50 (2) :302-307, 2004 A cta Zoologica S inica RNA 3 33, 201101, China RNA (RNA interference, RNAi), RNA, RNA ( si GFP) 32 RNA ( si GAPDH) ( Green fluorescent protein, GFP) (p EGFP2C1 Vector) Lipofectamine TM 2000, 36 h,, GFP GFP + si GAPDH GFP + si GFP, GFP GFP + si GAPDH, si GFP, RNA (sirna) RNA [ 50 (2) : 302-307, 2004 ] RNAi sirna GFP GAPDH Inhibition of green fluorescent protein gene expression in chicken blastoderm cells by sirna 3 MEN G He, CHEN Xue2Hui, WAN G Qi2Shan, CU I Fang2Yan, PAN Yu2Chun 33 College of Agriculture and Biology, Shanghai Jiaotong University, Shanghai 201101, China Abstract RNA interference (RNAi) has developed into a powerful tool for studying gene function, embryonic develop2 ment and virosis therapy which can be capable of silenced the expression of special genes. In order to identify the mecha2 nism of RNAi in the birds, The small interference RNA of GFP (si GFP) and GAPDH (si GAPDH) that synthesized in vit ro transcription were cotransfected into the chicken blastoderm cells separately with the green fluorescent protein ( GFP) expression vector (p EGFP2C1 Vector) by the transfection reagent (Lipofectamine TM 2000), then the numbers of fluorescent cell were measured after 36 h. The result of variance analysis showed that there were significant differences a2 mong the groups ( P < 0101), and the result of multiple comparison showed that there were significant differences be2 tween the groups of GFP and GFP + si GFP ( P < 0101), GFP + si GAPDH and GFP + si GFP ( P < 0101), but no sig2 nificant difference between GFP and GFP + si GAPDH ( P > 0105). The results indicate that the si GFP can knock2down the expression of GFP but the si GAPDH could not, which means there exists RNAi mechanism in chicken as well as in wireworm, epiphyte, cysticercoid, hydra, trypanosomiasis, turbination, drosophila, zebra, mice, and so on [ Acta Zoo2 logica Sinica 50 (2) : 302-307, 2004 ]. Key words RNAi, sirna, Chicken blastoderm cell, GFP, GAPDH, al. (1995) RNA,, RNA Guo et, Fire et al. 2003211210, 2003212201 3 973 SARS ( No12003CB514129) (2003034267) [ This research was funded by 973 Plan Special Project for Prevention and Cure of SARS (No12003CB514129) and Postdoctoral Science Foundation of China (No12003034267) ] 33 : E2mail : panyc @sjtu1edu1cn ν 2004 Acta Zoologica Sinica
2 : RNA 303 (1998), RNA,,, si GFP si GAPDH RNA RNA, RNAi, RNAi RNA RNA ( RNA interference, RNAi) RNAi, RNA RNA 111 sirna,, RNA (Dicer), RNA Picard, 2002), RNA ( Small interference RNA, sirna) sirna RNA (Dicer) RNA :, sirna T7 promoter, 5 2taatacgactcactatag23 ; si GFP, RNA,, Antisense 5 2aagttcaccttgatgccgttctatagtgagtcgtatta23, ( Accession No : U55763 ) ; si GAPDH, Sense 5 2 (Bernstein et al., 2001 ; Sijen et al., 2001 ; Lipardi et al., 2001) RNAi, sion No : K01458) T7, 1 nmol 50 l TE Buffer ( 10 mmol/ L Tris2HCl p H 810, 1 mmol/ L ED TA ), (Cogoni and Macino, 1999) (Chuang and Meyerowitz, 2000 ) ( Lohmann et al., 1999) (Ngo et al., 1998) (Alvarado and Newmark, 1999 ) ( Kennerdell and Carthew, 1998 ) ( Wargelius et al., 1999) ( Wianny and Zernicka2Goetz, 2000), Unit RNase Inhibitor ( Ta KaRa), 100 Unit T7 RNA DNA (Double strand RNA, dsrna) polymerase ( Promega), 200 pmol dsdna, 011 Unit ( ), RNAi Yeast Pyrophosphatase ( Sigma), DEPC ( Fraser et al., 2000 ; 50 l ] 50 l 37 2 h, Gonczy et al., 2000) ( Green fluorescent protein, GFP) 1974 RNA DNA, RNA (Morise et al., 1974) (100 l), 95 5 min 37 1 h,,, RNA 10 l 3 mol/ L NaAc (p H, 512) 215, - 20 GFP 2 30 min, 12 000 g 10 min 70 %,,, 40 l PBS, 112 ( ) (Chalfie et al., 1994) 1 (Donz and, cdna mrna, Dicer Sense 5 2aagaacggcatcaaggtgaactatagtgagtcgtatta23, aagcgtgttatcatctcagcctatagtgagtcgtatta23, Antisense 5 2aaggctgagatgataacacgctatagtgagtcgtatta23 ( Acces2 95 2 min,, DNA [ 10 T7 Buffer ( Tris2HCl p H 719 400 mmol/ L, MgCl 2 60 mmol/ L, D TT 100 mmol/ L, NaCl 100 mmol/ L, Spermidine 20 mmol/ L) 5 l, 1 mmol/ L rn TP Mixture ( Promega), 40 DNA2RNA 5 Unit RNase2Free DNase2 ( Ta KaRa), 37 15 min, DNA2 5 h, 3 min, Clontech 70 % GFP p EGFP2C1,,
04 3 50, PBS 2, : 400, 1 000 g 3 min,, (0125 %) 37 10 min 488 nm,, 1 000 g 5 min, 10 % DMEM 1 ml, 6,, 37 5 % CO 2 CO 2 ( %) = ( / ) 113 sirna Lipofectamine TM 2000 ( Invit2 rogen) : 250 l 4 g, 2 250 l 10 l, 5 min 211 sirna 20 min, (500 l) 50 % T7 6, 37 5 % CO 2 DNA CO 2 12 h DNase2, DNase2 p EGFP2C1 Vector (Clontech) 114 36 h, (Nikon E600) 488 nm DNA ( 1 2) ; T7 100 %,, sirna 3 % ( 1) 1 : A, DNase2 T7 DNA 1 sirna A. 1 2 T7 DNA DNA ; 3 4 T7 DNA RNA DNA B. 1 2 T7 DNA DNA ; 3 4 T7 DNA DNA RNA ; 5 RNA RNA Fig11 Electrophoresis of the sirna synthesized in vitro transcription A. The products on the line 1 and line 2 were double strand DNA that composed of T7 promotor and target gene oligonucleotide and digested by DNase2. The products on the line 3 and line 4 were single strand RNA transcription using the double strand DNA composed the T7 promotor and target gene oligonucleotide as templet and digested by DNase2. B. The products on the line 1 and line 2 were single strand RNA transcription us2 ing the double strand DNA composed the T7 promotor and target gene oligonucleotide as templet and digested by DNase2. The products on the line 3 and line 4 were cross2chains formed the double strand DNA templets and single strand RNA transcripted. The product on line 5 was small double strand RNA was annealed with two single strand RNA after the transcriptions.
2 : RNA 305 2 sirna A. p EGFP2C1 B. p EGFP2C1 si GFP C. p EGFP2C1 si GAPDH 488 nm ; Fig12 Eff iciency of sirna interfering on the expression of green fluorescent protein ( GFP) in chicken blasto2 derm cell A. The group was only transfected with p EGFP2C1. B. The group was transfected with p EGFP2C1 and si GFP. C. The group was transfected with p EGFP2C1 and si GAPDH. The images are showed by 488nm in the first row, and below, the images are showed by the white light. RNA ( 3 4) 1 : B, DNase2 Lipofectamine TM2000, 1 2 2-4 g 3 4,, DNase2 DNA, ( 1) 38 bp 21 nt, DNase2, DNase2,, DNA RNA, 36 h, 48 h RNA sirna sirna ( 5),, 1 sirna Table 1 Percentage of expression of cell green fluorescent sirna, protein in diverse time after transfection 20-40 g sirna (h) 212 sirna Time, Lipofectamine TM 2000, 4 g 10 l Lipofectamine TM 2000 B C, p EGFP2C1 sirna 1 + 1 g 2 + 2 g 3 + 3 g 3,, 6 g,,, 12 h ( %) Average percentage of expression ( %) 12 2173 + 0142 (4) 24 5156 + 0137 (4) 36 7145 + 0177 (4) 48 2128 + 0134 (4) A p EGFP2C1 1 g, 2 g 3 g 3 RNA p EGFP2C1 sirna
06 3 50 2 + 2 g, 36 h, RNAi, 2 2 2, 3 ( Elbashir et al., 2001), 488 nm, p EGFP2C1 ( A ) p EGFP2C1 si GAPDH (C) sirna,, p EGFP2C1 si GFP (B) 3, p EGFP2C1 si GFP 3 p EGFP2C1 ( P < 0101) ( p EGFP2C1 si GAPDH, 2), GFP GFP + si GAPDH GFP + si GFP ( P < 0101) ; GFP GFP + si GAPDH ( P > 0105) 2 Table 2 Percentage of expression of cell green fluorescent protein in diverse groups RNAi dsrna, RNAi ( %) Group Average percentage of expression ( %),, GFP 7124 + 1113 (4) a GFP + si GFP 0187 + 0127 (8) b, GFP + si GAPDH 6193 + 1154 (5) a, RNAi ( Pekarik et al., ( P < 0101) Different superscripts indicas significant difference ( 2003) P < 0101). sirna, 3 RNAi,, RNAi ;, RNA, (Billy et al., 2001) ( References) RNA,, P KR, E2F,, RNA L ( RNase L), mrna RNAi RNAi, 21 bp RNA, RNAi sirna, sirna RNA p EGFP2C1 p EGFP2C1 si GAPDH, sirna RNA, RNAi Alvarado AS, Newmark PA, 1999. Double2stranded RNA specifically disrupts gene expression during planarian regeneration. Proc. Natl. Acad. Sci. USA 96 : 5 049-5 054. Bernstein E, Hammond SM, Hannon GJ, 2001. Role for a bidentate ri2 bonuclease in the initiation step of RNA interference. Nature 409 (6 818) : 363-366. Billy E, Zhang HD, Filipowicz W, 2001. Specific interference with gene expression induced by long, double2stranded RNA in mouse embryonal teratocarcinoma cell lines. Proc. Natl. Acad. Sci. USA 98 (25) : 14 428-14 433. Chalfie M, Tu Y, Euskirchen G, 1994. Green fluorescent protein as a marker for gene express. Science 263 : 802-805.
2 : RNA 307 Chuang C, Meyerowitz EM, 2000. Specific and heritable genetic inter2 ference by double2stranded RNA in A rabidopsis thaliana. Proc. Natl. Acad. Sci. USA 97 (9) : 4 985-5 054. Cogoni C, Macino G, 1999. Gene silencing in Neurospora crassa re2 quires a protein homologous to RNA2dependent RNA polymerase. Nature 399 (6 732) : 166-169. Donz O, Picard D, 2002. RNA interference in mammalian cells using sirnas synthesized with T7 RNA polymerase. Nucl. Acids Res. 30 (46) : 1-4. Elbashir SM, Lendeckel W, Tuschl T, 2001. Duplexes of 212nu2 cleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411 (6 836) : 428-429. Fire A, Xu S, Montgomery M K, Kostas SA, Driver SE, Mello CC, 1998. Potent and specific genetic interference by double2stranded RNA in Caenorhabditis elegans. Nature 391 ( 6 669 ) : 806-811. Fraser AG, Kamath RS, Zipperlen P, Campos MM, Sohrmann M, Ahringer J, 2000. Functional genomic analysis of C1elegans chro2 mosome by systematic RNA interference. Nature 408 : 325-330. Gonczy P, Echeverri C, Oegema K, Coulson A, Jonesk SJ M, Copley RR, Duperon J, Oegema J, Brehm M, Cassin E, Hannak E, Kirkham M, Pichler S, Flohrs K, Goessen A, Leidel S, Alleaume AM, Martin C, Ozlu N, Bork P, Hyman AA, 2000. Functional genomic analysis of cell division in C1elegans using RNAi of genes on chromosome. Nature 408 : 331-336. Guo S, Kemphues KJ, 1995. Par21, a gene required for establishing polarity in C1 elegans embryos, encodes a putative Ser/ Thr kinase that is asymmetrically distributed. Cell 81 : 611-620. Kennerdell J R, Carthew RW, 1998. Use of dsrna2mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95 : 1 017-1 026. Lipardi C, Wei Q, Paterson BM, 2001. RNAi as random degradative PCR : sirna primers convert mrna into dsrnas that are degrad2 ed to generate new sirnas. Cell 107 (3) : 297-307. Lohmann J U, Endl I, Bosch TG, 1999. Silencing of developmental genes in hydra. Dev. Biol. 214 : 211-214. Morise H, Shimomura O, Johnson FH, Winant J, 1974. Intermolecu2 lar energy transfer in the bioluminescent system of Aequorea. Bio2 chemistry 13 : 2 656-2 662. Ngo H, Tschudi C, Gull K, Ullu E, 1998. Double2stranded RNA in2 duces mrna degradation in Trypanosoma brucei. Proc. Natl. A2 cad. Sci. USA 95 : 14 687-14 692. Pekarik V, Bourikas D, Mihlino N, Joset P, Preiswerk S, Stoeckli E T, 2003. Screening for gene function in chicken embryo using RNAi and electroporation. Nature Biotechnology 21 : 93-96. Sijen T, Fleenor J, Simmer F, Thijssen KL, Parrish S, Timmons L, Plasterk RH, Fire A, 2001 On the role of RNA amplification in dsrna2triggered gene silencing. Cell 107 (4) : 465-476. Wargelius A, Ellingsen S, Fjose A, 1999. Double2stranded RNA in2 duces specific developmental defects in Zebrafish embryos. Biochem. Biophys. Res. Commun. 263 : 156-161. Wianny F, Zernicka2Goetz M, 2000. Specific interference with gene function by double2stranded RNA in early mouse development. Na2 ture Cell Biology 2 : 70-75.