China B iotechnology, 2005, 25 (12) : 24 28 A tkup1 3 133 1 2 3 3 (1 150001 2 201106) (3 157011) RNA, RT2PCR,, Km ( ), A tkup1, PCR GUS Southern A tkup1 mrna PCR, PCR 2100bp, A tkup1 ( Genbank No: AF029876) ; GUS A tkup1 29 PCR A tkup1, PCR A tkup1 mrna A tkup1, 45% A tkup1 K +, [ 1 ],,,, [ 3 ], [ 1 ] 4% 5%, 3% 4%, 1% 2%, 2%, 2. 5% [ 4 ], [ 1, 2 ] A tkup1 (A rabidopsis thaliana K + : 2005210214 : 2005210224 3 (1102001011007) 33 : g_zk@ sohu. com up take) K + [ 5 ],, K +, K +, K + [ 6 ] A tkup1 A tkup1 1 1. 1 T/A pmd182t, ( Agrobacterium tum efaciens) LBA4404 Clontech, pcamb IA21201 DH5 (N icotiana tabacum ) 911 K326 1. 2 RNA T4 DNA Promega ; Ex2Taq DNA DNase I PCR SYBR RT2PCR Kit, Sigma AR 1. 3 A tkup1 cdna ( Kim 1998, Genbank No: AF029876 ), R217 (5 2AAAGGATCCAACAATGAACCAATCACCATCTCTTA TC23 ) R219 (5 2AAAGAGCTCTTAGACGTAATAAAC
2005, 25 (12) : A tkup1 25 CATTCCAAC23 ), B am H I SacI PCR : A tkup1z (5 2ACGCATAGAGTCGCCTTCATTTTCGCTCCAATC23 ) A tkup1f (5 2CGTCACGAAATGTCCGAAAACAGCTGG AACTCC23 ) ; mrna PCR : A tkup12s2f ( 5 2gTCCTCACTCCAACAATCTC23 ) A tkup12s2r ( 5 2ACCGGTGCTTCTAAGGAACT23 ),, PAGE 1. 4 A tkup1 Promega RNA ( RNAgents total RNA isolation system) RNA, Promega (Reverse Transcrip tion System ) cdna, R217 R219, Ex2Taq DNA PCR, PCR T2 ( pmd182t),, 1. 5 A tkup1 pcamb IA21201, B am H I SacI, A tkup1 pmd182t, T4 pcamb IA21201, A tkup1 pyf7783 1. 6, 5mm 5mm, 50m l OD 0. 3 0. 5 5 8 m in,, 9cm, MS0,, 22 3d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 50mg/L + Cb 250mg/L), 20d, ( 62BA 1. 0mg/L + NAA 0. 1mg/L + Km 100mg/L + Cb 250mg/L ) 30d,, Jefferson [ 7 ] GUS, GUS (1 /2MS + Km25mg/L + Cb 25mg/L ) 30d, 3 5d, 1. 7 A tkup1 PCR A tkup1 PCR : 94 6m in, 94 50 s, 62 60 s, 72 3m in, 30 ; 72 10m in A tkup1 PCR : 94 6m in, 94 30 s, 62 40 s, 72 1m in, 30 ; 72 10m in 1. 8 Southern M ichiels [ 8 ] DNA, PstI, 32P A tkup1 1. 9 PCR 1. 4 A tkup1 PCR, OD 260 DNA DNA 10 1 10 2 10 3 10 4 10 5 DNA, Promega RNA RNA, O ligo dt, SYBR λ RT2PCR Kit, A tkup12s2f A tkup12s2r, MJ Op ticon 2 PCR, mrna DNA PCR DNA Ct, mrna A tkup1 cdna 1. 10 A tkup1 A tkup1 T1,, A tkup1 PCR, RNA, PCR 1. 11,, ( 45kg/ha) (90kg/ha) ( 135kg/ha) A tkup1 PCR T1,,, 6 12, A lliance 2 2. 1 A tkup1 RNA R217 R219 PCR 2 100bp, V2GENE DNA,,
26 China B iotechnology Vol. 25 No. 12 2005 T/A pmd182t, YF5501, 2139bp, Genebank A tkup1 2. 2 A tkup1 A tkup1 pmd182t pcamb IA21201 B am H I SacI, T4 A tkup1 pcamb IA21201, A tkup1 pyf7785 ( 1),, SAR ( A llen, 1996, Genebank No. U67919), CaMV 35S + TMV Omega leader sequence Km, ; CaMV 35S + TMV Omega leader sequence nos A tkup1 2 A tkup1 PCR 2 PCR ana lysis of A tkup1 tran sform ed tobacco plan ts Lane1: DNA marker DL2 000; Lane2: Nontransformed tobacco p lants; Lane3: Positive control(a tkup1 gene ) ; Lane4 12: Transgenic tobacco p lants agarose, 32 P A tkup1 (B am H I SacI ) Southern, 29 GUS, ( 3), A tkup1 2 3 5 8 11, 4 6 7 10 12, 9, 2 3 5 8 11 1, 4 6 7 9 10 12 2 1 A tkup1 py F7785 1 Con struction of A tkup1 gene plan t expression vector py F7785 2. 3 GUS A tkup1, Km GUS 29 ( T 0 ), 911 (11 ) K326 (18 ) 2. 4 A tkup1 PCR GUS DNA, A tkup1z A tkup1f, A tkup1 PCR 2, 29 GUS 1. 0 kb 2. 5 A tkup1 Southern DNA PstII, 0. 7% 3 Sourthern 3 Sourthern blot ana lysis of tran sform ed plan ts Lane1: Nontransformed tobacco p lants; Lane2: Positive control ( YF7783 digested with PstI ) ; Lane3 12: Transgenic tobacco plants Note: Genom ic DNA were digested with PstI, followed by hybridization with A tkup1 gene p rob 2. 6 A tkup1 Southern 5, RNA 10 5 10 4 10 3 10 2 10 1 DNA DNA, PCR, 4 DNA S1 S2 S3 S4 S5 Ct
2005, 25 (12) : A tkup1 27 4 A tkup1 m RNA 5 A tkup1 PCR 4 The rea ltim e PCR testing of A tkup1 5 The standard curve of C t vs A tkup1 copes m RNA in tran sgenetic roots DNA 5, Y = 222X + 8. 77; r 2 = 0. 988, PCR, 1 1, A tkup1 5 T1 mrna, 4 1 3 5 mrna 2. 7 2 : 911 K326 4 1 m RNA Table 1 The mrna analysis of A tkup1 in transgenetic roots DNA template Ct Value copys of Target sequence Standard S1 17. 962 10 5 References S2 22. 35 10 4 S3 25. 559 10 3 S4 30. 609 10 2 S5 36. 614 10 1 S0 0 S0 39. 706 1. 45 Test 4 25. 612 1653. 07 samp les 1 25. 983 1373. 41 3 26. 201 1232. 18 5 26. 242 1206. 82 2 26. 917 861. 53 2 Table 2 The chem ica l con ten ts of A tkup1 tran sform ed tobacco leaves T 0 K 2 O ( % ) P 2 O 5 ( % ) N ( % ) Cl( % ) sugar( % ) nicotine ( % ) p rotein ( % ) LY91122 2. 63 0. 566 1. 38 0. 067 14. 70 1. 05 6. 24 LY91123 2. 41 0. 514 1. 27 0. 029 17. 54 1. 38 6. 51 LY91125 2. 58 0. 531 1. 49 0. 024 16. 13 1. 32 6. 50 LY91128 2. 52 0. 621 1. 29 0. 089 13. 20 1. 29 6. 86 K32621 2. 43 0. 549 1. 44 0. 039 15. 02 1. 26 6. 50 K32625 2. 20 0. 690 1. 35 0. 035 14. 68 1. 43 8. 30 K32626 2. 32 0. 536 1. 45 0. 038 16. 05 1. 26 9. 06 K32629 2. 55 0. 622 1. 36 0. 047 15. 88 1. 23 7. 01 LY9112ck1. 61 0. 532 1. 48 0. 056 19. 54 0. 81 7. 26 K3262ck 1. 76 0. 540 1. 41 0. 066 18. 27 1. 34 7. 09 - - - - + 0. 77 - - - - - - - - - - 3. 51 - - - -, 2. 45%, 45% ;, 18. 5%, 3,,,,,,,,
28 China B iotechnology Vol. 25 No. 12 2005,,,,,,,,, K +, A tkup1,, : A tkup1 45%, [ 1 ],.., 1993, 25 (3) : 119 128 Cao ZH H, Hu G S. Soil, 1993, 25 (3) : 119 128 [ 2 ],.., 1998, 4 (2) : 156 164 Huang SH W, Jin J Y. Plant Nutrition and Fertilizer Science, 1998, 4 (2) : 156 164 [ 3 ] Chaplin J R. Production factors affecting chemical compounds of the tobacco leaf. Recent Advances of Tob Sci, 1980, (6) : 3 63 [ 4 ] Sim s J L, CasyM, Legget J E, et al. Effect of transp lant water fertilization on growth and chem ical composition of burley tobacco. Annual Report of the College of Agriculture and the K Y Agri Exp Stn, 1981, 59 60 [ 5 ] Kim E J, Kwak J M, Uozum i N, et al. A tkup1: an A rabidopsis gene encoding high2affinity potassium transport activity. Plant Cell, 1998, 10 (1) : 51 62 [ 6 ] Fu H H. A tkup1: A dual2affinity K + transporter from A rabidopsis. The Plant Cell, 1998, 10 (1) : 63 73 [ 7 ] Jefferson R A, Kavanagh T A, Bevan M W. GUS fusions: beta2 glucuronidase as a sensitive and versatile gene fusion marker in higher p lants. EMBO J, 1987, 6 (13) : 3901 3907 [ 8 ] M ichiels A, Van den Ende W, Tucker M, et al. Extraction of high2quality genom ic DNA from latex2containing plants. Anal B iochem, 2003, 315 (1) : 85 89 [ 9 ] Ahn S J, Shin R, SchachtmanD P. Exp ression of KT / KU P genes in A rabidopsis and the role of root hairs in K + up take. Plant Physiology, 2004, 134 (3) : 1135 1145 Tran sgen ic Tobacco w ith A rabidopsis tha liana A tkup1 Gene Ha s H igh Pota ssium Con ten t in L eaves GUO Zhao2kui 1 YANG Q ian 1 YAO Quan2hong 2 WAN Xiu2qing 3 YAN Pei2qiang 3 (1 Harbin Institute of Technology L ife Sciences & Engineering Dep t Harbin 150001, China) (2 Shanghai Academy of Agriculture Science Shanghai 201106, China) (3 Heilongjiang Tobacco Research Institute Mudanjiang 157011, China) Abstract Total RNA was isolated from the roots of A rabidopsis thaliana, and A tkup1 gene was amp lified using RT2PCR methods. The PCR p roduct was cloned into pmd182t, which named YF5501. After sequencing, the DNA fragment which containing A tkup1 gene was cloned into the p lant binary exp ression vector containing intron kanam ycin gene, and introduced into tobacco varieties by Agrobacterium mediated transformation. YF5501 contained the same sequence of A tkup1 gene ( Genebank No: AF029876). 29 transgenic p lants of tobacco were obtained and p roved by PCR, GUS, Southern blot and realtim e PCR analysis. The results of chem ical content assays confirmed that A tkup1 gene had been exp ressed effectively in the modified p lants and the potassium content in the tobacco leaves had been increased up to 45%. Key words A tkup1 Transgenic tobacco K + content