The Structure of Lecithin Cholesterol Acyltransferase( LCAT)

Σχετικά έγγραφα
Malgorzata Korycka-Machala, Marcin Nowosielski, Aneta Kuron, Sebastian Rykowski, Agnieszka Olejniczak, Marcin Hoffmann and Jaroslaw Dziadek

Composition Analysis of Protein and Oil and Amino Acids of the Soybean Varieties in Heilongjiang Province of China

The effect of curcumin on the stability of Aβ. dimers

Comparison of nutrient components in muscle of wild and farmed groups of Myxocyprinus asiaticus

1.1 1., Litopenaeus vannamei N- -β-d- NAGase. Asp Glu. K I 9.50 mmol/l mmol/l. Litopenaeus vannamei

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

ER-Tree (Extended R*-Tree)

Nguyen Hien Trang* **

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

ΑΝΤΙΓΡΑΦΗ ΚΑΙ ΕΚΦΡΑΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ

Study on anti-hyperlipidemia mechanism of high frequency herb pairs by molecular docking method

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. Γουανίνη Κυτοσίνη. 4α. Λειτουργία γενετικού υλικού. Φωσφοδιεστερικός δεσμός

Supplementary information:


Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Βιοπληροφορική. Ενότητα 20: Υπολογιστικός Προσδιορισμός Δομής (2/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

, 4 10kGy THE IRRADIATION EFFECTS AND PROCESSING DOSE FOR PET FOODS DECONTAMINATION

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Advances in the study of to0in in halobios

Human angiogenin is a potent cytotoxin in the absence of ribonuclease inhibitor

Effects of feeding reduced dietary CP with supplementation of synthetic AA on N and C. excretion, energy utilization, and fecal VFA concentrations.

Chalkou I. C. [PROJECT] Ανάθεση εργασιών.

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

ÂÓÈÎ ÁÈ ÙÔ K ÙÙ ÚÔ 1 Ô KÂÊ Ï ÈÔ 1.1 E Ë Î ÙÙ ÚˆÓ ÚÔÎ Ú ˆÙÈÎ Î ÙÙ Ú

ΔΟΜΗ ΠΡΩΤΕΪΝΩΝ II. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

4 ο ΚΕΦΑΛΑΙΟ. Γ ε ν ε τ ι κ ή

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Molecular evolutionary dynamics of respiratory syncytial virus group A in

Peptidylarginine deiminase 4

Supporting Information. Partial thioamide scan on the lipopeptaibiotic trichogin GA IV. Effects on

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

ΠΡΑΚΤΙΚΗ ΑΣΚΗΣΗ ΣΚΟΥΤΕΛΗ ΑΛΕΞΑΝΔΡΑ

a 2,5 b 2,5 upplemental Figure 1 IL4 (4h) in Ja18-/- mice IFN-γ (16h) in Ja18-/- mice 1,5 1,5 ng/ml ng/ml 0,5 0,5 4ClPh PyrC 4ClPh PyrC

Supplementary Information for

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Targeting Bacillus anthracis toxicity with a genetically selected inhibitor of the PA/CMG2

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

ΕΙΣΑΓΩΓΗ Ι. Στοιχεία Μοριακής Βιολογίας Βιολογικά Μακρομόρια ΙΙ. Επισκόπηση του πεδίου της Υπολογιστικής Βιολογίας - Βιοπληροφορικής

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

Study on the Stability of Insulin Hexamer in Solution by Molecular Dynamics Simulations

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Approximation Expressions for the Temperature Integral

Electronic Supplementary Information

Supporting Information

Quick algorithm f or computing core attribute

Single-site association results for 136 SCARB1 genotyped variants with HDL-C.

Οι πρωτεΐνες δομούνται από ένα σύνολο αμινοξέων. 1/10/2015 Δ.Δ. Λεωνίδας

Αµινοξέα και πεπτίδια Φύλλο εργασίας - αξιολόγησης

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

(Vibrio anguillarum) (Cyclina sinensis) *

,,, (, ) , ;,,, ; -

Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

CorV CVAC. CorV TU317. 1

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Πανεπιστήμιο Πατρών Τμήμα Xημείας Αντωνία Ι. Αντωνίου Χημικός

Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA

Population exposure to PAHs in Tianjin area

College of Life Science, Dalian Nationalities University, Dalian , PR China.

ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΓΕΝΕΤΙΚΗΣ ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ ΚΑΙ ΣΗΜΑΤΟ ΟΤΗΣΗ

Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %

Comparable analysis of nutrition and functional active ingredients in different varieties of tartary buckwheat

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Science of Sericulture

ΑΝΑΠΤΥΞΗ ΠΡΟΓΡΑΜΜΑΤΩΝ ΕΚΠΑΙΔΕΥΣΗΣ ΜΕ ΣΤΟΧΟ ΤΗΝ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΥΑΙΣΘΗΤΟΠΟΙΗΣΗ ΑΤΟΜΩΝ ΜΕ ΕΙΔΙΚΕΣ ΑΝΑΓΚΕΣ ΚΑΙ ΤΗΝ ΚΟΙΝΩΝΙΚΗ ΤΟΥΣ ΕΝΣΩΜΑΤΩΣΗ

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Supporting Information

An experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Studies on Synthesis and Biological Activities of 2( 1 H21,2,42 Triazol212yl)2 2Arylthioethyl Substituted Phenyl Ketones

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

Experimental Study of Dielectric Properties on Human Lung Tissue

Transcript:

ISSN 100727626 CN 1123870ΠQ 2002 2 Chinese Journal of Biochemistry and Molecular Biology 18 (1) :64 69 cdna,, 3,,, 1) (, 100005) (LCAT) cdna, mrna cdna, SMART2 RACE, LCAT cdna, LCAT cdna ( GenBank AF324887) 1 953 bp, 1 356 bp 451, 23 428 LCAT C 12, 98 % 83 % 82 % LCAT, LCAT,,, cdna Q751,Q55 The Structure of Lecithin Cholesterol Acyltransferase( LCAT) :2001204202, :2001205228, (No 39770168),,1970 10,, 3 Tel :010265296413, E2mail :capogene @163bj com 1), Received :April 2,2001 ; Accepted :May 28,2001 Supported by the National Scaling for Heights Program and National Natural Sciences Foundation of China (No 39770168) 3 Corresponding author Tel : 010265296413, E2mail : capogene @163bj com cd NA and Its Protein from Beijing Duck ZENG Wu2wei, ZHANGJian 3 3, CHEN Bao2sheng 3, WU Gang, ZHANG Ke2man, XUE Hong ( Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medical Sciences, Perking Union Medical College, National Laboratory of Medical Molecular Biology, Beijing 100005, China) Abstract To obtain the nucleotide sequence and deduced amino acid sequence of lecithin cholesterol acyl2 transferase (LCAT) cdna from Beijing Duck, one kind of anti2atherosclerosis animals The sequence of leci2 thin :cholesterol acyltransferase cdna from Beijing Duck was obtained by utilizing the technique of SMART (Switching Mechanism At 5 end of RNA Transcript) and RACE( Rapid Amplification of cdna End) from the first strand of cdna The amino acid sequence of Beijing Duck LCAT was deduced from this cdna and its primary and secondary structures were predicted by using softwares for molecular biology The cdna sequence of lecithin cholesterol acyltransferase from Beijing Duck covered 1 953 bp, including a 1 356 bp fragment in an open reading frame (ORF) as well as 1bp and 596 bp at 5 and 3 of the untranslated regions respectively The ORF encoded 451 amino acids(aa) precuser, which contained a hydrophobic signal peptide of 23 amino acids and a mature peptide of 428 amino acids Comparing and aligning this amino acid sequence of LCAT with those of other published animals, it revealed that the mature protein had more 12 amino acids than that of the human, baboon and rabbit The homology among Beijing Duck and chicken, human, rabbit LCAT were

1 : cdna 65 98 %, 83 % and 82 % at protein level,respectively The amino acid residues concerned with the catalytic ac2 tivity were highly conserved The cdna sequence of LCAT from Beijing Duck was registered at GenBank with the accession number of AF324887 Although the amino acid sequence of Beijing Duck LCAT has some differ2 ence from that of other species, the regions which are important to function of LCAT are highly preserved Key words Beijing Duck,lecithin cholesterol acyltransferase (LCAT),cDNA and protein Superscript 200U 42 1 5 h,, (high den2 cdna sity lipoprotein,hdl), 70 75 %, (lecithin chol2 LCAT cdna, 2 esterol acyltransferase,lcat) B1 B2, cdna, 1 [1 ] 1 kb GenBank Blast LCAT LCAT cdna HDL, 1 kb B3 B6, LCAT, LCAT cdna 5 2UTR,LCAT CDS, B4 B5, B3 B4, B5 B6, 1 kb 600 [2 ] bp 2, Blast, 2, LCAT cdna 3 5 [3 ] apoai, apoai LCAT 1 111,, GenBank Blast,, ;MMLV Superscript LCAT cdna GIBCO BRL ; RACE2PCR GenBank Clontech 5 SMART :5 2AAGCAGTG2 GTAACAACGCAGAGTACGCGGG23 ; 3 LCAT cdna CDS 5 2 ATTCTAgAggCCgAggCggCCgACATg2d (T) 30 N 1 N 2 23 1 B1 :5 2gAAgCCAAA(g) CTggA2 CAAg(A) CC23, B2 :5 2gTTgCTgAAgACCATgTTgAg23 ; 2 B3 : 5 2gAggATggCTggTACATgTgg2 3,B4 : 5 2ATTCTAgAggCCgAggCggC23 ; 3 211 LCAT cdna B5 :5 2CAC(g) gaggcacca ( T) gggctgg23,b6 :5 2 gtgcatctcctctatcagtgc23 112 LCAT cdna 3 596 bp 1 ATG Trizol 23, + 4 ( 1 0 g) RNA, Oligo (dt)2 G, mrna 2 g mrna, CDS 3, SMART 5, MMLV LCAT cdna,, 3, LCAT cdna 113 LCAT cdna LCAT cdna 114 LCAT DNAMANPCGENE,, 2 LCAT cdna 1 953 bp, 1 356 bp,5 1 bp, cdna TGA, 3 poly (A) 17 bp poly (A)

66 18 AATAAA(Fig 1) LCAT cdna 3 2UTR, LCAT cdna 212 LCAT 500 Blast, LCAT cdna LCAT cdna 1 23, 92 % 85 % 85 % 83 % 81 % 80 % cdna LCAT cdna cdna LCAT 451, SignalP Server [4 ], 1 428 49 063

1 : cdna 67 Fig 1 The nucleotide sequence and its deduced amino acid sequence of Beijing Duck LCAT cdna, LCAT Table 1 The comparison of amino acids composition between LCAT Beijing Duck and human LCAT Table 1, LCAT 5 Cys, 2 4, 1 Cys31, LCAT 6 Cys, 2 LCAT Cys184 LCAT Asp Pro, LCAT C Pro,402 415 8 Pro, LCAT C 12, Pro,, C Glu401, LCAT, Ile390, Ser383 Gly374 LCAT [6 ], LCAT C, LCAT Amino acid LCAT, 98 %, 83 % 82 % 82 % 80 % 81 % LCAT Fig 2 Beijing duck Number molπmol ( %) Human Number molπmol ( %) A Ala 15 3 50 21 5 05 C Cys 5 1 17 6 1 44 D Asp 25 5 84 21 5 05 E Glu 23 5 37 21 5 05 F Phe 16 3 74 19 4 57 G Gly 33 7 71 34 8 17 H His 9 2 10 13 3 13 I Ile 17 3 97 17 4 09 K Lys 19 4 44 12 2 88 L Leu 42 9 81 50 12 02 M MET 12 2 80 9 2 16 N Asn 25 5 84 16 3 85 P Pro 28 6 54 37 8 89 Q Gln 22 5 14 16 3 85 R Arg 21 4 91 20 4 81 S Ser 24 5 61 22 5 29 T Thr 26 6 07 22 5 29 V Val 30 7 01 28 6 73 W Trp 12 2 80 12 2 88 Y Tyr 24 5 61 20 4 81

68 18 Fig 2 Alignment of amino acid sequences of Beijing duck and other animals LCAT 3 LCAT,,,lids,LCAT sn2 Acyl2, 3 2OH,,, HDL LCAT,, LCAT HDL apoai LCAT Cys502Cys74, Try61 [6 ] LCAT LCAT LCAT Cys502Cys74, 5 (familial LCAT deficiency, FLD), (fish2eye dis2, [7 ease, FED), ] LCAT Cys502Cys74,LCAT, :Asp345 His377 Ser181,LCAT motif, GXSXG, LCAT AHS 3 MG, [8, ] Ala (A) Gly( G),, LCAT, LCAT motif LCAT C 12, (VFLIAHS 3 MGNLNVLYFLL) [10, ] Cys502Cys74 Ser1812Asp3452His377 LCAT 5 Cys, Ser181 4 Cys Cys50 Cys74, Cys313 Cys354 2 4 N2 (Asn20, 84,272 384) [9 ] LCAT 50274 lids,lids,, 2, LCAT 2 Cys

1 : cdna 69 LCAT 6 Cys, 2 LCAT 4 Cys, 2, 2 LCAT Cys LCAT 1 (Cys184), LCAT, 2 Cys LCAT [10 ], LCAT LCAT, 2 Cys, [7 2 Cys ] 3,, AI cdna, LCAT 4 N2 (Asn2X2SerΠ Thr,20,84,272,384), 1 (Asn272) LCAT [10 ], LCAT 2 O2 (Thr407 Ser409), LCAT 2, LCAT C2 Gly401 LCAT [5 ], LCAT C2 2 O2, LCAT cdna, LCAT cdna, LCAT LCAT,,LCAT,LCAT LCAT, ( References) 1 Wang K Q, Chen B S, Xie Y H, Hao Q L, Li Z G Are tree shrews and Beijing ducks good models for the study of the antiatherogeniety HDL? In : Woodford F P, Davignon J Sniderman A eds Atherosclero2 sis X, Amsterdam : EI Sevier Press, 1995 ec126 131 2 Fielding C J, Fielding P E Molecular physiology of reverse cholesterol transport J Lipid Res, 1995, 36 : 211 228 (L Xin2yue,Chen Bao2 sheng Wang Ke2qin Clone and tissue expression of Beijing Duck apoli2 poprotein AI cdna Chin J Biochem Mol Biol),1998,14(5) :471 478 4 Nielsen H, Engelbrecht J, Brunak S, von Heijne G Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleav2 age sites Protein Engineering, 1997,10 : 1 6 5 Lee Y P, Adimoolam S, Liu M, Subbaiah P V, Glenn K, Jonas A Analysis of human lecithin2cholesterol acyltransferase activity by carbox2 yl2terminal truncation Biochim Biophys Acta, 1997,1344 : 250 261 6 McLean J, Fielding C, Drayna D, Dieplinger H, Baer B, Kohr W, Henzel W, Lawn R Cloning and expression of human lecithin2choles2 terol acyltransferase cdna 2339 Proc Natl Acad Sci USA, 1986, 83 :2335 7 Kuivenhoven J A, Pritchard H, Hill J, Frohlich J, Assmann G, Kaste2 lein J The molecular pathology of lecithin cholesterol acyltransferrrase (LCAT) deficiency syndromes J Lipid Res, 1997, 38 :191 205 8 Peelman F, Vanloo B, Perez2Mendez O, Decout A, Verschelde JL, Labeur C, Vinaimont N, Verhee A, Duverger N, Brasseur R, Vandekerckhove J, Tavernier J, Rosseneu M Characterization of func2 tional residues in the interfacial recognition domain of lecithin cholesterol acyltransferase (LCAT) Protein Engineering, 1999, 12 (1) : 71 78 9 Jonas A Lecithin cholesterol acyltransferase Biochim Biophys Acta, 2000,1529(123) :245 256 10 Hengstschlager2Ottnad E, Kuchler K, Schneider W J Chicken lecithin cholesterol acyltransferase J Biol Chem,1995, 270(44) :26139 45