from co2 lon skin testicle and spleen of positive mice ;5 :Positive control (to2 tal mrna extracted from HLA2B27 positive human white blood cell) ; 6 : Negative control ( total mrna extracted from spleen of normal mice) ; 7 :Blank control 6 3 [5 ] 1 3 : 00 PM PMS 3 1 :00 2 :00 PM HCG 4 8 :00 AM ( HCG 215 ; (2) ( : 6 4 : :10 d 2 1 Table 1 2 :10 d 8 (2) :1 (3) : 2 (4) : : HLA2B ( PN230) 2 1 2
5 2 : HLA2B HLA2B2704 HLA2B2704 DNA HLA2B2704 ( References) DNA 210 gπml 1 3 pl 3515 % Pinkert [6 10 % ] :M2 M2 30 M2 : ( ; (2) ; (3) 1 Gordon J W Scangos G A Plotkin D J Genetic transformation of mouse embryos by microinjection of purified DNA Proc Natl Acad Sci : HLA2B27 (Lin Jian2hao L Hou2shan Chen Zhan2kun Jiang Dong2 fang Wang Shen2wu Feng Chuan2han Ankylosing spondylitis and HLA2 B27 subtypes :A disease2related research in Chinese Han nationality J Beijing Med Univ) (5) : Hogan B Beddington R Costantini F et al Manipulating the Mouse Embyro : A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Press 1994 : : ( Tian Xiao2li Chen Lan2ying Hu Rong2li2 ang(eds) : Principle Technology and Application of Transgenic Animal Jilin :Jilin Press of Science and Technology) 1994 : Ryan T M Townes T M Reibly M P et al Human sickle hemoglobin in2 transgenimice Science : Pinkert C A Transgenic Animal Technology : A Laboratory Handbook San Diego :Academic Press Inc 1994 :
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Διαβάστε περισσότεραRapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότεραStudy on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Διαβάστε περισσότεραα 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Διαβάστε περισσότεραTGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότεραLUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Διαβάστε περισσότερα,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Διαβάστε περισσότεραAntimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Διαβάστε περισσότεραNucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Διαβάστε περισσότεραResurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Διαβάστε περισσότεραElectronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Διαβάστε περισσότεραConductivity Logging for Thermal Spring Well
/.,**. 25 +,1- **-- 0/2,,,1- **-- 0/2, +,, +/., +0 /,* Conductivity Logging for Thermal Spring Well Koji SATO +, Tadashi TAKAYA,, Tadashi CHIBA, + Nihon Chika Kenkyuusho Co. Ltd., 0/2,, Hongo, Funabashi,
Διαβάστε περισσότεραCopper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότεραER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Διαβάστε περισσότεραThe toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Διαβάστε περισσότεραHIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
Διαβάστε περισσότερα2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Διαβάστε περισσότεραSupporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Διαβάστε περισσότεραScience of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Διαβάστε περισσότερα1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Διαβάστε περισσότερα, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H
57 6 2008 6 100023290Π2008Π57 (06) Π3486208 ACTA PHYSICA SINICA Vol. 57,No. 6,June,2008 ν 2008 Chin. Phys. Soc. 3 1) 2) 1) g 1) (, 130033) 2) (, 100049) (2007 9 11 ;2007 11 14 ),Littrow,,.,., Litrrow.
Διαβάστε περισσότεραExtract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Διαβάστε περισσότεραSupporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Διαβάστε περισσότεραReading Order Detection for Text Layout Excluded by Image
19 5 JOURNAL OF CHINESE INFORMATION PROCESSING Vol119 No15 :1003-0077 - (2005) 05-0067 - 09 1, 1, 2 (11, 100871 ; 21IBM, 100027) :,,, PMRegion,, : ; ; ; ; :TP391112 :A Reading Order Detection for Text
Διαβάστε περισσότεραGro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Διαβάστε περισσότεραΜελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Διαβάστε περισσότεραCongruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Διαβάστε περισσότεραSupporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Διαβάστε περισσότεραA facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Διαβάστε περισσότεραCollege of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Διαβάστε περισσότεραDNA. SPF 20 d 9. 09% % % % % % Testis Injection of Exogenous DNA Results in Expression in Mouse Sperm
Chinese Journal of Zoology 2010 45 2 151 ~ 157 DNA * 400716 DNA Mus musculus DNA DNA pegfp-n 1 DNA- DNA 0. 08 μg / μl 0. 12 μg / μl 0. 24 μg / μl 3 SPF 2 5 d 3 20 d GFP PCR 3 9. 09% 47. 06% 27. 78% 3 GFP
Διαβάστε περισσότεραOptimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Διαβάστε περισσότεραDirect Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3
Supporting Information Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3 Shohei Shimokawa, Yuhsuke Kawagoe, Katsuhiko Moriyama, Hideo Togo* Graduate
Διαβάστε περισσότεραSupporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Διαβάστε περισσότεραΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Διαβάστε περισσότεραSupporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
Διαβάστε περισσότεραDesign and Fabrication of Water Heater with Electromagnetic Induction Heating
U Kamphaengsean Acad. J. Vol. 7, No. 2, 2009, Pages 48-60 ก 7 2 2552 ก ก กก ก Design and Fabrication of Water Heater with Electromagnetic Induction Heating 1* Geerapong Srivichai 1* ABSTRACT The purpose
Διαβάστε περισσότεραSupplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3
Supplementary Information Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3 Lewis Pairs: Structures of Intermediates, Kinetics, and Mechanism Qianyi Wang, Wuchao Zhao,
Διαβάστε περισσότεραΕθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ
Εθνικό Μετσόβιο Πολυτεχνείο Σχολή Μηχανολόγων Μηχανικών ΕΡΓΑΣΤΗΡΙΟ ΕΜΒΙΟΜΗΧΑΝΙΚΗΣ ΚΑΙ ΣΥΣΤΗΜΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΗΧΑΝΟΛΟΓΙΚΩΝ ΚΑΤΑΣΚΕΥΩΝ ΚΑΙ ΑΥΤΟΜΑΤΟΥ ΕΛΕΓΧΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ
Διαβάστε περισσότεραc Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Διαβάστε περισσότεραA summation formula ramified with hypergeometric function and involving recurrence relation
South Asian Journal of Mathematics 017, Vol. 7 ( 1): 1 4 www.sajm-online.com ISSN 51-151 RESEARCH ARTICLE A summation formula ramified with hypergeometric function and involving recurrence relation Salahuddin
Διαβάστε περισσότεραQuick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Διαβάστε περισσότεραReaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Διαβάστε περισσότερα8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Διαβάστε περισσότερα* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Διαβάστε περισσότεραCorrection of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Διαβάστε περισσότεραEmulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil
354 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /-, No.0, -/.-0* (,**0) 38 * * Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil Tomoko Kawakami, Kyoko Ohashi* and Atsuko Shimada Graduate
Διαβάστε περισσότεραExperimental Study of Dielectric Properties on Human Lung Tissue
32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021
Διαβάστε περισσότεραDistribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Διαβάστε περισσότεραSupplementary Information for
Supplentary Information for Aggregation induced blue-shifted ission molecular picture from QM/MM study Qunyan Wu, a Tian Zhang, a Qian Peng,* b Dong Wang, a and Zhigang Shuai* a a Key Loratory of Organic
Διαβάστε περισσότεραDevelopment of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Διαβάστε περισσότεραMSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Διαβάστε περισσότεραE#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils
J. Jpn. Soc. Soil Phys. No. 3+, p..3 /1,**, * ** ** E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils Kaoru UENO*, Tadashi ADACHI** and Hajime NARIOKA** * The Graduate School
Διαβάστε περισσότεραComputational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based
Διαβάστε περισσότεραElectrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Διαβάστε περισσότεραPNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Διαβάστε περισσότεραSupporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Διαβάστε περισσότεραInhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Διαβάστε περισσότεραN 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
Διαβάστε περισσότερα( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Διαβάστε περισσότεραQuantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Διαβάστε περισσότεραHigh order interpolation function for surface contact problem
3 016 5 Journal of East China Normal University Natural Science No 3 May 016 : 1000-564101603-0009-1 1 1 1 00444; E- 00030 : Lagrange Lobatto Matlab : ; Lagrange; : O41 : A DOI: 103969/jissn1000-56410160300
Διαβάστε περισσότεραOctretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis
528 2012 6 21 6 Chin J Gastroenterol Hepatol Jun 2012 Vol. 21 No. 6 doi 10. 3969 /j. issn. 1006-5709. 2012. 06. 011 Meta 430060 Cochrane Library Pubmed 2 Revman 5. 0 6 484 Meta Meta R573. 2 A 1006-5709
Διαβάστε περισσότεραVBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Διαβάστε περισσότεραInfluence of Flow Rate on Nitrate Removal in Flow Process
J. Jpn. Soc. Soil Phys. No. 33, p.1-2-,**/, ******* Influence of Flow Rate on Nitrate Removal in Flow Process Toshio TABUCHI*, Hisao KURODA**, Akiko IKENOBE** and Mayumi HIRANO** * Former professor of
Διαβάστε περισσότεραPE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE
2624 54 plasma exchange PE hemoperfusion HP continuous venovenous hemofiltration CVVH 54 PE CVVH PE+HP HP+CVVH HP+CVVH+PE 183 exceed normal limit absolute value ENLAV prothrombin time PT PE total bilirubin
Διαβάστε περισσότεραΜαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα
Διαβάστε περισσότεραScreening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
Διαβάστε περισσότεραSupporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Διαβάστε περισσότεραComparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Διαβάστε περισσότερα*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
Διαβάστε περισσότεραEffects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis
33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6
Διαβάστε περισσότεραSite-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran
1 Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran Munawar Hussain, a Rasheed Ahmad Khera, a Nguyen Thai Hung, a Peter Langer* a,b a Institut für Chemie, Universität Rostock,
Διαβάστε περισσότεραLewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Διαβάστε περισσότεραSeparation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection
31 2 2012 2 FENXI CESHI XUEBAO Journal of Instrumental Analysis Vol. 31 No. 2 127 ~ 132 - * 730070 PB - Eu - 3 8 min 0. 025 ~ 10 0. 025 ~ 25 0. 05 ~ 10 mg /L 3 1. 00 mg /L 3 6 RSD 4. 5% 0. 95% 3 101%~
Διαβάστε περισσότεραVilsmeier Haack reagent-promoted formyloxylation of α-chloro-narylacetamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 205 Vilsmeier aack reagent-promoted formyloxylation of α-chloro-arylacetamides by formamide Jiann-Jyh
Διαβάστε περισσότεραΑξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών
Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231
Διαβάστε περισσότεραNguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
Διαβάστε περισσότεραA Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Διαβάστε περισσότερα, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραCorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Διαβάστε περισσότερα) ; GSP ) ;PXD g, 100 ml
30 (FENXI HUAXUE) 10 2002 10 Chinese Journal of Analytical Chemistry 1163 1167 3 3 3 (, 225002) PVC, 1. 0 10-4 1. 0 10-8 molπl, 58. 6 mvπdecade ; 2. 5 10-9 molπl, 2 3,,,,, 1, PVC Pretsch 1, EDTA,, 5 10-12
Διαβάστε περισσότεραAnalysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius
Chinese Journal of Zoology 2009,44 (3) :7075 3 ( 830000) : 6 ( Esox lucius), :6418 %,1911 %114 %,17 17138 %,7 8114 %,6136 % 45173 %,,WHOΠFAO 76135,,,,, : ; ; ; ; :Q955 :A :025023263 (2009) 03270206 Analysis
Διαβάστε περισσότερα«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»
ΦΟΡΕΑΣ ΔΙΑΧΕΙΡΙΣΗΣ ΕΘΝΙΚΟΥ ΘΑΛΑΣΣΙΟΥ ΠΑΡΚΟΥ ΖΑΚΥΝΘΟΥ ΤΕΥΧΟΣ ΠΡΟΚΗΡΥΞΗΣ ΑΝΟΙΚΤΟΥ ΙΑΓΩΝΙΣΜΟΥ ΓΙΑ ΤΟ ΕΡΓΟ «ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ» Για τις ανάγκες της Πράξης ΟΡΓΑΝΩΣΗ ΤΗΣ ΠΡΟΣΤΑΣΙΑΣ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ
Διαβάστε περισσότεραΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY
10 ο COMECAP 2010, Πρακτικά Συνεδρίου, Πάτρα 10 th COMECAP 2010, Proceedings, Patras, Greece ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY ΥΧΡΟΥΡΟΝΗΚΖ ΓΗΑΚΤΜΑΝΖ ΣΧΝ ΖΛΔΚΣΡΗΚΧΝ ΔΚΚΔΝΧΔΧΝ ΣΖΝ ΔΛΛΑΓΑ ΓΗΑ ΣΖΝ ΥΡΟΝΗΚΖ ΠΔΡΗΟΓΟ 1998-2007
Διαβάστε περισσότεραΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ
ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙ ΕΥΤΙΚΟ Ι ΡΥΜΑ ΚΡΗΤΗΣ ΤΜΗΜΑ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ ΕΠΙΜΕΛΕΙΑ: ΑΡΜΕΝΑΚΑΣ ΜΑΡΙΝΟΣ ΧΑΝΙΑ
Διαβάστε περισσότεραPotentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph
2004 62 20, 2062 2066 ACTA CHIMICA SINICA Vol 62, 2004 No 20, 2062 2066 ΞΞ ( 400715) (AET) ( GCE), (NG), (Cys) ( GA) (anti2diph), (Diph), 24 600 ng ml - 1, 8 9 mv/ decade, 0 9979, 5 2 ng ml - 1,,,,, Potentiometric
Διαβάστε περισσότεραStudy on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Διαβάστε περισσότεραComparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Διαβάστε περισσότεραResearch on the Effect and Technique of Remediation for Multi-Metal Contaminated Tailing Soils
34 9 2013 9 ENVIRONMENTAL SCIENCE Vol 34 No 9 Sep 2013 1 2 1* 1 1 2 1 2 1 2 Marc Peters 1 1 100101 2 100049 EDTA Cd Pb 52 2 mg kg - 1 4 836 5 mg kg - 1 Cr 2 7% 60% Cd Pb 0 1% 0 1 mol L - 1 EDTA 1 6 2 3
Διαβάστε περισσότεραSupplementary information
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary information Synthesis of carboxyimidamide-substituted benzo[c][1,2,5]oxadiazoles
Διαβάστε περισσότεραΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ
ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ Γηπισκαηηθή Δξγαζία ηνπ Φνηηεηή ηνπ ηκήκαηνο Ζιεθηξνιόγσλ Μεραληθώλ θαη Σερλνινγίαο Ζιεθηξνληθώλ
Διαβάστε περισσότεραAccumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Διαβάστε περισσότεραMetal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Διαβάστε περισσότεραStress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Διαβάστε περισσότεραThe pathway of the ozonation of 2,4,62trichlorophenol in aqueous solution
25 12 2005 12 Acta Scientiae Circumstantiae Vol. 25,No. 12 Dec., 2005,. 2,4,62 [J ].,2005,25 (12) :1619-1623 PI Yunzheng, WANGJianglong. The pathway of the ozonation of 2,4,62trichlorophenol in aqueous
Διαβάστε περισσότερα