Chinese Journal of Biochemistry and Molecular Biology. sirna. PCR, 3 Corresponding author Tel : , E2mail

Σχετικά έγγραφα
Construction and Identification of Transforming Growth Factor-β1 shrna Expressing Vector

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Chinese Journal of Biochemistry and Molecular Biology RNA.

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

TGFp FSH INH INH

Cellular Physiology and Biochemistry

Research Paper. sirna. RNA small interfering RNA sirna hepatitis B virus HBV pmc. BESPX-MCS2. sirna. pmc-h1-sihbs-u6. E. coli ZYCY10P3S2T HBV

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

ER-Tree (Extended R*-Tree)

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC

30s 56 60s 72 60s dntp cm s s s 23

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

(bovine herpesvirus type 1, BHV1,. (infectious bovine rhinotracheitis, IBR) (infectious pustular vulvovaginitis, IPV) 3, 1.1, 1.2a 1.2b [5].

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

Chinese Bulletin of Life Sciences RNA RNA. Progress in RNA interference therapeutics. CHU Liang 1, LIU Xinyuan 1,2 *

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Shiraia sp. Slf14 III

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

PNS mg kg - 1. Rb 1

, DYY-8B, ; : Centrifuge 11 R. min

Chinese Journal of Biochemistry and Molecular Biology. psilencer 2. 0-FucT Ⅶ 2

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Electronic Supplementary Information

Supporting Information

Quick algorithm f or computing core attribute

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Advance in Nanorealgar Studies

svari Real-time RT-PCR RSV

High mobility group 1 HMG1

Identification of Fish Species using DNA Method

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

,,, (, ) , ;,,, ; -

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127

Science of Sericulture

Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Degradation of Dichlorvos by Rhodobacter sphaeroides

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

Angioarrestin( harp1) C FD

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

MUL TIL EVEL2USER2ORIENTED AGRICUL TURAL INFORMATION CLASSIFICATION

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Recombinant human interferon alpha 2b broad-spectrum anti-respiratory viruses pharmacodynamics study in vitro

Approximation Expressions for the Temperature Integral

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

15 1 Vol. 15 No Journal of Medical Postgraduates Feb (MIF) IgG IgM IgA PBMC. npcr (36. 5 % %, P < 0. 01) 84.

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening

The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis

Chinese Journal of Biochemistry and Molecular Biology PRV PCR. Detection of Pseudorabies Virus D NA by PCR. (No. 2 KM03507N),

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Congruence Classes of Invertible Matrices of Order 3 over F 2

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

Research on explaining porosity in carbonate reservoir by capture cross section method

Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1

Research on the Environmental Impact Factors of Electromagnetic Radiation from High - speed Railway

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Supplementary Information for

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

MSM Men who have Sex with Men HIV -

NIRF Can Significantly Inhibit the Expression of Hepatitis B Virus Antigens in vitro and in vivo

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

5 2TCA TCT GCC TCT GCT ACC TG23, 5 2

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Vol. 34 No Journal of South-Central University for Nationalities Nat. Sci. Edition Mar MTT 3 CVB 4 R373 A

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

Protective Effect of Surface Coatings on Concrete

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

Transcript:

ISSN 100727626 CN 1123870ΠQ 2005 6 Chinese Journal of Biochemistry and Molecular Biology 21 (3) :397 402 sirna SARS,,,,,,, 3,,,, ( 100071) sirna SARS, BJ01 SARS ( Pol) ( S), 4 sirna, sirna PCR, sirna SARS, Pol sirna (psoe) Vero BJ01 SARS RNA SARS SARS SARS, RNAi, sirna Q78,R373 Interference of SARS2CoV Replication by Small Interfering RNAs ZHAO Hui, CHEN Shui2Ping, DUAN Hong2Yuan, DENG Yong2Qiang, J IANG Tao, ZHAO Zhuo, YU Man, KANG Xiao2Ping, YANG Bao2An, LI Xiao2Yu, QIN Cheng2Feng, QIN E2De 3 ( State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and Epidemiology,Academy of Military Medical Sciences, Beijing 100071, China) Abstract To investigate interference of SARS2CoV replication in mammalian cells by small interfering RNAs (sirnas), sirna expression plasmids targeting the polymerase gene and the S gene of SARS2CoV were constructed Vero cells were stably transfected with these plasmids Clonal cell lines,psoa,psoe,pssk and psne were selected by growth in hygromycin B2containing media and characterized further by PCR analysis to determine the organization of plasmid DNA in the clonal cell lines Cell lines in which the plasmid DNA was correctly integrated into the genome were challenged with SARS2CoV BJ01 strain at a multiplicity of infection (MOI) of 0105 Cytopathic effect (CPE) of cells infected by SARS2CoV was observed every day At 3rd day, postchallenged cells which was no CPE were fixed in the slides and immunofluorescence assays ( IFA) were performed One of the clonal cell lines,psoe were resistant to SARS2CoV infection In addition, SARS2CoV RNA failed to accumulate in psoe by real2time quantitive PCR analysis Observations have showed that sirna (psoe) targeting polymerase gene could inhibit SARS2CoV RNA replication and protein expression in Vero cells These results suggested a feasibility of using RNAi to elucidate pathogenesis of SARS2CoV and that RNAi might represent a new approach for the treatment of SARS infection Key words SARS coronavirus, RNA interference, small interfering RNAs SARS (SARS coronavirus,sars2cov) ( severe acute respiratory syndrome,sars) RNA :2004208225 :2004209228 3, 5 3 (No 2003CB514119) 3 :Tel :010266948604,E2mail :qinede @sohu com :5 2 2S 2E 2M 2N 2 3 [1 ] SARS RNA, RNA RNA, RNA Received :August 25, 2004 ;Accepted :September 28, 2004 Supported by National High Technology 973 Project of China 2003CB514119) 3 Corresponding author Tel :010266948604, E2mail :qinede @sohu com ( NO 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

398 21 mrna RNA ; RNA ( RNeasy Mini Kit ) [2 ] QIAGEN ; (PCR) SARS, ; (Lipofectamine SARS RNA ( RNA interference,rnai) Invitrogen ; SARS RNAi SARS, ; FITC RNA(double2stranded RNA,dsRNA) IgG, sirna RNA 1 4 dsrna, RNA (RNA2inducing silencing complex,risc) sirna2 ( sirna2protein complex, sirnp) ATP sirna, AGTTGGGTA23 SARS Pol sirnp mrna PCR mrna [3,4 ],sirna (PCR) [5 8 ] 1 5 sirna,, SARS, RNAi, Pol S 5 UTR sirna 3 UTR ( RNA [9 ], ), sirna SARS sirna Ambion sirna, sirna sirna SARS BJ01 ( Pol) ( http :ΠΠwww ambion comπtechlibπmiscπsirna - design ( S) sirna html) sirna sirna, sirna BJ01 SARS 1 1 2, 24 h, 018 g sirna DNA sirna (psilencer TM hygro) 2 l Lipofectamine 2000, 24 h, Ambion Lipofectamine 2000 (psne) E coli DH5 1 7 LB (10 gπl 5 gπl 10 gπl NaCl,pH 710 100 gπml) 1 3 2000) (Opti2MEM ) B sirna PCR 5 2 TAATACGACTCACTATAGGG23 5 2AGGCGATTA, 3 : sirna TTCAAGAGA sirna 65 BamH Hind 1 1 SARS 2 DNA SARS BJ01 ( GenBank : psilencer sirna Fig 1 AY278488) SARS sirna Vero ( ) 10 % ( GIBCO ) 1 6 100 UΠml 100 UΠml DMEM Vero 24 (ph 712),1 10 5 Π 37,5 % CO 2 24 h Vero 10, 37, 5 % CO 2 24 h B ( 300 gπml), Vero Ex Taq DNA dntp TaKaRa, 150 gπml ; E coli DH5 B ; DNA, 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

3 :sirna SARS 399 DNA( 215 U 36 l 94 2 min, 35 : ) PCR PCR :10 94 30 s,55 45 s,72 1 min 72 7 Ex 5 l,215 mmolπl dntp 4 l,20 molπl min 1 l DNA 2 l, Ex Taq Fig 1 sirna target sites and its expression plasmid construction (A) Oa,Oe targeting polymerase gene and Sk targeting S gene were selected as sirna target sites ; (B) Map of psoe plasmid construction Complementary sequence are underlined 1 8 SARS BJ01 Vero 2 10 5 PFUΠml [10 ] 0105 MOI, 3, 37,5 % CO 2 95 % 1 h, 2 % 150 gπml B DMEM 1 1 ml 1 10 RNA PCR,, 24 h, 24 h (cytopathic effect,cpe) BSL2 RNA( 3 1 9 ( IFA) IgG, 3, [12 ] ) 9 d RNA 10 l 1 10 10 2 10 3 10 4 [ 11 ] RNA PCR SARS FITC 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

400 21 (PCR) 2 2 1 BJ01 SARS Pol S psoa psoe pssk sirna, DNA, sirna Vero B, 4 sirna :psoa psoe pssk psne,psne DNA PCR 526 bp Fig 2 PCR products of sirna expression plasmid integrated into the cellular genome M:100 bp DNA ladder ;C:Vero cell ; 1,2,3 and 4 represent four clonal cell lines (psne,psoa,psoe and pssk) respectively Vero ( Fig 2) sirna SARS ( Fig 4) 4, SARS Pol sirna (psoe) 2 2 sirna BJ01 SARS, psoa psoe pssk sirna (psoa) SARS SARS, psne S sirna(pssk) BJ01 psoa psoe pssk Pol psoe sirna, SARS 2 3 sirna BJ01 SARS 3 d sirna psoe,psoa pssk psne SARS,, 4 +, PCR SARS Pol psoe ( Fig SARS Pol 3) psoe,psoe Fig 3 CPE of cells infected by SARS2CoV at 3rd day (A) Normal Vero cells ; (B) infected Vero cells ; (C), (D), ( E) and (F) represent infected psne,psoe,psoa and pssk clonal cells, respectively 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

3 :sirna SARS 401 Fig 4 IFA of inhibition of SARS2CoV antigen in clonal cells by sirna at 3rd day (A) Negative control ; (B) Positive control ; (C) and (D) represent infected psne clonal cells and psoe clonal cells, respectively 5 7 d ( Fig 5), psoe psne 10-3 psne sirna SARS RNA 24 h,, Fig 5 Real time quantitive RT2PCR of inhibition of SARS2CoV replication by sirna psne ; psoe 3 psilencer RNA sirna SARS, U6 RNAi SARS S [14 ] RNA(shRNA) sirna S sirna sirna, sirna,, Pol SARS, pol [15 ] shrna RNA, SARS shrna sirna RNA, sirna, RNA, sirna, sirna Pol sirna (psoe) Vero BJ01 sirna, SARS RNA, RNA SARS sirna [9,13 ] sirna SARS, sirna SARS RNA, SARS Vero SARS,,siRNA [15 ] Vero SARS,,SARS, 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

402 21 RNAi,siRNA, sirna, sirna RNAi sirna SARS Pol (psoe) SARS RNA, 4 6 8 sirna, sirna, [5,7 ] sirna sirna SARS sirna SARS ( References) 5 Park W S,Miyano2Kurosaki N,Hayafune M,Nakajima E,Matsuzaki T, Shimada F, Takaku H Prevention of HIV21 infection in human peripheral blood mononuclear cells by specific RNA interference Nucleic Acids Res,2002,30(22) :4830 4835 6 McCaffrey A P, Nakai H, Pandey K, Huang Z, Salazar F H, Xu H, Wieland S F,Marion P L, Kay M A Inhibition of hepatitis B virus in mice by RNA interference Nat Biotechnol,2003,21(6) :639 644 7 Kapadia S B,Brideau2Andersen A,Chisari F V Interference of hepatitis C virus RNA replication by short interfering RNAs Proc Natl Acad Sci USA,2003,100(4) :2014 2018 8 McCaffrey A P,Meuse L,Pham T T,Conklin D S,Hannon GJ, Kay M A RNA interference in adult mice Nature,2002,418(6893) :38 39 9 Gitlin L, Karelsky S, Andino R Short interfering RNA confers intracellular antiviral immunity in human cells Nature, 2002, 418 (6896) :430 434 10 SARS BJ01 ( Yu Man, Peng Wen2Ming, Duan Hong2Yuan, Chang Guo2 Hui,Fan Bao2Chang,Deng Yong2Qiang,Liu Hong,Wei Yun2Ling, Zhu Qing2Yu,Qin E2de Development of plaque assay for SARS coronavirus BJ01 strain Med J Chin PLA),2003,28 (8) :701 702 11, SARS 1 Rota P A,Oberste M S,Monroe S S,Nix W A,Campagnoli R,Icenogle J (Si Bing2Yin, Yang Bao2An, Yu Man,Liu Hong, P,Penaranda S,Bankamp B,Maher K,Chen M H, Tong S, Tamin A, Lu Fu2Shuang, Han Wei2Guo, Zhang Yu,Shi Yu2Ling,Li lin2hai,qin Lowe L,Frace M,DeRisi J L,Chen Q,Wang D, Erdman D D,Peret T E2De,Zhu Qing2Yu Development of IFA method for detecting antibodies C,Burns C,Ksiazek T G,Rollin P E,Sanchez A,Liffick S,Holloway B, of SARS coronavirus Med J Chin PLA),2003,28(8) :699 700 Limor J,McCaustland K,Olsen2Rasmussen M, Fouchier R, Gunther S, 12 Adelman Z N,Sanchez2Vargas I,Travanty E A,Carlson J O,Beaty B J, Osterhaus A D,Drosten C,Pallansch M A,Anderson L J,Bellini W J Blair C D,Olson K E RNA silencing of dengue virus type 2 replication Characterization of a novel coronavirus associated with severe acute in transformed C6Π36 mosquito cells transcribing an inverted2repeat RNA respiratory syndrome Science,2003,300(5624) :1394 1399 derived from the virus genome J Virol,2002,76 (24) :12925 12933 2,, SARS 13 Brummelkamp T R,Bernards R,Agami R A system for stable expression RNA ( ) (Rui Wei,Zhang of short interfering RNAs in mammalian cells Science, 2002, 296 Qi2Peng, Shi Lei, Lu Ming, Jing Xia, Guo Qiang2Hua, Shang Tong (5567) :550 553 Analysis of coding region in RNA polymerase of SARS2CoV J Peking 14 Zhang Y,Li T, Fu L, Yu C,Li Y, Xu X,Wang Y,Ning H, Zhang S, Univ ( Heal Sci) ),2003,35( supplement) :137 138 Chen W, Babiuk L A, Chang Z Silencing SARS2CoV Spike protein 3 RNA ( RNAi) expression in cultured cells by RNA interference FEBS Lett,2004,560 ( Chen Zhong2Bin, Yu Yue2Cheng,Wang (123) :141 146 Sheng2Qi Recent Advances on the RNA Interference Chin J Biochem 15 SARS Mol Biol),2002,18 (5) :525 528 ( Wang Cheng2Zhong, QI Zheng2Wu The 4 Dykxhoorn D M,Novina C D,Sharp P A Killing the messenger : short biological characteristics of SARS virus and its related coronaviruses RNAs that silence gene expression Nat Rev Mol Cell Biol,2003,4 (6) : Acta Biochim Biophys Sin),2003,35(6) :495 502 457 467 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet