Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide

Σχετικά έγγραφα
Chinese Journal of Biochemistry and Molecular Biology. Effect of IL KAP on Tumorigenesis and Tumor Development

Screening, Expression and characterization of a Novel Protein Binding to Hepatitis B Surface Antigen

A Ne w Method of Separation and Bioactivity Assay of Flammulin

Chinese Journal of Biochemistry and Molecular Biology PGC-1 . PGC-1. PGC-1β PRC PGC-1 3

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

ER-Tree (Extended R*-Tree)

Cellular Physiology and Biochemistry

TGFp FSH INH INH

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Quick algorithm f or computing core attribute

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Chinese Journal of Biochemistry and Molecular Biology. p38mapk

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

Gene Expression and Biotoxicological Properties of Recombinant Human Brain Acetylcholinesterase

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

Approximation Expressions for the Temperature Integral

Advance in Nanorealgar Studies

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

,,, (, ) , ;,,, ; -

A System Dynamics Model on Multiple2Echelon Control

Congruence Classes of Invertible Matrices of Order 3 over F 2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Angioarrestin( harp1) C FD

Analysis on construction application of lager diameter pile foundation engineering in Guangdong coastal areas

A ne w method for spectral analysis of the potential field and conversion of derivative of gravity-anomalies : cosine transform

CorV CVAC. CorV TU317. 1

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Application of Statistical Process Control in Pretreatment Production Process of Gardenia jasminoides

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

PACS: Pj, Gg

. O 2 + 2H 2 O + 4e 4OH -

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1

,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

Construction and Identification of Transforming Growth Factor-β1 shrna Expressing Vector

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

ScFv-Fc. China Biotechnology ScFv PCR. ScFv-Fc. ppiczα. Fc 2 ScFv-Fc ScFv. ppiczα /Fc. protein A. PCR ELISA Western blotting

Construction and Evaluation of Lentiviral Vector pita-hbp1

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Optimization of fermentation process for achieving high product concentration high yield and high productivity

PNS mg kg - 1. Rb 1

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection

Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

High order interpolation function for surface contact problem

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

NIRF Can Significantly Inhibit the Expression of Hepatitis B Virus Antigens in vitro and in vivo

Shiraia sp. Slf14 III

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

No. 7 Modular Machine Tool & Automatic Manufacturing Technique. Jul TH166 TG659 A

Supplementary information:

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

Supporting Information

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Supporting Information

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Nguyen Hien Trang* **

Preparation and Characterization of a Novel Recombinant Imaging Agent Directing Thrombus

Application of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy

, DYY-8B, ; : Centrifuge 11 R. min

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Science of Sericulture

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Expression and Purification of HIV-1 Protease and the Establishment. of a Method for Protease Inhibitor Screening

# School of Pharmaceutical Sciences, Zhengzhou University, 100 Kexue Avenue, Zhengzhou, Henan , China.

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Apr Vol.26 No.2. Pure and Applied Mathematics O157.5 A (2010) (d(u)d(v)) α, 1, (1969-),,.

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

AH6 Western Blot Western Blot RIPA 90V 160V 100V 1.5 3%BSA 15 AH Prionics -Check WESTERN 100% 99.4% 100% 100% Western Blot

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

To whom correspondence should be addressed: Dr. Beat Schwaller, Unit of Anatomy,

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

High mobility group 1 HMG1

Transcript:

ISSN 100727626 CN 1123870ΠQ 2005 4 Chinese Journal of Biochemistry and Molecular Biology 21 (2) :282 286 3,, (, 100034) Secretion of Recombinant Proteins in Mammalian Cells Directed by Growth Hormone Signal Peptide ZHANG Zhi2Qian 3, LI Jin2Ping, HU Ying ( Department of Cell Biology, Peking University School of Oncology, Beijing Institute for Cancer Research, Beijing 100034, China) Abstract Signal peptide capable of efficiently directing many protein secretion in mammalian cells is one of the key elements in recombinant protein production, gene therapy and the development of DNA vaccines In order to explore the possibility of rat growth hormone signal peptide as such an element,a new vector based on the mammalian expression vector pcdna3 was constructed by employing rat growth hormone ( rgh) signal peptide as leading sequence,followed by multiple cloning sites,the myc epitope2tag and 6 his purification tag in the expression cassette The vector was validated by successfully expressing and secretion of chick MMP22 C2 terminal PEX domain,a potential angiogenesis inhibitor,and tandem peptide repeats of myc epitope2tag in COS2 7 cells These results suggest that rat growth hormone signal peptide is effective in the mediation of recombinant protein expression and secretion, and this vector provides a new tool for universal cloning and secretion of exogenous proteins in mammalian cells Key words rat growth hormone, signal peptide, secretion vector, mammalian cell R392,, [4 ] IgG [5 ] [6 ], [7 ] [8 ],, CHO COS [1 ] N, CHO COS : 2004210222, :2004212221 15 30, N ( No 30270658) ( No 7002009),,, 3 Tel :010266179250,E2mail :zqzhang @public3 bta net cn, [2,3 ] Received : October 22,2004 ;Accepted : December 21,2004 Supported by National Natural Science Foundation of China (No 30270658), Natural Science Foundation of Beijing Municipal (No 7002009),Beijing Key High2Technology Laboratory of Cancer Molecular Biology, and Chinese Medical Board Foundation, 3 Corresponding author Tel : 86210266179250 E2mail : zqzhang @public3 bta net cn 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

2 : 283, MEM), Lipofectamine [9 ], ( GIBCOΠBRL), 114 2 % ΠPBS 3 min,0 5 % Triton X2100ΠPBS 3, 10 min Myc10 9E10 (1 10 ) ( MMP22 C PEX, ) 37 1 h,0 5 % Triton X2100ΠPBS 3, 10 min, 1 111 COS27 12 %SDS2PAGE, ATCC, Vent DNA PVDF (Milipore) 5 % ΠTTBS New England Biolabs ; T4 DNA 1 h,ttbs, Myc10 Promega 9E10 (1 1000 ) 1 h, GIBCO/ BRL TTBS, HRP (1 Sigma 112 RT2PCR 1 h, TTBS, ECL RT2PCR 11 2 (rgh) MMP22 C PEX : :5 2 211 GGCAAGCTT ( Hind ) ACAGATCACTGAGTGG23 : 5 2AGAGGATCCT ( BamH ) GGACAAGGGCATG2 3 ; MMP22 C PEX : :5 2CGGATCC ( BamH ) TCTGCAAGCACG23, :5 2CCTCTAGA ( Xba ) GCAAGTCCTCTTCAGAAATCAGTTTTTGCT CGAG( Xho ) GCAACCCAACCAGTC (Fig 1), PEX PCR, rgh PEX PCR rgh PEX, PEX N rgh 5 2CTGGGCCC ( Apa ) TAATGATGATGATGATGATGTCTAGA ( Xba ) CAAGT CCTCTTCAG23 C PCR Myc 6 His, Hind Apa,T4 DNA pcdna310 ( Invitrogen ) DH5, 212, Tip2500 (Qiagen ) 113 (Jackson ImmunoResearch Laboratories) 37 1 h, 0 5 % Triton X2100ΠPBS,,Olympus BH22,Kodak Tmax2400 115 Western 80 000 ) (Jackson ImmunoResearch Laboratories) (Amersham ),, PEX pmyc2n MycPEX/ pcdna3, COS27, 24 h 48 h Myc 9E10, MGC2803 ( ), DNA PEX,, 48 h COS27,SDS2PAGE, Myc Western COS27 ( 10 %, Fig 2 rghpexmychisπpcdna 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

284 21 Fig 1 Immunofluorescent staining of Myc/ PEX to demonstrate the localization of expressed PEX in transfected COS27 cells (A) MycPEXΠpcDNA3 ; (B) rghpex/ pcdna3 Bar :20 m Fig 2 Western blot analysis of COS2culture supernatants 48 hours after transient transfection probed with Myc antibody 1 rghpexmychisπpcdna ;2 E coliexpressed PEX as positive control ; 3 MycPEXΠpcDNA without signal peptide PEX 15 l Myc 26 kd, prghsecmychis(fig 3) Myc PEX ( Myc, MycPEXΠpcDNA ) prghsecmychis, COS27,, Western 48 h 213 Myc 6 Myc His (Fig 4), Fig 3 Multiple cloning sequence of the eukaryotic secretion expression vector prghsecmychis To construct prghsecmychis,this sequence replaced the multiple cloning sites between Hind and Apa of pcdna3 Arrow :signal peptide cleavage site 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

2 : 285 Fig 4 Western blot result of (Myc) nπprghsecmychis transfected COS27 culture medium probed with 9E10 Myc antibody Fifteen microliters of culture supernatants were loaded in each lane 1 untransfected cell supernatants ; 2 (Myc) nπprghsecmychis transfected cell supernatants, 3 PcDNA3, prghsecmychis,, CMV SV40 ( SV40 T COS27 ) Neomycin prghsecmychis, [5,8 ],, ( References),,Li [9 ],, MMP22 C PEX Myc,,,, lgg PEX [10,11 ] MMP22,PEX [10 ], COS27,,, PEX PEX,,,, 6 His, Ni2NTA PEX ( ) prghsecmychis Myc 6 His, 1 Yan S C B, Grinnell W, Wold F Post2translational modifications of proteins :some problems left to solve Trends Biol Sci,1989,14 :264 2 Von Heijne G Patterns of amino acids near signal2sequence cleavage sites Eur J Biochem,1983,133 :17 21 3 Perlman D,Halvororson H O A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides J Mol Biol, 1983,167 :391 409 4 Schmidt F R Recombinant expression systems in the pharmaceutical industry Applied Microbiol Biotechnol,2004,65(4) :363 372 5 Coloma M J,Hastings A,Wims L A,Morrison S L Novel vectors for the expression of antibody molecules using variable regions generated by polymerase chain reaction J Immunol Methods,1992,152 :89 104 6 Chubet R G,Brizzard B L Vectors for expression and secretion of FLAG epitope2tagged proteins in mammalian cells BioTechniques,1996,20 : 136 141 7 Herrera A M, Musacchio A, Fernandez J R, Duarte C Efficiency of erythropoietin s signal peptide for HIV mm 21 gp120 expression Biochem Biophys Res Commun,2000,273 :557 559 8 Liu Y C, Kawagishi M,Mikayama T,Inagaki Y,Takeuchi T,Ohashi H Processing of a fusion protein by endoprotease in COS21 cells for secretion of mature peptide by using a chimeric expression vector Proc Natl Acad Sci USA,1993,90 :8957 8961 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet

286 21 9 Li Y,Luo L,Rasool N,Wagner R R,Kang C Y Viral liposomes released from insect cells infected with recombinant baculovirus expressing the matrix protein of vesicular stomatitis virus J Virol,1993,7 :584 588 10 Brooks P C,Silletti S,von Schalscha T L,Friedlander M,Cheresh D A Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with integrin binding activity Cell,1998,92(3) :391 400 11,,,,, 22C PEX (Li Jin2Ping, Zhang Guang2Mou,Ke Yang,Lin Ben2Yao,Zhao Wei,Hu Ying,Ning Tao,Lin Zhong2Xiang, Zhang Zhi2Qian Prokaryotic expression of PEX: a C2 terminal fragment of matrix metalloproteinase 2 and its effect on the inhibition of angiogenesis Prog Biochem Biophys),2002,29 (1) :120 123 The Fifth Editorial Board of Chinese Journal of Biochemistry and Molecular Biology (Advisors) ZHENGJi ZHANG Chang2Ying ZOU Cheng2Lu(Chen2lu TSOU) ( Editor2in2Chief) J IA Hong2Ti ( Associate Editors2in2Chief) CHANG Zeng2Yi SUN Zhi2Xian YANG Fu2Yu (Members of the Board,alphabetically) CHANG Zeng2Yi GU Jun HUANGLi J IAO Bing2Hua LI Bo2Liang LI Gui2Yuan LI Zai2Ping LIN Qi2Shui LIU Guo2Qin PENGJing2Pian QU Liang2Hu RUAN Kang2Cheng SUN Zhi2Xian WANG Zhi2Zhen XU Gen2Jun YANG Xiao2Ming YE Qi2Nong ZHANGJin ZHANG Yi ZHOU Jun2Mei ZHU Yu2Xian (Specially Invited Members of the Board) Ray WU(USA) LI Lin WANGLin2Fang ZHA Xi2Liang CHEN Qing2Xi HANG Hai2Ying J IA Hong2Ti KE Yang LI Gang LI Lin LIANG Ai2Hua LIU De2Fu LIU Jin2yuan QIAN Guan2Xiang RAO Zi2He SHANG Yong2Feng WANGJia2Xi WEI Qun YANG Fu2Yu YAO Li2Bo YUAN Qin2Sheng ZHANG Nai2Heng ZHOU Chun2Yan ZHU Da2Hai Robert K YU(USA) SHANG Yong2Feng WANG Zhi2Zhen GENG Yun2Qi HE Rong2Qiao J IANG Cheng2Yu J IN You2Xin LI Gen2Xi LI Ning LIANG Song2Ping LIU De2Pei MIAO Shi2Ying QIANG Bo2Qin SHI Yun2Yu SHOU Cheng2Chao WANGLin2Fang WEN Jin2Kun YANG Ke2Gong YAO Ren2Jie ZHA Xi2Liang ZHANG Xu2Jia ZHOU Hai2Meng ZHU Wei2Guo 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet