Shiraia sp. Slf14 III

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Vol. 40 No Journal of Jiangxi Normal University Natural Science Nov ITS-rDNA. Acremonium sp. AChEI

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

Studies on purification and characteristics of glycosyltransferase from an engineering strain

Electronic Supplementary Information

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Supporting Information

30s 56 60s 72 60s dntp cm s s s 23

svari Real-time RT-PCR RSV

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

BL21 (D E3)2p E T28a ( + )2bgl 2

Vol. 39 No Journal of Jiangxi Normal University Natural Science Jan Western blot %. 40 kda

ER-Tree (Extended R*-Tree)

Cellular Physiology and Biochemistry

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Supporting Information

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Supporting Information

Acknowledgements... 3 Contents... I Figures... VII Tables... IX Abbreviations... X

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Τα αναλώσιμα μαζί με τα τεχνικά χαρακτηριστικά τους περιγράφονται αναλυτικά ανά ομάδα:

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Identification of Fish Species using DNA Method

Divergent synthesis of various iminocyclitols from D-ribose

Congruence Classes of Invertible Matrices of Order 3 over F 2

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...

The Free Internet Journal for Organic Chemistry

Vol. 31,No JOURNAL OF CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY Feb

Supporting Information. Experimental section

, DYY-8B, ; : Centrifuge 11 R. min

M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Heterobimetallic Pd-Sn Catalysis: Michael Addition. Reaction with C-, N-, O-, S- Nucleophiles and In-situ. Diagnostics

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

CorV CVAC. CorV TU317. 1

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Reading Order Detection for Text Layout Excluded by Image

HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1

Χαρακτηριςμόσ και δυναμική ζκφραςη του γονιδίου CYP450 τησ οικογζνειασ 71Α από την ελιά

Approximation Expressions for the Temperature Integral

YOU Wen-jie 1 2 JI Guo-li 1 YUAN Ming-shun 2

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

MSM Men who have Sex with Men HIV -

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

Nguyen Hien Trang* **

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

A/A Είδος Προδιαγραφές

Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating

Research Paper. glda. glda AT glda-wt. glda-4 pet- 32a + E. coli U / ml E. coli-wt U / ml 3 A Q814

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

Prey-Taxis Holling-Tanner

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Direct Palladium-Catalyzed Arylations of Aryl Bromides. with 2/9-Substituted Pyrimido[5,4-b]indolizines

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

A summation formula ramified with hypergeometric function and involving recurrence relation

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Science of Sericulture

Το κοινωνικό στίγμα της ψυχικής ασθένειας

High mobility group 1 HMG1

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

Quick algorithm f or computing core attribute

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

: Monte Carlo EM 313, Louis (1982) EM, EM Newton-Raphson, /. EM, 2 Monte Carlo EM Newton-Raphson, Monte Carlo EM, Monte Carlo EM, /. 3, Monte Carlo EM

Transcript:

39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp Slf14 III RT-PCR RNA pet-22b + -PKSIII Ni-NTA BL21 DE3 SDS-PAGE 43 kda III Q 979 85 A DOI 10 16357 /j cnki issn1000-5862 2015 04 19 0 6-10 III PKS Hypocrellins Shiraia sp Slf14 PKS 1-3 Polyketide synthase PKS PKS 11-15 Shiraia sp Slf14 Shiraia sp Slf14 4-5 > 98% NCBI AXZN00000000 1 3 Shiraia sp Slf14 3 I PKS modular III PKS RT-PCR II PKS iterative 2 KS α KS β 1 III PKS 2 PKS ACP 1 1 -CoA -CoA 1 1 1 E coli DH5α E coli BL21 2015-03-24 31460021 20142BAB214008 GJJ13211 YRD201408 1971-6-8

4 Shiraia sp Slf14 III 431 DE3 Shiraia sp Slf14 pet- 22b T-vector PMD19 simple TaKaRa 1 1 2 LB g L - 1 10 5 10 15 ph 7 0 121 20 min Shiraia sp Slf14 RNA DNA 1% RNA 1 1 3 KOD DNA RNAiso Plus T4 RNA - 20 RNA DNA PrimeScript TM reagent Kit with gdna Eraser QuickCut Nde I BamH I Not I PrimeScript cdna DNA Ladder Marker pmd TM 1 2 2 III PKS 19-T Vector Cloning Kit TaKaRa E Z N A cycle-pure kit Plasmid Mini Kit I Gel Extraction Kit OMEGA 1 1 4 PCR BIO- RAD UV-3900 50 μl 10 Buffer 5 0 μl dntps 2 5 mmol L - 1 4 0 μl pksiii-ndei-f pksiii-bamhi-6his-r 1 5 μl KOD-Plus-Neo 1 μl cdna 1 μl ddh 2 O Heraeus DYY-8C DNA 50 μl PCR 94 2 min 98 1 2 1 2 1 Shiraia sp Slf14 RNA cdna 1 DEPC 2-80 RNAiso Plus RNAiso Plus III PKS Primer 5 III PKS pksiii-ndei-f pksi- II-BamHI-6His-R 1 cdna III PKS NdeI BamHI 10 s 55 30 s 68 40 s 30 68 7 min 4 1% pksiii-ndei-f pksiii-bamhi-6his-r GGAATTCCATATGTCCCACGTGGCTAACAC CGCGGATCCTTAGTGGTGGTGGTGGTGGTGACCTGTTCGTACAGTGTGCCAG Gel Nde I Bam HI Extraction Kit PCR 1% pmd TM 19-T Vector Cloning Kit DNA 0 7 10 min T-vector pmd19 simple E coli 22 IPTG 1 mmol L - 1 22 DH5α PCR 200 rpm 8 h 50 ml 1 100 μl TaKaRa 4 8 000 rpm 1 2 3 III PKS 5 min 20 ml TE Nde I Bam HI 1 2 2 pet-22b + LB 37 200 rpm 2 h OD 600 Buffer 5 min 1 1 1% 4 Gel Extraction Kit PCR 10 ml Buffer A T4 DNA 20% 3 s 5 s 4 10 min 100 μl BL21 DE3 37 4 10 000 rpm 15 min SDS-PAGE Ni-NTA PCR 12% SDS-PAGE

432 2015 2 1 a Shiraia sp Slf14 III PKS 1 b 2 1 III PKS pmd19-t Nde I Bam HI 1 3 kb Shiraia sp Slf14 pmd19-t 2 RNA RT-PCR 1 3 kb 1 a pksiii-nde I-F pksiii-bam HI-6His-R RT-PCR 2 Nde I Bam HI b RT-PCR 2 2 III PKS 2 α β III α 3 β PKS 2 3 3 III PKS 4 3 III PKS

4 Shiraia sp Slf14 III 433 4 III PKS / 2 3 III PKS PCR III PKS Nde I Bam HI Nde I Bam HI pet-22b + pet-22b + -PKSIII 5 pet-22b + -PKSIII III PKS SDS-PAGE 6 6 43 kda Ni-NTA 5 pet-22b + -PKSIII 3 6 SDS-PAGE Shiraia sp Slf14 III PKS III III

434 2015 PKS 7-9 8 J 2008 27 2 1-5 9 III J 2008 39 2 309-313 4 10 III J 2005 25 11 1601-1607 1 J 11 III 2003 25 184-188 J 2012 28 1 2 Deng Hong Xie Jie Zhao Jingquan Drug-delivery and 1-14 multifunction possibilities of hypocrellin photosensitizers 12 III J Journal of Innovative Optical Health Sciences 2015 8 1 1-13 3 Jiang Yuan Albert Wingnang Leung Wang Xinna et al Effect of photodynamic therapy with hypocrellin B on apoptosis adhesion and migration of cancer cells J International Journal of Radiation Biology 2014 90 7 575-579 4 J 2006 31 1 6-18 5 J 2012 37 9 655-661 6 J 2006 24 2 170-172 7 Li Jingni Luo Yunzi Lee Jung-Kul et al Cloning and characterization of a type III polyketide synthase from Aspergillusniger J Bioorganic & Medicinal Chemistry Letters 2011 21 6085-6089 J 2010 26 11 1482-1492 13 J 2014 38 1 14-18 14 J 2015 39 1 101-105 15 Frank Gross Nora Luniak Olena Perlova et al Bacterial type III polyketide synthases phylogenetic analysis and potential for the production of novel secondary metabolites by heterologous expression in pseudomonads J Arch Microbiol 2006 185 1 28-38 16 J 2014 24 5 1-4 The Prokaryotic Expression Purification and Bioinformatics of Type III Polyketide Synthase from Shiraia sp Slf14 Which Is an Endophytic Fungus of Huperzia serrata PENG Silu 1 YANG Huilin 1 2 LI Erhan 1 WANG Xiaolan 1 ZHU Du 1 2* 1 Key Lab of Protection and Utilization of Subtropic Plant Resources Jiangxi Normal University Nanchang Jiangxi 330022 China 2 Jiangxi Science & Technology Normal University Jiangxi Key Laboratory of Bioprocess Nanchang Jiangxi 330013 China Abstract The hypocrellins are a unique class of perylenequinones characterized by a pentacyclic conjugated chromophore giving rise to photoactivity One type III PKS gene was obtained from Shiraia sp Slf14 which is the key synthase in the product process of the hypocrellin The total RNA as the template to amplify the type III PKS fragment was used and then was cloned into pmd TM 19-T vector After identify type III PKS gene was ligated into pet- 22b + to obtain recombinant expressing vector pet-22b + -PKSIII The expression vector into Escherichia coli BL21 DE3 and cultured positive colonies of E coli in liquid LB medium were introduced Then the objective protein were obtained and isolated for purification using a Ni-NTA affinity chromatography It can lay the foundation for the catalytic activity of type III polyketide synthase Key words endophytic fungus polyketide synthase hypocrellin cloning and expression