( Hepatitis B virus, HBV)

23 4 2 0 0 7 7 CHIN ESE JOU RNAL OF VIROLO GY Vol. 23 No. 4 J uly 2007 S1 1, 1, 1, 2, 1, 1, 1 (11, 361005 ; 21, 102200) : HBV DNA HBV (S1 ), HBV (NRAg) EL ISA, 10 312 / ml (95 %10 2122412 / ml),s1 994 HBsAg NRAg EL ISA 9917 % (95 %: 9911 % 9919 %) 271, NRAg EL ISA HBV DNA 9613 % (95 %:9313 %9812 %),NRAg EL ISA / ( S/ CO) HBV NRAg,1 HBsAga HBV NRAg EL ISA HBV DNA, HBsAg, HBsAg, HBV DNA : ; ; :R37312 :A :100028721 (2007) 0420252206 ( Hepatitis B virus, HBV),, ( HBsAg)a HBsAg, [1,2 ],, [3,4 ] HB2 sag, 1 HBV S1 AA21247 7 H11, 4D11,HBcAg GA CZ, 2 ( HRP), 4D11 CZ HRP [10 ] HBV,S1 3 ELISA HBV S1 HBcAg ( HBcAg) HBV DNA [529 ] 0102mol/ L ( PB,p H714) 7 H11, (S1 ) GA ( HBcAg) 1g/ ml, S1 HBcAg HBV (Nu2 100 l/ 96,4 ; PBST cleic acids related antigen, N RAg) 1,200 l / ( 20 %,10 % :2006210217 ; :2007204219 : 863 ( 2006AA02Z442), (2004 YZ0121),(3502Z20041008), : (1982 2 ),,, Tel :862 59222184113 ; E2mail : yuanquan @xmu1edu1cn : ( E2mail : nsxia @xmu1edu1cn) ( EL ISA), HBV PCR, HB2 sag, HBsAg, HBV DNA PBS ) 37 2h,,4, 50 l ;50 l,,37 60min ; PBST 5, 100 l 1 1 000 4D112 HRP (S1 ) CZ2HRP( HBcAg),37 30min ; PBST 5, TMB,37 15min,, OD450/ 620nm

4 :S1 253 4 ELISA HBV S1 HBcAg ( NRAg ELISA) 0102mol/ L (PB,p H714) 7 H11 GA 1g/ ml,100 l/ 96,4 ; PBST 1,200 l/ ( 20 %,011 %Casin 10 %PBS ) 37 2h,,4, 50 l ;50 l,,37 60min ;PBST 5,100 l 4D112HRP/ CZ2HRP (1 1 000 ),37 30min ; PBST 5, TMB,37 15min,, OD450/ 620nm 5 271 (215 ) (56 ),994 HBsAg ( ) 6 HBV DNA HBV FQ2 PCR ( ) ( PCR A) (PCR B), PCR A, PCR B, C S PCR PCR : DNA K, PCR,PCR 95 10min,95 40s,55 40s,72 40s,35 (25 ),72 10min C cf1 : 5 2CACCTCTGCCTAATCATCTC 23 cr1 :5 2 ATGCTCAGGAGACTCTAAGG23, cf2 :5 2ACTGT2 TCAAGCCTCCAAG CT23 cr2 : 5 2AAGGAAAGAAGT2 CAGAAGGC23 [11] ;S af1 : 5 2GTCT GCGGCGTTT2 TATC23aR1 :5 2ACAGTGGGGGAAAGC23, af2 : 5 2TGCC CGTTTGTCCTCTA23 ar2 :5 2AGA AACGGRCT2 GAGGC23 7 HBsAg EL ISA ( ), HBeAg HBeAb HBsAg,, HBV S1 () (S1 1 S20020072) (S1 2, S2000062), 8 Taq DNA dn TP Promega PCR Biometra T3, PCR Rotorgene3000, Tecan Sunrise Sigma 1 HBV NRAg EL ISA HBV S1 EL ISA HBcAg EL ISA 1 ELISA HBV DNA( + ) ELISA,8 HBV DNA (P1P8) 30 HBV DNA HBsAg HBV NRAg ELISA HBV S1 ELISA HBcAg ELISA ( ),P1P8 S1 HBV NRAg ELISA HBV S1 ELISA HBcAg ELISA OD 0103, OD 310 0112 + Nc( ) (CO), HBV NRAg ELISA HBV S1 ELISA HB2 cag ELISA NRAg > S1 > HBcAg, ( GMT) 1 6 098 1 1 8101 320, ( P < 0101) ( 1) S1 1 2 1 :269 1 2S1 2,NRAgS1 HBcAg S1 1 23 7 1 1NRAg ELISA 10 312 / ml (95 %10 212 10 412 / ml) Table 1 Comparison of several EL ISA reagents in lesting sera with HBV viremia HBV positive serum P1 P2 P3 P4 P5 P6 P7 P8 GM T SD HBV genome copies HBV EL ISA2titer 1 NRAg Pre S1 HBcAg PreS1 test 1 PreS1 test 2 215 10 7 5120 1280 640 320 10 210 10 7 10240 2560 640 320 1 119 10 7 10240 2560 320 320 1 117 10 7 10240 2560 320 320 1 912 10 6 10240 2560 320 640 10 218 10 6 5120 1280 160 320 1 112 10 7 1280 640 320 80 Neg 114 10 6 5120 2560 160 160 1 91 6 10 6 21 8 6089 20 1810 17 320 17 269 18 2 5 Note : Pres1 test 1 and Pres1 test 2 used two kinds ofcommercial EL ISA reagent s.

254 23 2 HBV NRAg EL ISA 994 HBsAg HBV N RAg EL ISA (1) 3, HBV NRAg EL ISA 9917 %(95 %:9911 %9919 %) (980, 9816 %) OD 0105, OD 01016 01015 DNA, NRAg ELISA S/ CO HBV ( 2) 1 HBV NRAg EL ISA HBsAg OD Figure 1 OD value distribution of HBV NRAg EL ISA in lesting HBsAg negative sera 3 HBV D NA( + ) NRAg 271 HBV DNA PCR A,227 ; PCR B, 3 ;HBV DNA PCR 2 HBV NRAg EL ISA S/ CO HBV DNA Figure 2 The relativity of HBV genome copies with S/ CO values in HBV NRAg EL ISA 4 HBV NRAg 2 HBV HBV DNA NRAg HBeAg HBeAb,HBV DNA(γ)NRAg ( P > 0105) HBeAg (Ο) HBeAb (Ο)NRAg 9312 %, HBV DNA(γ),1 231 HBV DNA NRAg 100 % HBV DNA(Ο) HBV 917 10 8 / ml,,17 HBsAg (γ) HBeAg (Ο) 6 200 / ml, 113 10 6 / ml HBeAb(γ) 5 NRAg (γ),11 HBeAb (Ο) 231 HBV DNA (γ),nrag 227, 9813 % (95 %: 9516 %9915 %), PCR A PCR A 4 NRAg, NRAg 4 HBV DNA,1 4 700 / ml, 3 500 / ml NRAg (Ο),(Fisher P < 01001) (2) 271,NRAg HBV DNA 9613 %(95 %:9313 % 9812 %), 9813 %(95 %:9516 % 9915 %), 8510 % (95 %:7012 % 9413 %) (3) NRAg ELISA S/ CO 2 HBV NRAg Table 2 NRAg positive rate in chronic hepatitis patients with different models of HBV infection marker Model of HBV marker Mean genome NRAg n DNA HBsAg HBeAg HBeAb copies per ml (γ) % γ γ γ Ο 113 111 10 7 912 113 100 γ γ γ γ 3 41 4 10 6 101 9 3 Ο γ γ Ο Ο 44 11 0 10 5 521 9 41 931 2 γ γ Ο γ 69 11 1 10 5 671 7 69 100 γ Ο γ Ο 1 81 3 10 4 1 Ο γ Ο Ο Ο 1 21 0 10 2 0 0 Subtotal 231 11 3 10 6 491 8 227 981 3 Ο γ Ο γ 6 5 831 3 Ο γ Ο Ο 11 0 0 Ο Ο 23 1 41 3 Subtotal 40 6

4 :S1 255 3 HBV NRAg ELISA HBV DNA Table 3 Consistence of the results when detection using HBV DNA HBV NRAg EL ISA and HBV DNA HBV NRAg EL ISA γ Ο Total γ 227 4 231 Ο 6 34 40 Total 233 38 271 Consistence rate (95 %CI) 981 3 % (951 6 %2991 5 %) 851 0 % (701 2 %2941 3 %) 961 3 % (931 3 %2981 2 %) 5 HBV D NA(γ) HBV 231 HBV DNA (γ) 108,PCR A NRAg EL ISA S1 1 HBV genome (Copies/ ml) 2 (4) HBV 1 000 / ml 98, N RAg EL ISA 10010 %,PCR A 9619 %,S1 1 8918 %, S1 2 6413 %10 HBV 1 000 / ml, PCR A,NRAg EL ISA 7,S1 1 2 6 3, NRAg EL ISA (9712 %) PCR A,S1 ( P < 0101) 108 DNA (γ) S/ CO, HBV NRAg S1 EL ISA, N RA (3) 4 HBV DNA HBV Table 4 Positive rates of several commercial HBV kits in testing HBV DNA p sotive sera n Positive rate ( %) PCR test A NRAg EL ISA Pre S1 test 1 Pre S1 test 2 1 000 98 95 (9619 %) 98 (100 %) 88 (891 8 %) 63 (6413 %) < 1 000 10 10 (100 %) 7 (701 0 %) 6 (6010 %) 3 (301 0 %) Total 108 105 (971 2 %) 105 (971 2 %) 94 (871 0 %) 66 (6111 %) a PCR,HBsAg 140 Thr Ile ( T140I), HBsAga HBcAg HBV,HBV DNA HBcAg Dane,,,, HBcAg 75 % 3 HBV NRAg EL ISA S1 EL ISA HBeAg HBV DNA S/ CO HBV, Figure 3 S/ CO value distribution of HBV DNA psoitve, HBeAg sera when tested by HBV NRAg EL ISA kit or HBV, commercial PreS1 EL ISA kits 6 HBsAg(Ο) HBV D NA(γ) HBeAg HBV 231 HBV DNA (γ), HBV DNA,2 HB2 sag (Ο) HBV DNA 2 a PCR,1 HBsAb (Ο) PCR HBeAg (γ) HBeAb (Ο) HBcAb (γ),, 10 S1 1 5 10 6 2 (Ο), HBV DNA 813 10 4 / ml ; PCR 10 2 10 3 / / ml,, ml,c S PCR,S1

256 23 S1 HBV DNA, S1, S1,HBV DNA 1 000 / ml, 10 %36 %(4) S1, HBV DNA HBV DNA Dane HBcAg, 50 % S1,,Dane, HBsAg HBsAg HBcAg S1,, HBV N RAg EL ISA HBV DNA HBV,,, HBsAg,S1 HBcAg 1 S1 HBcAg ( : ),HBV N RAg EL ISA,S1 HBcAg, HBV DNA, HBV2NRAg EL ISA, HBV DNA, S/ CO HBV (2) HBeAg HBeAb, HBV DNA (γ) N RAg ( P > 0105), NRAg HBeAg HBeAb,HBV DNA, HBV DNA (Ο) HBsAg (γ) 17, HBeAg (Ο),6 HBeAb (γ) 5 NRAg (γ), 11 HBeAb (Ο) N RAg (Ο), ( P < 01001) (2), HBeAb (γ),,hbeab (Ο) 5 N RAg (γ), HBsAg S/ CO 20,12 N RAg (Ο) 1 HBsAg S/ CO 20,11 HB2 sag S/ CO 111215 (), HBcAg HBV,, S1 AA21247 HBV, 108 HBV DNA 1 000 / ml,n RAg,PCR A 3, 1 PCR B,NRAg HBV PCR,2 HBsAg (2) HBV DNA, HBV2N RAg EL ISA 1 HBsAga, HBsAg N RAg EL ISA, PCR [1 ] Toshimasa K, Makoto N, Hironori S, et al1 Analysis of HBs antigen negative variant of hepatitis B virus : Unique Substitutions, Glu129 to Asp and Gly145 to Ala in the surface antigen gene [J ]1 Med Sci Monit, 2000, 6 (6) : 1165211691 [ 2 ] Oon C J, Chen W N1 Current aspects of hepatitis B sur2 face antigen mutant s in Singapore [J ]1 J Viral Hepatol, 1998, 5 ( Suppl. 2) : 172231 [3 ] Steven J M, Wan C C, Yi Z, et al1 Wild2type and a epitope variant s in chronic hepatitis B virus carriers posi2 tive for hepatitis B surface antigen and antibody [J ]1 J Gastroenterol Hepatol, 2002, 17 : 14821521 [ 4 ] Marcus S, Thomas P, J ens R1 Isolation, characteriza2 tion and biological significance of hepatitis B virus mu2 tant s from serum of a patient with immunologically nega2 tive HBV infection[j ]1 J Hepatol,2000, 33 : 79928111 [5 ] Tatsuji K, Akinori R, Akihiro M, et al1 New enzyme immunoassay for detection of hepatitis B virus core anti2 gen ( HBcAg) and relation between levels of HBcAg and HBV DNA[J ]1 J Clin Microbiol, 2003, 41 : 1901219061 [6 ] Sadakazu U, Hiroaki O, Fumio T, et al1 An enzyme2 linked immunosorbent assay with monoclonal antibodies for the determination of phosphorylated hepatitis B core protein (p21c) in serum[j ]1 J Virol Meth, 1998, 72 : 952 1031 [7 ] Guillou D B, Duclos2Vallee J C, Eberle F, et al1 Evalu2 ation of an enzyme2linked immunosorbent assay for detec2

4 :S1 257 tion and quantification of hepatitis B virus PreS1 envelope antigen in serum samples : comparison with two commer2 cial assays for monitoring hepatitis B virus DNA [J ]1 J Viral Hepatol, 2000, 7 : 38723921 [8 ] Theilmann L, Klinkert M Q, Gmelin K, et al1 Detec2 tion of PreS1 proteins in serum and liver of HBsAg2posi2 tive patients : a new marker for hepatitis B virus infection [J ]1 Hepatology,1986, 6 : 18621901 [9 ] Kuijpers L, Koens M, Murray2L yon I, et al1 Pre2S pro2 teins in hepatitis B [J ]1 J Virol Meth,1989, 28 : 472511 [10 ] Tijssen P, Kurstak E1 Highly efficient and simple methods for the preparation of peroxidase and active peroxidase 2 antibody conjugates for enzyme immunoas2 says[j ]1 Anal Biochem, 1984,136 : 45124571 [ 11 ] Petit M A, Guillou D B, Roche B, et al1 Residual hep2 atitis B virus particles in liver transplant recipient s re2 ceiving lamivudine : PCR quantiation of HBV DNA and EL ISA of PreS1 antigen[j ]1 J Virol Meth,2001, 65 : 49325041 Establishment of a Ne w Combined Enzyme Immunoassay f or Detection of HBV PreS1 and Core Antigens and the Consistency with HBV D NA Test YUAN Quan 1, GE Sheng2xiang 1, YAN Qiang 1, ZHAO Yu 2, XION G J un2hui 1, ZHAN G J un 1, XIA Ning2shao 1 (11 N ational Institute of Diagnostics and V accine Development in Inf ectious Disease, Xiamen University, Xiamen 361005, China; 21 Bei j ing W antai Pharmacy Enterprise Co1 L t d, Bei j ing 102200, China) Abstract :In t his st udy,a new combined enzyme immunoassay (NRAg EL ISA) for detection of HBV PreS1 and core antigens which was highly consistent with serum HBV DNA test was established. The serial ser2 um dilution test indicated that t he average sensitivity of t he assay was 10 312 genome copies/ ml (95 %CI : 10 2122412 genome copies/ ml),which was notably higher t han t he test performed on Pre S1 or core antigen a2 lone. The test with sera from 994 blood donors whose HBsAg were negative demonstrated t hat t he specific2 ity of t his assay was 9917 % (95 %CI : 9911 %29919 %). 271 serum samples from chronic hepatitis patient s were also examined and t he result showed t hat t he total consistent rate between NRAg EL ISA and HBV DNA was 9613 %(95 %CI :9313 %29812 %). The NRAg EL ISA S/ CO (signal/ cutoff) was closely correlated with HBV genome copies (R = 019158,n = 231). Furt hermore,by using t his assay,we found a patient whose HBsAg was negative but HBV DNA was positive. Sequencing result showed t hat HBV genome from this patient had a point mutation in t hea epitope of S gene. Our result s indicate t hat HBV N RAg EL ISA has a high relativity with HBV DNA test,and can effectively detect t he mutation of HBsAg,it is expected to be a potent tool for screening HBsAg mutant and is a convenient method for substit uting HBV DNA test. Key words : hepatitis B virus ;nucleic acids related antigen (NRAg) ; HBsAg mutation Corres ponding author : X IA N ing2shao, E2mail : ns x ia @x mu. edu. cn