China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2

Σχετικά έγγραφα
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

(A ntifreeze p roteins, A FP s) (afp ),

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

ΜΕΛΕΤΗ ΑΠΟΤΙΜΗΣΗΣ ΠΑΡΑΓΟΜΕΝΗΣ ΕΝΕΡΓΕΙΑΣ Φ/Β ΣΥΣΤΗΜΑΤΩΝ ΕΓΚΑΤΕΣΤΗΜΕΝΩΝ ΣΕ ΕΛΛΑ Α ΚΑΙ ΤΣΕΧΙΑ

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

Electronic Supplementary Information

Η ΤΟΞΙΚΟΤΗΤΑ ΤΟΥ ΒΟΡΙΟΥ(B) ΣΤΗΝ ΚΑΛΛΙΕΡΓΕΙΑ ΤΗΣ ΤΟΜΑΤΑΣ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Aronia. melanocarpa. Επιβλεπονηερ καθηγηηερ:

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

LfcinB. Expression and Iden tif ica tion of Lfc inb Gene in P ich ia pastoris

Identification of Fish Species using DNA Method

THE GENETIC TRANSFORMATION OF STRAWBERRY WITH WINTER FLOUNDER ANTIFREEZE PROTEIN GENE

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΤΕΧΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

BGP TRACP-5b BGP TRACP-5b P 0.05


Fenton. COD ρ NH N TP ENVIRONMENTAL PROTECTION OF CHEMICAL INDUSTRY

E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Science of Sericulture

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Supporting Information

Isotopic and Geochemical Study of Travertine and Hot Springs Occurring Along the Yumoto Fault at North Coast of the Oga Peninsula, Akita Prefecture

6 cm, 1. 2 IAA, NAA, 2. 1

Electronic Supplementary Information

ΥΠΟΚΑΤΑΣΤΑΣΗ ΦΑΡΙΝΑΣ ΤΣΙΜΕΝΤΟΥ ΑΠΟ ΑΝΑΚΥΚΛΩΜΕΝΑ ΥΛΙΚΑ ΚΑΤΕ ΑΦΙΣΗΣ ΚΤΙΡΙΩΝ

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

,,, (, ) , ;,,, ; -

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Changes and Issues of Consolidation Techniques of Peaty Arable Land in Hokkaido

Ch in. J. B iochem. M o l. B io l. 2000, V o l. 16, N o. 5, Cd 2+ : Cd 2+ ΛCd 2+

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Stem Character istics of W heat w ith Stem L odging and Effects of L odging on Gra in Y ield and Qual ity

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Conductivity Logging for Thermal Spring Well

Shiraia sp. Slf14 III

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ

MSM Men who have Sex with Men HIV -

ect of Modified Wheat Starches on the Textural Properties of Baked Products, such as Cookies

Quick algorithm f or computing core attribute

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones

ER-Tree (Extended R*-Tree)

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

svari Real-time RT-PCR RSV

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1

Approximation Expressions for the Temperature Integral

GPS, 0. 5 kg ( In tegrated Fertility Index, IF I) 1. 1 SPSS 10. IF I =

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

) ; GSP ) ;PXD g, 100 ml

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

«Συντήρηση αχλαδιών σε νερό. υπό την παρουσία σπόρων σιναπιού (Sinapis arvensis).»

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Supporting Information

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Supporting Information

Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks

Cellular Physiology and Biochemistry

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

X g 1990 g PSRB

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

; +302 ; +313; +320,.

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Δυσκολίες που συναντούν οι μαθητές της Στ Δημοτικού στην κατανόηση της λειτουργίας του Συγκεντρωτικού Φακού

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Q L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan

CorV CVAC. CorV TU317. 1

Journal of the CUN(Natural Sciences Edition) ...

China Academic Journal Electronic Publishing House. All rights reserved. O ct., 2005

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Curran et al.,**. Davies et al ,**, ,***,**/

þÿ Ç»¹º ³µÃ ± : Ãż²» Ä Â

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (ΜΑΘΗΜΑ 5ο)

ΜΔΛΔΣΖ ΔΝΓΟΣΡΑΥΤΝΖ Δ ΥΑΛΤΒΔ ΘΔΡΜΖ ΔΛΑΖ

Transcript:

China B iotechnology, 2005, 25 (12) : 24 28 A tkup1 3 133 1 2 3 3 (1 150001 2 201106) (3 157011) RNA, RT2PCR,, Km ( ), A tkup1, PCR GUS Southern A tkup1 mrna PCR, PCR 2100bp, A tkup1 ( Genbank No: AF029876) ; GUS A tkup1 29 PCR A tkup1, PCR A tkup1 mrna A tkup1, 45% A tkup1 K +, [ 1 ],,,, [ 3 ], [ 1 ] 4% 5%, 3% 4%, 1% 2%, 2%, 2. 5% [ 4 ], [ 1, 2 ] A tkup1 (A rabidopsis thaliana K + : 2005210214 : 2005210224 3 (1102001011007) 33 : g_zk@ sohu. com up take) K + [ 5 ],, K +, K +, K + [ 6 ] A tkup1 A tkup1 1 1. 1 T/A pmd182t, ( Agrobacterium tum efaciens) LBA4404 Clontech, pcamb IA21201 DH5 (N icotiana tabacum ) 911 K326 1. 2 RNA T4 DNA Promega ; Ex2Taq DNA DNase I PCR SYBR RT2PCR Kit, Sigma AR 1. 3 A tkup1 cdna ( Kim 1998, Genbank No: AF029876 ), R217 (5 2AAAGGATCCAACAATGAACCAATCACCATCTCTTA TC23 ) R219 (5 2AAAGAGCTCTTAGACGTAATAAAC

2005, 25 (12) : A tkup1 25 CATTCCAAC23 ), B am H I SacI PCR : A tkup1z (5 2ACGCATAGAGTCGCCTTCATTTTCGCTCCAATC23 ) A tkup1f (5 2CGTCACGAAATGTCCGAAAACAGCTGG AACTCC23 ) ; mrna PCR : A tkup12s2f ( 5 2gTCCTCACTCCAACAATCTC23 ) A tkup12s2r ( 5 2ACCGGTGCTTCTAAGGAACT23 ),, PAGE 1. 4 A tkup1 Promega RNA ( RNAgents total RNA isolation system) RNA, Promega (Reverse Transcrip tion System ) cdna, R217 R219, Ex2Taq DNA PCR, PCR T2 ( pmd182t),, 1. 5 A tkup1 pcamb IA21201, B am H I SacI, A tkup1 pmd182t, T4 pcamb IA21201, A tkup1 pyf7783 1. 6, 5mm 5mm, 50m l OD 0. 3 0. 5 5 8 m in,, 9cm, MS0,, 22 3d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 50mg/L + Cb 250mg/L), 20d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 100mg/L + Cb 250mg/L ) 30d,, Jefferson [ 7 ] GUS, GUS (1 /2MS + Km25mg/L + Cb 25mg/L ) 30d, 3 5d, 1. 7 A tkup1 PCR A tkup1 PCR : 94 6m in, 94 50 s, 62 60 s, 72 3m in, 30 ; 72 10m in A tkup1 PCR : 94 6m in, 94 30 s, 62 40 s, 72 1m in, 30 ; 72 10m in 1. 8 Southern M ichiels [ 8 ] DNA, PstI, 32P A tkup1 1. 9 PCR 1. 4 A tkup1 PCR, OD 260 DNA DNA 10 1 10 2 10 3 10 4 10 5 DNA, Promega RNA RNA, O ligo dt, SYBR λ RT2PCR Kit, A tkup12s2f A tkup12s2r, MJ Op ticon 2 PCR, mrna DNA PCR DNA Ct, mrna A tkup1 cdna 1. 10 A tkup1 A tkup1 T1,, A tkup1 PCR, RNA, PCR 1. 11,, ( 45kg/ha) (90kg/ha) ( 135kg/ha) A tkup1 PCR T1,,, 6 12, A lliance 2 2. 1 A tkup1 RNA R217 R219 PCR 2 100bp, V2GENE DNA,,

26 China B iotechnology Vol. 25 No. 12 2005 T/A pmd182t, YF5501, 2139bp, Genebank A tkup1 2. 2 A tkup1 A tkup1 pmd182t pcamb IA21201 B am H I SacI, T4 A tkup1 pcamb IA21201, A tkup1 pyf7785 ( 1),, SAR ( A llen, 1996, Genebank No. U67919), CaMV 35S + TMV Omega leader sequence Km, ; CaMV 35S + TMV Omega leader sequence nos A tkup1 2 A tkup1 PCR 2 PCR ana lysis of A tkup1 tran sform ed tobacco plan ts Lane1: DNA marker DL2 000; Lane2: Nontransformed tobacco p lants; Lane3: Positive control(a tkup1 gene ) ; Lane4 12: Transgenic tobacco p lants agarose, 32 P A tkup1 (B am H I SacI ) Southern, 29 GUS, ( 3), A tkup1 2 3 5 8 11, 4 6 7 10 12, 9, 2 3 5 8 11 1, 4 6 7 9 10 12 2 1 A tkup1 py F7785 1 Con struction of A tkup1 gene plan t expression vector py F7785 2. 3 GUS A tkup1, Km GUS 29 ( T 0 ), 911 (11 ) K326 (18 ) 2. 4 A tkup1 PCR GUS DNA, A tkup1z A tkup1f, A tkup1 PCR 2, 29 GUS 1. 0 kb 2. 5 A tkup1 Southern DNA PstII, 0. 7% 3 Sourthern 3 Sourthern blot ana lysis of tran sform ed plan ts Lane1: Nontransformed tobacco p lants; Lane2: Positive control ( YF7783 digested with PstI ) ; Lane3 12: Transgenic tobacco plants Note: Genom ic DNA were digested with PstI, followed by hybridization with A tkup1 gene p rob 2. 6 A tkup1 Southern 5, RNA 10 5 10 4 10 3 10 2 10 1 DNA DNA, PCR, 4 DNA S1 S2 S3 S4 S5 Ct

2005, 25 (12) : A tkup1 27 4 A tkup1 m RNA 5 A tkup1 PCR 4 The rea ltim e PCR testing of A tkup1 5 The standard curve of C t vs A tkup1 copes m RNA in tran sgenetic roots DNA 5, Y = 222X + 8. 77; r 2 = 0. 988, PCR, 1 1, A tkup1 5 T1 mrna, 4 1 3 5 mrna 2. 7 2 : 911 K326 4 1 m RNA Table 1 The mrna analysis of A tkup1 in transgenetic roots DNA template Ct Value copys of Target sequence Standard S1 17. 962 10 5 References S2 22. 35 10 4 S3 25. 559 10 3 S4 30. 609 10 2 S5 36. 614 10 1 S0 0 S0 39. 706 1. 45 Test 4 25. 612 1653. 07 samp les 1 25. 983 1373. 41 3 26. 201 1232. 18 5 26. 242 1206. 82 2 26. 917 861. 53 2 Table 2 The chem ica l con ten ts of A tkup1 tran sform ed tobacco leaves T 0 K 2 O ( % ) P 2 O 5 ( % ) N ( % ) Cl( % ) sugar( % ) nicotine ( % ) p rotein ( % ) LY91122 2. 63 0. 566 1. 38 0. 067 14. 70 1. 05 6. 24 LY91123 2. 41 0. 514 1. 27 0. 029 17. 54 1. 38 6. 51 LY91125 2. 58 0. 531 1. 49 0. 024 16. 13 1. 32 6. 50 LY91128 2. 52 0. 621 1. 29 0. 089 13. 20 1. 29 6. 86 K32621 2. 43 0. 549 1. 44 0. 039 15. 02 1. 26 6. 50 K32625 2. 20 0. 690 1. 35 0. 035 14. 68 1. 43 8. 30 K32626 2. 32 0. 536 1. 45 0. 038 16. 05 1. 26 9. 06 K32629 2. 55 0. 622 1. 36 0. 047 15. 88 1. 23 7. 01 LY9112ck1. 61 0. 532 1. 48 0. 056 19. 54 0. 81 7. 26 K3262ck 1. 76 0. 540 1. 41 0. 066 18. 27 1. 34 7. 09 - - - - + 0. 77 - - - - - - - - - - 3. 51 - - - -, 2. 45%, 45% ;, 18. 5%, 3,,,,,,,,

28 China B iotechnology Vol. 25 No. 12 2005,,,,,,,,, K +, A tkup1,, : A tkup1 45%, [ 1 ],.., 1993, 25 (3) : 119 128 Cao ZH H, Hu G S. Soil, 1993, 25 (3) : 119 128 [ 2 ],.., 1998, 4 (2) : 156 164 Huang SH W, Jin J Y. Plant Nutrition and Fertilizer Science, 1998, 4 (2) : 156 164 [ 3 ] Chaplin J R. Production factors affecting chemical compounds of the tobacco leaf. Recent Advances of Tob Sci, 1980, (6) : 3 63 [ 4 ] Sim s J L, CasyM, Legget J E, et al. Effect of transp lant water fertilization on growth and chem ical composition of burley tobacco. Annual Report of the College of Agriculture and the K Y Agri Exp Stn, 1981, 59 60 [ 5 ] Kim E J, Kwak J M, Uozum i N, et al. A tkup1: an A rabidopsis gene encoding high2affinity potassium transport activity. Plant Cell, 1998, 10 (1) : 51 62 [ 6 ] Fu H H. A tkup1: A dual2affinity K + transporter from A rabidopsis. The Plant Cell, 1998, 10 (1) : 63 73 [ 7 ] Jefferson R A, Kavanagh T A, Bevan M W. GUS fusions: beta2 glucuronidase as a sensitive and versatile gene fusion marker in higher p lants. EMBO J, 1987, 6 (13) : 3901 3907 [ 8 ] M ichiels A, Van den Ende W, Tucker M, et al. Extraction of high2quality genom ic DNA from latex2containing plants. Anal B iochem, 2003, 315 (1) : 85 89 [ 9 ] Ahn S J, Shin R, SchachtmanD P. Exp ression of KT / KU P genes in A rabidopsis and the role of root hairs in K + up take. Plant Physiology, 2004, 134 (3) : 1135 1145 Tran sgen ic Tobacco w ith A rabidopsis tha liana A tkup1 Gene Ha s H igh Pota ssium Con ten t in L eaves GUO Zhao2kui 1 YANG Q ian 1 YAO Quan2hong 2 WAN Xiu2qing 3 YAN Pei2qiang 3 (1 Harbin Institute of Technology L ife Sciences & Engineering Dep t Harbin 150001, China) (2 Shanghai Academy of Agriculture Science Shanghai 201106, China) (3 Heilongjiang Tobacco Research Institute Mudanjiang 157011, China) Abstract Total RNA was isolated from the roots of A rabidopsis thaliana, and A tkup1 gene was amp lified using RT2PCR methods. The PCR p roduct was cloned into pmd182t, which named YF5501. After sequencing, the DNA fragment which containing A tkup1 gene was cloned into the p lant binary exp ression vector containing intron kanam ycin gene, and introduced into tobacco varieties by Agrobacterium mediated transformation. YF5501 contained the same sequence of A tkup1 gene ( Genebank No: AF029876). 29 transgenic p lants of tobacco were obtained and p roved by PCR, GUS, Southern blot and realtim e PCR analysis. The results of chem ical content assays confirmed that A tkup1 gene had been exp ressed effectively in the modified p lants and the potassium content in the tobacco leaves had been increased up to 45%. Key words A tkup1 Transgenic tobacco K + content