ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :636 641 DNA,,, 3,, ( DNA, 130023) DNA 2 000 5 000 ( :M89, M11, M12 AM4), DNA MTND 4 11 210 11 414 (205 bp) RegionV 8 196 8 316 (121 bp),, 11 248,11 249,11 283 11 293, M11 M12, M89 AM4 M11 M12 DNA,,, Q75,Q986 Extraction, Amplification and Sequence Analysis of Xiajiadian Ancient Human Bone D NA WAN Cheng,CUI Yin2qiu,DUAN Ran2hui,ZHOU Hui 3,ZHU Hong,LI Wei ( Ancient DNA Laboratory, College of Life Sciences,Jillin University, Changchun 130023, China) Abstract Ancient DNA was extracted from human bone remains (varying in age from about 2 000 to 5 000 years old) recovered from the archaeological sites Two mitochondrial DNA fragments from 11 210 to 11 414 (205 bp) and from 8 196 to 8 316 (121 bp) were amplified from the extracts using the polymerase chain reac2 tion ( PCR) and sequenced directly Evidence is presented that the amplified sequences are authentic and do not represent contamination by extraneous DNA The result shows that 11 248,11 249,11 283 and 11 293 are highly variable sites and M11 and M12 have high homogeneity, but M89 and AM4 have lower homogene2 ity compared with M11 and M12 there are remnents of genetic information in the ancient bone DNA, which have important implication for anthropology,archaeology and molecular evolution Key words ancient human bone DNA,extraction,sequence analysis,homology 3,,, ( 1984 Higuchi [1 ] 100 ), ( (quagga), DNA ) DNA,Paabo [2 ], DNA DNA,, DNA,, 112, 315 bp 226, :2001201211, :2001203214 3 Tel : (0431) 8921591,Fax : (0431) 8921591,,,,1974 3, Received :January 11,2001 ;Accepted :March 14,2001, 3 Corresponding author Tel : (0431) 8921591,Fax : (0431) 8921591
5 : DNA 637 bp DNA ( 18 S rrna ) [3 ] ; PCR DNA 600 (control region) [4 ] : 3 4 [5 DNA, ], DNA 2, 2 000 5 000 DNA, DNA,, [6 ] DNA,, DNA, 1 1988, Paabo [7,8 ] PCR ( ) DNA 111 7000 92 4 DNA, DNA (Table 1) Table 1 The sample used in the extraction of ancient DNA Sample No Type of material Site of excavation Approximate age M89 Femur The remain of Xishan in the Zhengzhou of Henan province The later period of Yangshao culture belonging to Neolithic age about 5000 years M11 Humerus The remains of longtoushan in Kesiketengqi of Ne2 imenggu Xiajiadian upper culture belonging to bronze age 2 500 3 000 years M12 Femur The remains of longtoushan in Kesiketengqi of Ne2 imenggu Xiajiadian upper culture belonging to bronze age 2 500 3 000 years AM4 Femur The remains of Sandouwan in chayouhouqi of Nei2 menggu Donghan times about 2000 years 112 11211, HCl,pH614) (5) (4) (6) 10 000 g 15 s,,, 1 ml 70 % 1 (7), 1 (8) 56 10 min 2 3 mm, 65 l DNA,,, - 20,, 11213 (PCR),, - 20 11212 1993 Paabo [9 ] DNA Table 2, : (1) 015 g PCR : 67 mmolπl Tris2HCl 1 ml (10 molπl GuSCN,011 molπ 1 ml (10 molπl GuSCN,011 molπl Tris2 DNA DNA, PCR (ph 818), 2 mmolπl MgCl 2, 1 mmolπl dntps 113 L Tris2HCl ph614,0102 molπl EDTA ph810,113 % Tri2 mgπml BSA,015 molπl, 30 ton X2100), 60 5 l, 1 U Taq DNA, 30 6 h (2) 500 l 94 1 min,55 45 (3) 500 l 40 l s,72 1 min (4) 10 000 g 15 s, 3
638 17 Table 2 The primers used in PCR amplification Primer 3 Sequence Length (bp) Reference L8215 H8297 L11230 H11396 5 2AGAGTTTCATGCCCATCGCT23 121 Handt et al (1996) [4 ] 5 2ATGCTAAGTTAGCTTTACAG23 Handt et al (1996) [4 ] 5 2TCTACACCCTAGTAGGCTCC23 205 Handt et al (1996) [4 ] 5 2GCTTAGGGAGTCATAAGTG23 Handt et al (1996) [4 ] 3 Note :The numbers give the 3 2ends of the primers according to Anderson et al [11 ] l PCR, Taq DNA 115, - 20 PCR PCR PCR, 11214 2 % 1 TAE 2 % ( 015 gπ ml), 1 TAE, PCR, 5 VΠcm 9 l PCR 1 l 10, 2 l Gene Ruler TM 100 bp DNA ldder,254 nm, 11215 PCR 2 %,, NucleoTrap R DNA Purification Kits (Clontech) PCR, PCR,, fmal R DNA Cycle Sequen2 ceing System( Promega) 2 211 2 Fig 1 2 (205 bp 121 bp) 11 283,11 284 (CA TG) ; M89 DNA, 11 248 11 249 ( CT TC) 11 293 ( C G) DNA 11 381 (C G) (Fig 2) DNA Region (8 196 8 316, 121 bp) 212 DNA trna 205 bp 9 bp 121 bp,205 bp (11 210 11 414) DNA (CCCCCTCTA) Region MTND4,, NADH 11 248 Region 9 11 249, bp : mtdna 4 205 bp DNA Fig 1 PCR amplification of mtdna (A :205 bp ;B :121 bp) from samples 2 6 1 DNA marker ; 2 DNA from blank control ; 3 DNA from sample M89 ; 4 DNA from sample M11 ; 5 DNA from sample M12 ; 6 DNA from sample AM4 AM4 11 248 11 284 [11 ] ( CT TC), 11 283 11 284 (CA TG) ; M11 11 248 (C T) 11 283 11 284 (CA TG) 11 345 ( G C) ; M12 11 248 ( C T)
5 : DNA 639 Fig 2 Sequences alignment for 2052base2pair sequence obtained from eight extracts with the published the fragment of MTND4 gene The italic boldfaced nucleotide indicates variation site Fig 3 Sequences alignment for 1212base2pair sequence obtained from eight extracts with the published the fragment of Region gene The italic boldfaced nucleotide indicates variation site The underline illustrates two direct repeats of 9 bp 4 121 bp 213, 4, Clustal X 4 Am4 8 521 ( G (Fig 3) [11 ] C),8 270 (C T) 8 280 (A T), M89 3, M11 8 232 ( T A) (Fig 4) M89 8 264 (T C), M11 M12 AM4
640 17 Fig 4 Analysis of homology of the mitochondrial DNA fragment in the four ancient bones : longtoushan ( M11 M12), Sandouwan (Am4),Xishan(M89) ( 2 ) PCR, Taq, PCR DNA PCR,, 3, PCR PCR, 3, DNA, ( ), Centricon30 (Amicon) SiO 2, 3 DNA 311,, DNA DNA 156, 312 DNA( ) DNA, DNA,, (,, ), PCR,,, DNA : ( ) PCR, DNA DNA, DNA, PCR, DNA DNA, DNA ( ) DNA, ( ) DNA, :, ( ) ( ) 313 ( ) ( ) 3 ( ), : ( ) - 20, 3 : PCR PCR DNA, ( ) DNA, DNA,, PCR DNA PCR PCR, PCR PCR, PCR ( Taq )
5 : DNA 641,,,, DNA ( References) 1 Higuchi R,Bowman M, Frieiberger M, Ryder O A,Wilsom A C DNA sequences from the quagga,an extinct member of the horse family Na2 ture,1984,312 :282 284 2 Paabo S Molecular cloning of ancient Egyptian mummy DNA Nature, 1985,314 :644 645 3 Cano R J,Poinar H N,Piemazek N J,Acra A,Poinar Jr GO Amplifica2 tion and sequencing of DNA from a 12021352million2year2old weevil Nature,1993,363 :536 700 4 Handt O,krings M,Ward R H,Paabo S The retrieval of ancient human DNA sequences Am J Hum Genet,1996,59 :368 376 5 Poinar H N, Hofreiter M,Spaulding G,Martin P S, Stankiewicz B A, Bland H, Evershed R P, Possnert G, Paabo S Molecular coproscopy : drug and diet of the extinct groud sloth nothrotheriops shastensis Sci2 ence,1998,281 :402 406 6 Paabo S,Higuchi R Ancient DNA and the polymerase chain reaction J Biol Chem,1989,264(17) :9707 9712 7 Paabo S Ancient DNA : extraction, characterization, molecular cloning and enzymatic amplification Proc Natl Acad Sci USA,1989,86 :1936 1943 8 Paabo S Gifford J A,Wilson A C Mitochondrial DNA sequences from a 70002year old brain Nucleic Acids Res,1988,16 (20) :9775 9787 9 Hoss M,Paabo S DNA extraction from Pleistocene bones by as silica2 based purification method Nucleic Acids Res, 1993, 21 ( 16) : 3913 3914 10 Boom R,Sol C J A,Salimans M M,Jansen C L,Wertheim2van Dillen P M E,Noordaa J Rapid and simple method for Purification of nucleic ac2 ids J Clin Microbiol,1990,28(3) :495 503 11 Anderson S,Bankier A T,Barrell B G,de Bruijn M H L,Coulson A R, Drouin J,Eperon I G,Nierlich D P,Roe B A,Sanger F,Schreier P H, Smith A J H,Staden R,Young 1 G Sequence and organization of the hu2 man mitochondrial genome Nature,1981,290 :457 465