2004 62 3 274 278 ACTA CHIMICA SINICA Vol 62 2004 No 3 274 278 a b a a Ξ a a Ξ ( a 300071) ( b 300070) 5 PCR PCR PCR 0 15 1 50 10 3 amol/ L R 2 = 0 9992 PCR (PCR) Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer HUANG Yan2Ping a b KONG De2Ming a ZHANG Xiao2Bin a SHEN Han2Xi Ξ a MI Huai2Feng a ( a State Key Laboratory of Functional Polymer Materials for Adsorption and Separation Chemical School Nankai University Tianjin 300071) ( b College of Pharmacy Tianjin Medical University Tianjin 300070) Abstract To specific target sequence of telomerase product a fluorogenic duplex scorpion primer has been designed A probe element attached at the 5 2end of it can specifically detect target gene A PCR blocker carbon chain with C 3 group whose length is as the same as a base pair is joined between the primer sequence and the probe in the duplex scorpion primer A fluorescence signal is only produced when the probe sequence is hybridized with the target gene in the extended duplex scorpion primer Using this technology a novel method has been developed for quantitative assay of telomerase product by real2time PCR Accurate quantitative assay can be achieved with sample detected within 0 15 1 50 10 3 amol/ L under fast cycling conditions The linear correlation factor R 2 = 0 9992 The method is specific simple and without post2pcr manipulation Keywords duplex scorpion primer telomerase real2time assay polymerase chain reaction (PCR) ( Telemetric repeat ( TTAGGG) amplification protocol TRAP) [2] (10 50 kb) TRAP (Polymerase chain reaction PCR) RNA [1] ; PCR Ξ E2mail : hxshen @eyou com Received September 24 2003 ; revised December 22 2003 ; accepted January 8 2004 (No 20075012)
No 3 : 275 1 3 TRAP PCR 1 3 1 PCR 2 5 L 10 TRAP [ 200 [3] mmol/ L Tris2HCl (ph = 8 3) 10 mmol/ L EGTA 630 mmol/ L [4] [5] [6] KCl 0 05 % Tween220 1 mg/ ml BSA ] 0113 L dntps [7] PCR (datp dttp dctp dgtp 10 mmol/ L) 2U Taq PCR 1 5 L MgCl 2 (25 mmol/ L) 1 4 L (75 g/ ml) PCR 0 5 L PP/ 2 5 L QP (25 mol/ L) 2 8 L (36 g/ ml) 2 L R5 25 L :95 3 min 1 ;94 30 s 60 30 s (real2time) 27 PCR 1 3 2 PCR 25 L PCR 12 % TRAP ( 130 V) 2 3 h PCR (ethidium bromide) PCR ( ) 1 3 3 25 L TRAP PP QP MgCl 2 ( 1 3 1) PCR :95 15 s 60 20 s 45 80 20 min (TaqMan2 [8] [9] ) (Duplex scorpion primer DSP) PCR 2 1 PCR Kim [10] TRAP DSP ( R5) DSP R5 1 1 1 GeneAmp R 5700 PCR ( ABI ) DF2D ( ) [ CCCTAA] [11] 3 ( UVI tec ) RF2540 ( PCR (PCR2blocker) ( ) 16 402F2Q210 ( Starna Brand) ) PCR 1 2 DSP ( Probe Primer PP ) : FAM25 2 2 5 PCR DSP PP 5 FAM ; QP DABCYL PP DSP [ CCCTAA] 3 2 2AATCCGTCGAGCAGAGTT23 ( ( 1 A) PCR ) ( 1 B) (Quencher probe QP) : 5 2[ TTAGGG] 3 23 2DABCYL DSP Taq : 5 2 ( 1 C) PCR DSP AATCCGTCGAGCAGAGTT23 : 5 2GCGCGG [ CT T2 ACC] 3 CTAACC23 ( ( 1 D) Michael Zuker mfold( PCR 3 1) [12] ) [10] ( ) R5 : 5 2 AATCCGTCGAGCAGAGTTAG[ GGTTAG] 4 23 (molecularbeacon) PP
276 Vol 62 2004 QP PCR PCR T m PP QP DSP 2 3 PP QP DSP PP DSP FAM 495 nm ; QP DABCYL 479 nm DSP PP QP [13] DSP DABCYL FAM 1 DSP Figure 1 Assay principle of DSP 2 2 DSP 2 DSP QP 3 DSP Figure 3 Absorption spectra of DSP 1 PP ; 2 QP ; 3 DSP PP 2 4 QP PP DSP T m = 59 5 1 5 mmol/ L MgCl 2 TRAP PP 0 3 mol/ L QP 95 5 min : E ff = [ 1 - ( F q - F b ) / ( F uq - F b ) ] 100 % [14] F uq F q F b PP PP QP ( 1) QP PP > 1 97 % PCR QP QP PP 5 1 PP QP DSP 2 DSP (1) (2) 2 5 DSP Figure 2 Fluorescence melting curve (1) and the derivative curve (2) DSP TRAP of DSP
No 3 : 277 c (QP) c (PP) 1 DSP Table 1 Quenching efficiencies of DSP 1 1 2 1 3 1 4 1 5 1 PCR :95 3 min 1 94 0 s 45 3 s 40 E ff 97 2 97 3 97 6 97 6 97 8 PCR R5 DSP PCR ( 4) DSP DSP ; (50bp 56bp R5 21 27 ) [10] DSP 5 DSP R5 (amol/ L) DSP DSP Figure 5 Amplification plots using DSP for quantitative assay of R5 18 DSP (amol/ L) 2 7 PCR R5 10 6 0 15 1 50 10 4 amol/ L DSP PCR 0 15 1 50 10 3 amol/ L R5 C T ( 6) R 2 0 9992 ; 0 15 amol/ L 4 (1 4) DSP (5 8) 1 2 5 6 ; 3 4 7 8 R5 Figure 4 Gel electrophoresis of PCR products using upstream primer (1 4) or DSP (5 8) 1 2 5 6 water as reference ; 3 4 7 8 R5 as template 2 6 PCR DSP 1 s [14] ( 94 6 DSP TRAP R5 0 s 0 s 3 s 100 ) Figure 6 Standard curve for detection of R5 using the DSP by TRAP PCR 60 [10] assay (53 50 45 ) PCR 45 PCR PCR ( 5) 3 Whitcombe [15 16] PCR ( C T ) PCR PP TaqMan 40 C T Solinas [17] 40
278 Vol 62 2004 5 Uehara H ; Nardone G ; Nazarenko I ; Hohman R J Biotechniques 1999 26 552 PCR ( HEG) 6 Szatmari I ; Tokes S ; Dunn C B ; Bardos T J ; Aradi C 3 (DABCYL) J Anal Biochem 2000 282 80 DSP PCR PCR 7 Xu S ; He M ; Yu H ; Cai X ; Tan X ; Lu B ; Shu B Anal Biochem 2001 299 188 8 Kong D2M ; Gu L ; Shen H2X ; Mi H2F Acta Chim Sinica 2003 61 755 (in Chinese) ( 2003 61 755 ) 9 Kong D2M ; Shen H2X Chin J Chem 2003 21 556 10 Kim N W ; Wu F Nucleic Acids Res 1997 25 2595 11 Hultdin M ; Grgnlund E ; Norrback K F ; Eriksson2 References 1 Granger M P ; Wright W E ; Shay J W Crit Rev Oncology/ Hematology 2002 41 29 2 Kim N W ; Piatyszek M A ; Prowse K R ; Harley C B ; West M D ; Ho P L ; Coviello G M ; Wright W E ; Weinrich S L ; Shay J W Science 1994 266 2011 3 Hirose M ; Abe2Hashimoto J ; Ogura K ; Tahara H ; Ide T ; Yoshimura T J Cancer Res Clin Oncol 1997 123 337 4 Gelmini S ; Caldini A ; Becherini L ; Capaccioli S ; Pazzagli M ; Orlando C Clin Chem 1998 44 2133 Lindstrgm E ; Just T ; Roos G Nucleic Acids Res 1998 26 3651 12 http :/ / www bioinfo rpi edu/ applications/ mfold/ old/ dna/ form1 cgi 13 Fang X H ; Li J J ; Perlette J ; Tan W H ; Wang K M Anal Chem 2000 72 747A 14 Tyagi S ; Kramer F R Nat Biotechnol 1996 14 303 15 Whitcombe D ; Theaker J ; Guy S P ; Brown T ; Little S Nat Biotechnol 1999 17 804 16 Thelwell N ; Millington S ; Solinas A ; Booth J ; Brown T Nucleic Acid Res 2000 28 3752 17 Solinas A ; Brown L J ; McKeen C ; Mellor J M ; Nicol J T G ; Thelwell N ; Brown T Nucleic Acids Res 2001 29 e96 (A0309243 PAN B F ; FAN Y Y )