2008,22 (1) :41 44 Journal of Nuclear Agricultural Sciences 41 :100028551 (2008) 012041204 BcMF14 p 1,2 1 (11, 310029 ;21, 236032) : BcMF14,,, BcMF14 p ( : EF523517), 273 bp,, 222, 73 NCBI, 86 %RT2PCR, BcMF14 p,, BcMF14 p : ; BcMF14 p ; (RALF) ; MOLECULAR CHARACTERIZATION AND EXPRESSION PATTERN OF RALF2LIKE GENE BcMF14 p FROM Brassica campestris var. purpurea LI Yan2yan 1,2 CAO Jia2shu 1 (11 Institute of Vegetable Science, Zhejiang University, Hangzhou, Zhejiang 310029 ; 21 Department of Biology, Fuyang Normal College, Fuyang, Anhui 236032) Abstract :The rapid alkalinization factor ( RALF) gene is one of polypeptide signals. In this study BcMF14 p was cloned from Brassica campestris ssp. chinensis var. purpurea based on BcMF14 from B. campestris ssp. chinensis var. communis cv. Aijiaohuang. The sequence of this gene was 273bp ( GenBank accession number EF523517), including a 222 bp ORF, colding 73 amino acids. It considered as RALF2like protein according to its high identity with B. oleracea var. botrytis BoRAL F1 and Arabidopsis thaliana RAL F28 in nucleotide sequence ( > 86 %). RT2PCR discovered that BcMF14 p was expressed prominently in flower buds, flower and silique, but no expression in vegetative organs, this indicated that BcMF14 p may be involved in the signal transduction during reproduction development of B. campestris var. purpurea. Key words : Brassica campestris ssp. chinensis var. purpurea ; BcMF14 ;rapid alkalinization factor ;gene expression (rapid alkalinization factor, RALF) 1991 (systemin) [1 ], ( PSK) RALF ( ENOD40) CLV3 S (SCR) 6 [2 6 ],RALF 2001 [3 ], 20 RALF, :2007204229 :2007207226 : (30671426) (2005C12019202) : (19762),,,,, E2mail :liyanyan1976 @yahoo. com. cn : (19582),,,,, Tel :0571286971188 ; E2mail : jshcao @ zju. edu. cn
42 22 ;,, [7 ] RALF,( Populus trichocarpa P. deltoides) 5 RALF [8 ] RALF 39 [9 ],12 EST RNA [10 ], RALF [3 ] RALF,,, EcoRI, Germain 5 RALF, ScRAL F1 ScRAL F3, [7 ] Bedinger RALF ( PRAL F),, [11 ] RALF ( BoPRAL FL1) [12 ],, RALF ( Brassica campestris L. ssp. chinensis Makino var. communis Tsen et Lee cv. Aijiaohuang), BcMF14 ( BcRAL F1) ( GeneBank Accession NO. EF523516),, RALF [13 ], ( B campestris ssp. chinensis var. purpurea Hongshan ),, p GEM2T2 easy2vector, Promega, E. coli DH5 112 11211 DNA DNA [ 14 ] BcRAL F, p1 : 5 2 CGTATGGGGGATGTCTGAAAGT23 () p2 : 5 2GTAAAATTAACCAAGGGTGGTG23 (), DNA, PCR PCR :DNA 015 l,10 PCR 5 l,25mmolπl Mg 2 + 4 l,20 molπl p1 p2 1 l,10mmolπl dntps 1 l, 5UΠ l Taq 015 l, 50 l PCR :94 2min ;94 30s,56 30s,72 2min,35 ;72 7min,4 110 % 270bp PCR, p GEM2T2easy2vector Promega p GEM2T2 easy2vector E. coli DH 5 270bp, 11212 ClustawL DNA star http :ΠΠwww. EMBL2Heidelberg. de ; http :ΠΠwww. expasy. orgπprosite 11213 NCBI, BLAST, RALF RAL F TreeView 11214, ( : < 110mm ; : 1 116mm ; : 116 212mm ; : 212 218mm ; : > 218mm ) Invitrogen TRIzoL, RNA, cdna cdna, p1 p2 RT2PCR, PCR 1 : p1 p2 2 l, Taq Buffer (10 ) 5 l,mg 2 + (25mmolΠL ) 4 l,dntps (10mmolΠL) 1 l,taq 111 2U ( Promega), ddh 2 O 50 l PCR : 94,2min ; 94 30s ; 56 30s ; 72 1min,30 ;72 10min 2actin, 2actin pactin1 : 5 2 TCGGAATGGGCCAGAAGGAC23 pactin2 : 5 2 TCCACGTCGCACTTCATGATG23 2 211 BcMF14 p DNA, p1 p2 PCR,PCR, 270bp
1 BcMF14 p 43 ( 1), p GEM2T2easy2vector, E. coli DH 5,, 1 BcMF14 p PCR Fig. 1 Amplication results of BcMF14 p M:1 kb ;1 : ; 2 :DNA M: 1 kb DNA marker ; 1 : CK with ddh 2 O as templete ; 2 : amplified product with DNA as template, DNA 273 ( : EF523517) DNAstar, 222bp, BcMF14 p 73,8080139 Da, 71792, ph 710 11291 ; ( K R) 10 ; (D, E) 9 ; (A I L F W V) 26 ; (N C Q S T Y) 19 ProtScale Kyte Doolittle BcMF14 p N, SignalP2NN SignalP2HMM ( http :ΠΠwww. isv. cnrs2 gif.frπterminator2), BcMF14 p RALF N, 28 29 ( 2) (http :ΠΠwww. expasy. orgπprosite) BcMF14 p, N - ( 2 7 64 69 ), C ( 6 8 52 54 ), II ( 24 17 ) ( 54 61 ) BcMF14 p 2 BcMF14 p Fig. 2 Nucleotide and deduced amino acid sequences of BcMF14 p BcMF14 p ORF 222bp, 73,ORF, N -, C, II, The ORF of BcMF14 p gene is composed of 222 base pairs coding 73 amino acids. ATG (initiation codon) and TGA (stop codon) are shown in frame. Shaded regions are N2myristoylation sites, double underlined are 2 Protein kinase C phosphorylation sites, underlined sequences is casein kinase II phosphorylation site, italic is tyrosine kinase phosphorylation site. 212 BcMF14 p BLAST, BcMF14 p RALF BcMF14 BoRAL FL1 RAL FL8 RAL FL9 cdna, 86 % 88 % 86 % 85 % BcMF14 p ExPASy Proteomics Server, TreeView BcMF14 p ( Brassica Campestris ) ( Arabidopsis ) ( Oryza) ( Populus ) ( Nicotiana ) ( Solanum) 4 5 RALF, ( 3) 3 BcMF14 p BoRAL FL1 ( Q4TTZ9), ArRAL FL ( AAM65793), NaRAL F (
44 AF407278) RAL F2 ( AAO27367) OrRAL FL (ABA99460),,, 3 BcMF14p RALF (, ) Fig. 3 A phylogenetic tree based on the RALF amino acids ( Enghish names in the figure : genus, gene) 213 BcMF14 p cdna, p1 p2 RT2PCR, 2actin, 4 BcMF14 p BcMF14 p : 3, 4, 5,,, BcMF14 p 4 BcMF14 p Fig. 4 RT2PCR analysis of the expression pattern of BcMF14 p Fb1 Fb5 F Si Sc L 1 5 ; 2actin Fb1 Fb5, F, Si, Sc, L indicate stage 1 5 of flower bud, open flower, germinal silique, scape and leave of Brassica campestris var. purpurea respectively ; 2actin is internal control 3,,, RALF 2001 RALF BcMF14 p, BcMF14 p BcMF14 p,,c,, [15 ] N - II [16,17 ] BcMF14 p, RALF, BcMF14 p, BcMF14 p : [ 1 ] Ryan C A, Pearce G. Systemin :a polypeptide signal for plant defensive genes. Annu Rev Cell Dev Biol, 1998, 14 : 1 17 [ 2 ] Yang H, Matsubayashi Y, Hanai H, et al. Molecular cloning and characterization of OsPSK, a gene encoding a precurso. Plant Mol Biol, 2000, 44 (5) : 635 647 [ 3 ] Pearce G, Moura D S, Stratmann J, et al. RALF, a 52kDa ubiquitous polypeptide in plants, arrests root growth and development. Proc Natl Acad Sci USA, 2001, 98 (22) : 12843 12847 [ 4 ] Martin D C, Jurkevitch E, Poiret M, Yves d Aubenton2Carafa, Petrovics G, Kondorosi E, Kondorosi A. enod40, a Gene Expressed During Nodule Organogenesis, Codes for a Non2Translatable RNA Involved in Plant Growth. EMBO J, 1994, 13 : 5099 5112 [ 5 ] Clark S E, Running M P, Meyerowitz E M. CLAVATA1, a regulator of meristem and flower development in Arabidopsis. Development, 1993, 119 : 397 418 Journal of Nuclear Agricultural Sciences 2008,22 (1) :41 44 [ 6 ] Christel R S, Nasrallah M E, Nasrallah J B. The Male Determinant of Self2Incompatibility in Brassica. Science, 1999, 5445 : 1697 1700 [ 7 ] Germain H, Chevalier E, Caron S, Matton D. P. Characterization of five RALF2like genes from Solanum chacoense provides support for a developmental role in plants. Planta, 2005, 220, 447 454 ( 31 )
Journal of Nuclear Agricultural Sciences 2008,22 (1) :28 31, Vantuyl, 1000Gy 2500Gy [4 ], cordelia, cordelia,, cordelia, cordelia, [9 ],, [10,11 ], : cordelia, [12 ], ;,, () [10 ] :,, [ 1 ] Van Tuyl J M, Van Holsteijn H C M. Lily breeding research in the Netherlands. Acta Hortic,1996,414 :35 45 [ 2 ] Asano Y, Myodo H. Studied on crosses between distantly related species of lilies I. For the intrastylar pollination technique. J Japan Soc Hor Sci, 1977,46 (1) :59 65 [ 3 ] Hopper J E, Ascher P D, Peloquin S J. Inactivation of self2 incompatibility following temperature pretreatment of styles in longiflorum. Euphytica, 1967,16 :215 220 lilium [ 4 ] Van Tuyl J M, Clara Marcucci M, Visser T. Pollen and pollination experiments. VII. The effect of pollen treatment and application method on incompatibility and incongruity in lilium. Euphytica, 1982,31 :613 619 [ 5 ] Van Tuyl J M, Van de Sande K, Van Dien R, et al. Overcoming interspecific crossing barriers in lilium by ovary and embryo culture. Acta Hortic,1990,266 :317 322 [ 6 ] Hayashi M, Kanoh K, Serizawa Y, et al. Ovary slice culture of lilium forumosanum Wallace. Japan.J Breed,1986,36 :304 308 [ 7 ] Kanoh K, Hayashi M, Serizawa Y, et al. Production of interspecific hybrids between Lilium longiflorum and L. elegance by ovary slice culture. Japan J Breed, 1988,38 :278 282 [ 8 ] Asano Y Studies on crosses between distantly related species of lilies. Characteristics of Newly Obtained through embryo culture. J Japan Soc Hort Sci, 1980,49 (2) :241 250 [ 9 ].. :,1995,330 332 [10 ] Van Tuyl J M, V Van Dien M P, Van Creij M GM, etal. Application of in vitro pollination,ovary culture,ovule culture and embryo rescue for overcoming incongruity barriers in interspecific lilium crosses. Acta Hortic,1991 :115 126 [ 11 ] Van Tuyl J M, Van Dijken A, Chi H S, et al. Breakthroughs in interspecific hybridization of lily. Acta Hortic,2000,508 :83 88 [12 ],,,..,2006,33 (3) :653 656 31 ( 44 ) [ 8 ] Haruta M, Constabel C P. Rapid alkalinization factors in poplar cell cultures. Peptide isolation, cdna cloning, and differential expression in leaves and methyl jasmonate2treated cells. Plant Physiol, 2003, 131, 814 823 [ 9 ] Olsen A N, Mundy J, Skriver K. Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs. In Silico Biology, 2002, 2 (4) : 177 180 [10 ] MacIntosh G C, Wilkerson C, Green P J. Identification and analysis of Arabidopsis expressed sequence tags characteristic of non2coding RNAs. Plant Physiol, 2001, 127 (3) : 765 776 [11 ] Bedinger P, Parsons R, Clark M, Covey P, Arthur2Asmah R. PEX proteins, pollen specific LRX (Leucine2Rich Repeat Extensin Chimera) proteins. Proceedings of the 7th International Congress on Plant Molecular Biology. Barcelona Spain, 2003, S20 S69 [12 ],,,. RALF., 2006, 33 : 561 565 [13 ],,. RALF., 2006, 23 : 1 4 [14 ],,. DNA RAPD.,1995,22 : 47 52 [15 ] Park J, Hill M M, Hess D, Brazil D P, Hofsteenge J, Hemmings B A. Identification of tyrosine phosphorylation sites on 32phosphoinositide2 dependent protein kinase21 and their role in regulating kinase activity. J Biol Chem,2001, 276 : 7459 37471 [16 ] Lin R, Hiscott J. A role for casein kinase II phosphorylation in the regulation of IRF21 transcriptional activity. Mol Cell Biochem, 1999, 191 : 169 180 [17 ] Boisson B, Giglione C, Meinnel T. Unexpected protein families including cell defense components feature in the N2myristoylome of a higher eukaryote. J Biol Chem,2003, 278 : 4341 43429