ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :165 171 MAGE2D1, (, 100850) 3 MAGE2D1 (MAGE) MAGE2D, Northern blot Dot blot, 48,, 13, 7 MAGE2A 2B 2C Π, MAGE2D MAGE2D1, MAGE, Q34311 Tissue Expression Profile of Human MAGE2D1, the Ne w Member of Melanoma Antigen2encoding Gene Family ZHANG Cheng2gang, HE Fu2chu 3 ( Beijing Institute of Radiation Medicine, Academy of Military Medical Sciences, Beijing 100850, China) Abstract Members of MAGE(melanoma antigen2encoding gene) family are expressed in a wide variety of tu2 mors but not in normal cells, with the exception of the male germ cells, placenta, and possibly, cells of the developing fetus However, the discovery of MAGE2D1 has broken this discipline since it is ubiquitously ex2 pressed in normal tissues rather than strictly in cancerπtestis Moreover, the knowledge about the MAGE2D1 gene is far from being understood The tissue expression profile of human MAGE2D1 using Northern blot and Multiple2Tissue2RNA Dot blot techniques were reported The results demonstrated that human MAGE2D1 was extensively expressed in cancer cell lines and ubiquitously expressed in many normal tissues In forty2eight kinds of tumors detected, expression of human MAGE2D1 were significantly up2regulated in thirteen and down2 regulated in seven, implicating potential diagnostic value of MAGE2D1 in clinical application Moreover, the expression level of MAGE2D1 in fetal tissues was higher than that in adult ones However, although MAGE2D1 does not encode a tumor2special antigen, the biological function of MAGE2D1 and the relationship with tumor need much more pathological study Key words melanoma antigen2encoding gene, expression profile, tumor :2001206211, :2001208223 (No 9905105) (No 39900041, 39900074) (No 39730310) 863 (8632102210204204) 3 Tel : (010) 66931246, Fax : (010) 68214653, E2mail : hefc @nic bmi ac cn (1970 9),, Received :June 11,2001 ;Accepted :August 23,2001 Partially supported by Initiative Foundation for Scientific and Technological Innovation of Academic Military Medical Science (No 9905105), Chinese National Natural Science Foundation General Program (No 39900041, 39900074) and Key Project (No 39730310),Chinese High2tech Program (8632102210204204) 3 Corresponding author Tel : (010) 66931246, Fax : (010) 68214653, E2mail : hefc @nic bmi ac cn
166 18, PD2Quest, MAGE, BAGE, GAGA, LAGE21, NY2ESO21, PAGE PRAME [1 11 ] 2 Π, [12,13 ] T, 211 MAGE2D1, MAGE2D1 ( Melanoma antigen2encoding gene, MAGE) MAGE 3 Northern,, A 12,B 6 MAGE2D1 MOLT24 ( ), G2361,C 3 3 ( ), SW480 ( ) A549 ( ) Xq28 Xp21 Xq26227 [5-7 ] Pold [14 ] Salehi [15 ] MAGE2D1 ( NRAGE), MAGE2 D, RACE MAGE2D1 cdna [16 ], North2 ern MAGE2D1, 48, 13, 7, MAGE2D1 MAGE 1 111 Northern 7 Northern 8, Northern CLONTECH p70,, ( 5 2CCCTCGAGATGCCTCCAGACTGGCAAGG23 ) p71 (5 2GCTCTAGATCACTCAACCCAGAAG23 ) MA2 GE2D1 cdna 1 174 bp,112 % ( PROMEGA) Northern - 70,2 d, [17 ImageJ (NIH) ] 112 RNA RNA CLONTECH, MAGE2D1 Π RNA BIOCHAIN, MAGE2D1 48-70,2 d (BIO2RAD),, HL60 ( ), K2562 ( ) HeLa S3 ( ) (Fig 1) Fig1 Expression profile of human MAGE2D1 in seven kinds of tumor cell line 212 MAGE2D1 Northern, MAGE2D1 (Fig 2) Fig 2 Expression profile of human MAGE2D1 in eight kinds of normal tissues
2 : MAGE2D1 167 213 MAGE2D1 RNA MAGE2D1 Northern MAGE2D1 ( Fig, 3) (Table 1, part ), MAGE2D1, Table 1 Fig 3 Expression profile of human MAGE2D1 in multiple tissues using Dot blot technique Table 1 Expression of human MAGE - D1 in 68 kinds of normal tissues and 8 kinds of tumor cell lines Tissue Tissue Part I Cancer cell lines Cerebral cortex 1 55 MOLT24 (leukemia) 2 26 Placenta 1 47 A549 (lung carcinoma) 1 80 Whole brain 1 47 Raji (Burkitt s lymphoma) 0 96 Mammary gland 1 40 HL60 (leukemia) 0 41 Uterus 1 28 K2562 (leukemia) 0 31 Atrium, right 1 25 HeLa S3 (uterine cervix carcinoma) 0 29 Ovary 1 20 SW480 (colorectal adenocarcinoma) 0 16 Salivary gland 1 15 Daudi (Burkitt s lymphoma) 0 32 colon, descending 1 13 rectum 1 13 Part II Normal fetal tissues Ventricle, left 1 11 Fetal brain 2 07 Atrium, left 1 06 Fetal liver 1 87 Duodenum 0 98 Fetal lung 1 75 Substantia nigra 0 98 Fetal kidney 1 30 Testis 0 96 Fetal heart 1 12 Bladder 0 94 Fetal thymus 1 07 Cerebellum, right 0 94 Fetal spleen 0 95 Thymus 0 91 Appendix 0 88 Part III Normal adult tissues Ileum 0 87 Hippocampus 3 85 Apex of the heart 0 82 Amygdala 3 46 Corpus callosum 0 80 Temporal lobe 3 26 Colon, transverse 0 74 Thalamus 2 96 Ileocecum 0 71
168 18 Table 1(continued) Tissue Tissue Pons 2 82 Spleen 0 68 Paracentral gyrus of cerebral cortex 2 81 Ventricle, right 0 63 Caudate nucleus 2 79 Jejunum 0 57 Spinal cord 2 79 Kidney 0 53 Occipital lobe 2 76 Skeletal muscle 0 51 Pituitary gland 2 58 Stomach 0 47 Putamen 2 45 Esophagus 0 40 Frontal lobe 2 42 Pancreas 0 38 Adrenal gland 2 06 Cerebellum, left 0 35 Thyroid gland 2 04 Lymph node 0 34 Aorta 1 95 Lung 0 32 Medulla oblongata 1 92 Inter2ventricular septum 0 29 Accumbens nucleus 1 84 Liver 0 29 Colon, ascending 1 65 Heart 0 26 Trachea 1 64 Bone marrow 0 17 Parietal lobe 1 63 Peripheral blood leukocyte 0 17 Prostate 1 61 (Table 1, part part ), MAGE2D1, 7, MAGE2D1, MAGE2D1 2 6 (Fig 4) 214 MAGE2D1 48 RNA MA2 GE2D1, MAGE2D1 20 (Fig1 5) Fig 4 Comparison of human MAGE2D1 transcription in seven tissues between fetal and adult stage, MAGE2D1 13 The asterisks( 3 ) indicated that the expression level of human MA2 : ( ) GE2D1 was down2regulated about two to six times in adult stage than ( ) that in fetal stage Fig 5 Comparison of human MAGE2D1 expression between 48 kinds of tumor tissues and corresponding normal ones In each pair of the column,the tumor tissue is in the left, while the normal tissue in right
2 : MAGE2D1 169, ( Table ( ) ( Table 2, 2, ) 28, MA2 ), 7, GE2D1 (Table 2) Table 2 Comparison of human MAGE2D1 expression between 48 kinds of tumor tissues and corresponding normal ones Normal tissue Malignant tissue Trend in carcinogenesis Brain 0 21 Astrocytoma, grade I 0 41 Malignant meningioma 0 10 Neurilemmoma 0 15 Parotid 2 01 Pleomorphic adenoma 2 78 Thyroid 2 25 Nodular goiter of thyroid 2 88 Papillary adenocarcinoma 3 55 Follicular adenoma 0 93 Pancreas 0 36 Adenocarcinoma 0 51 Adrenal 0 41 Neuroendocrinic carcinoma 0 98 Prostate 0 36 Hyperplasia 1 29 Breast 2 04 Invasive ductal carcinoma 0 31 Fibroadenoma 2 47 Lung 0 45 Poorly differentiated squamous cell carcinoma 0 10 Moderately differentiated squamous cell carcinoma 0 67 Bronchi2alveolar carcinoma 0 77 Poorly differentiated adenocarcinoma 0 31 Moderately differentiated adenocarcinoma 0 57 Throat 0 21 Squamous cell carcinoma 0 15 Esophagus 0 18 Poorly differentiated squamous cell carcinoma 0 72 Moderately differentiated adenocarcinoma 0 93 Moderately differentiated squamous cell carcinoma 0 26 Stomach 1 66 Single ring cell carcinoma 4 07 Poorly differentiated adenocarcinoma 0 93 Moderately differentiated adenocarcinoma 2 01 Well differentiated adenocarcinoma 1 13 Liver 0 18 Poorly differentiated hepatocellular carcinoma 0 10 Moderately differentiated hepatocellular carcinoma 0 Gallbladder 3 30 Well differentiated squamous cell carcinoma 1 91 Duodenum 0 62 Adenocarcinoma 0 10 Small intestine 2 52 Malignant mesothelioma 0 15 Colon 0 44 Poorly differentiated adenocarcinoma 1 08 Well differentiated adenocarcinoma 0 98 Rectum 0 05 Poorly differentiated adenocarcinoma 0 26 Moderately differentiated adenocarcinoma 0 36 Kidney 0 15 Clear cell carcinoma 1 96 Granular cell carcinoma 0 31 Bladder 0 64 Transitional cell carcinoma, grade II 1 75 Transitional cell carcinoma, grade III 0 21 Testis 1 24 Seminoma 1 24 Ovary 3 21 Mucous cystadenocarcinoma 0 15 Thecoma 0 26 Teratoma 3 14
170 18 Table 2(continued) Normal tissues Malignant tissues Trend in carcinogenesis Uterus 0 15 Leiomyoma 1 80 Adenocarcinoma 0 21 Thymus 0 31 Thymoma 0 57 Lymph node 0 26 Lymphoma of tonsil 0 51 Non2Hodgkin s lymphoma 0 21 Soft tissue 0 15 Malignant fibrous histocytoma 0 26 Note : the arrows and represent the expression of human MAGE2D1 in tumor tissues up2regulated or down2regulated compared with normal tissues respectively 3 Northern RNA MAGE2D1 MAGE2D1,, ( References), 1, MAGE2D1ΠNRAGE MA2 GE2D Trophinin MAGE2D4 MAGE2D, MAGE2A 2B 2C, Xp111212p11123, 3, MAGE2A 2B 2C 3 [18 ],MAGE2 A 2B 2C Π, MAGE2D,, MAGE2D1, MAGE2D1, MAGE2D1,,, MAGE2D1,,, 1995, 2 :167 175, MAGE2D1, MAGE2D1 MAGE2D1, MAGE van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, van den Eynde B, Knuth A, Boon T A gene encoding an antigen rec2 ognized by cytolytic T lymphocytes on a human melanoma Science, 1991, 254 :1643 1647 2 van den Eynde B, van der Bruggen P T cell tumor antigens Curr Opin Immunol 1997, 9 :684 693 van den Eynde B, Boon T Tumor antigens recognized by T lympho2 cytes Int J Clin Lab Res, 1997, 27 :81 86 4 De Plaen E, Arden K, Traversari C, Gaforio J J, Szikora J P, De Smet C, Brasseur F, van der Bruggen P, Lethe B, Lurquin C Structure, chromosomal localization, and expression of 12 genes of the MAGEfami2 ly Immunogenetics, 1994, 40 :360 369 5 Rogner U C, Wilke K, Steck E, Korn B, Poustka A The melanoma antigen gene ( MAGE) family is clustered in the chromosomal band Xq28 Genomics, 1995, 29 :725 731 6 Muscatelli F, Walker A P, De Plaen E, Stafford A N, Monaco A P Isolation and characterization of a MAGE gene family in the Xp21 3 re2 gion Proc Natl Acad Sci USA, 1995, 92 :4987 4991 7 Lucas S, De Smet C, Arden K C, Viars C S, Lethe B, Lurquin C, Boon T Identification of a new MAGE gene with tumor - specific ex2 pression by representational difference analysis Cancer Res, 1998, 58 : 743 752 8 Boel P, Wildmann C, Sensi ML, Brasseur R, Renauld J C, Coulie P, Boon T, van der Bruggen P BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes Immunity, 9 van den Eynde B, Peeters O, De Backer O, Gaugler B, Lucas S, Boon T A new family of genes coding for an antigen recognized by autologous cytolytic T lymphocytes on a human melanoma J Exp Med, 1995, 182 :689 698 10 Lethe B, Lucas S, Michaux L, De Smet C, Godelaine D, Serrano A, De Plaen E, Boon T LAGE21, a new gene with tumor specificity Int
2 : MAGE2D1 171 J Cancer, 1998, 76 :903 908 11 Chen M E, Lin S H, Chung L W, Sikes R A Isolation and character2 ization of PAGE21 and GAGE27 New genes expressed in the LNCaP prostate cancer progression model that share homology with melanoma2 associated antigens J Biol Chem, 1998, 273 :17618 17625 12 Romero P Cytolytic T lymphocye responses of cancer patiens to tumor2 associated antigens Spring Semin Immunopathology, 1996, 18 :185 198 13 van Baren N, Brasseur F, Godelaine D, Hames G, Ferrant A, Leh2 mann F, Andre M, Ravoet C, Doyen C, Spagnoli G C, Bakkus M, Thielemans K, Boon T Genes encoding tumor - specific antigens are expressed in human myeloma cells Blood, 1999, 94 :1156 1164 14 Pold M, Zhou J, Chen GL, Hall J M, Vescio R A, Berenson, J R Identification of a new, unorthodox member of the MAGE gene family Genomics, 1999, 59 :161 167 15 Salehi A H, Roux P P, Kubu CJ, Zeindler C, Bhakar A, Tannis L L, Verdi J M, Barker P A NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor - dependent apoptosis Neuron, 2000, 27 :279 288 16,,, RACE MAGE2D1 ( Xing Gui2chun, Zhang Cheng2gang, Wei Han2dong, He Fu2chu Full2length cloning of human melanoma antigen2encoding gene D1 using rapid amplification of cdna ends technique Chin J Biochem Mol Biol),2001, 17 (2) :203 208 17,,,, ImageJ (Zhang Cheng2gang, Yuan Shou2jun, Deng Mei2yu, Li Lin, Tang Zhong2ming, He Fu2chu A simple method for semi2quantitative image analysis of dot and band signal image Chin J Stereol Image Anal), 2001,4(3) :167 170 18,,,, X ( Zhang Cheng2gang, Xing Gui2chun, Wei Han2dong, Yu Yong2tao, He Fu2chu A new mel2 anoma antigen2encoding gene subfamily in human chromosome X Acta Genet Sin), 2001, 28 (3) :197 203 2002 2002,, : 11 : ; ; ; ;DNA ;PCR ;NDA ;Southern ; ; DNA ; RNA ; ;DNA, 21 31 : 1600, 41 15, 7 21, ( ) 7 1 : 100875 ; (010) 62208197 ; E2mail :whlpost @263 net ( )