39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp Slf14 III RT-PCR RNA pet-22b + -PKSIII Ni-NTA BL21 DE3 SDS-PAGE 43 kda III Q 979 85 A DOI 10 16357 /j cnki issn1000-5862 2015 04 19 0 6-10 III PKS Hypocrellins Shiraia sp Slf14 PKS 1-3 Polyketide synthase PKS PKS 11-15 Shiraia sp Slf14 Shiraia sp Slf14 4-5 > 98% NCBI AXZN00000000 1 3 Shiraia sp Slf14 3 I PKS modular III PKS RT-PCR II PKS iterative 2 KS α KS β 1 III PKS 2 PKS ACP 1 1 -CoA -CoA 1 1 1 E coli DH5α E coli BL21 2015-03-24 31460021 20142BAB214008 GJJ13211 YRD201408 1971-6-8
4 Shiraia sp Slf14 III 431 DE3 Shiraia sp Slf14 pet- 22b T-vector PMD19 simple TaKaRa 1 1 2 LB g L - 1 10 5 10 15 ph 7 0 121 20 min Shiraia sp Slf14 RNA DNA 1% RNA 1 1 3 KOD DNA RNAiso Plus T4 RNA - 20 RNA DNA PrimeScript TM reagent Kit with gdna Eraser QuickCut Nde I BamH I Not I PrimeScript cdna DNA Ladder Marker pmd TM 1 2 2 III PKS 19-T Vector Cloning Kit TaKaRa E Z N A cycle-pure kit Plasmid Mini Kit I Gel Extraction Kit OMEGA 1 1 4 PCR BIO- RAD UV-3900 50 μl 10 Buffer 5 0 μl dntps 2 5 mmol L - 1 4 0 μl pksiii-ndei-f pksiii-bamhi-6his-r 1 5 μl KOD-Plus-Neo 1 μl cdna 1 μl ddh 2 O Heraeus DYY-8C DNA 50 μl PCR 94 2 min 98 1 2 1 2 1 Shiraia sp Slf14 RNA cdna 1 DEPC 2-80 RNAiso Plus RNAiso Plus III PKS Primer 5 III PKS pksiii-ndei-f pksi- II-BamHI-6His-R 1 cdna III PKS NdeI BamHI 10 s 55 30 s 68 40 s 30 68 7 min 4 1% pksiii-ndei-f pksiii-bamhi-6his-r GGAATTCCATATGTCCCACGTGGCTAACAC CGCGGATCCTTAGTGGTGGTGGTGGTGGTGACCTGTTCGTACAGTGTGCCAG Gel Nde I Bam HI Extraction Kit PCR 1% pmd TM 19-T Vector Cloning Kit DNA 0 7 10 min T-vector pmd19 simple E coli 22 IPTG 1 mmol L - 1 22 DH5α PCR 200 rpm 8 h 50 ml 1 100 μl TaKaRa 4 8 000 rpm 1 2 3 III PKS 5 min 20 ml TE Nde I Bam HI 1 2 2 pet-22b + LB 37 200 rpm 2 h OD 600 Buffer 5 min 1 1 1% 4 Gel Extraction Kit PCR 10 ml Buffer A T4 DNA 20% 3 s 5 s 4 10 min 100 μl BL21 DE3 37 4 10 000 rpm 15 min SDS-PAGE Ni-NTA PCR 12% SDS-PAGE
432 2015 2 1 a Shiraia sp Slf14 III PKS 1 b 2 1 III PKS pmd19-t Nde I Bam HI 1 3 kb Shiraia sp Slf14 pmd19-t 2 RNA RT-PCR 1 3 kb 1 a pksiii-nde I-F pksiii-bam HI-6His-R RT-PCR 2 Nde I Bam HI b RT-PCR 2 2 III PKS 2 α β III α 3 β PKS 2 3 3 III PKS 4 3 III PKS
4 Shiraia sp Slf14 III 433 4 III PKS / 2 3 III PKS PCR III PKS Nde I Bam HI Nde I Bam HI pet-22b + pet-22b + -PKSIII 5 pet-22b + -PKSIII III PKS SDS-PAGE 6 6 43 kda Ni-NTA 5 pet-22b + -PKSIII 3 6 SDS-PAGE Shiraia sp Slf14 III PKS III III
434 2015 PKS 7-9 8 J 2008 27 2 1-5 9 III J 2008 39 2 309-313 4 10 III J 2005 25 11 1601-1607 1 J 11 III 2003 25 184-188 J 2012 28 1 2 Deng Hong Xie Jie Zhao Jingquan Drug-delivery and 1-14 multifunction possibilities of hypocrellin photosensitizers 12 III J Journal of Innovative Optical Health Sciences 2015 8 1 1-13 3 Jiang Yuan Albert Wingnang Leung Wang Xinna et al Effect of photodynamic therapy with hypocrellin B on apoptosis adhesion and migration of cancer cells J International Journal of Radiation Biology 2014 90 7 575-579 4 J 2006 31 1 6-18 5 J 2012 37 9 655-661 6 J 2006 24 2 170-172 7 Li Jingni Luo Yunzi Lee Jung-Kul et al Cloning and characterization of a type III polyketide synthase from Aspergillusniger J Bioorganic & Medicinal Chemistry Letters 2011 21 6085-6089 J 2010 26 11 1482-1492 13 J 2014 38 1 14-18 14 J 2015 39 1 101-105 15 Frank Gross Nora Luniak Olena Perlova et al Bacterial type III polyketide synthases phylogenetic analysis and potential for the production of novel secondary metabolites by heterologous expression in pseudomonads J Arch Microbiol 2006 185 1 28-38 16 J 2014 24 5 1-4 The Prokaryotic Expression Purification and Bioinformatics of Type III Polyketide Synthase from Shiraia sp Slf14 Which Is an Endophytic Fungus of Huperzia serrata PENG Silu 1 YANG Huilin 1 2 LI Erhan 1 WANG Xiaolan 1 ZHU Du 1 2* 1 Key Lab of Protection and Utilization of Subtropic Plant Resources Jiangxi Normal University Nanchang Jiangxi 330022 China 2 Jiangxi Science & Technology Normal University Jiangxi Key Laboratory of Bioprocess Nanchang Jiangxi 330013 China Abstract The hypocrellins are a unique class of perylenequinones characterized by a pentacyclic conjugated chromophore giving rise to photoactivity One type III PKS gene was obtained from Shiraia sp Slf14 which is the key synthase in the product process of the hypocrellin The total RNA as the template to amplify the type III PKS fragment was used and then was cloned into pmd TM 19-T vector After identify type III PKS gene was ligated into pet- 22b + to obtain recombinant expressing vector pet-22b + -PKSIII The expression vector into Escherichia coli BL21 DE3 and cultured positive colonies of E coli in liquid LB medium were introduced Then the objective protein were obtained and isolated for purification using a Ni-NTA affinity chromatography It can lay the foundation for the catalytic activity of type III polyketide synthase Key words endophytic fungus polyketide synthase hypocrellin cloning and expression