http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology breast cancer resistance protein BCRP ATP p53 p53

Σχετικά έγγραφα
Journal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology HBx HBxΔ127

Cellular Physiology and Biochemistry

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology H 2 O 2 AKT2 TUNEL DNA ladder AKT2 sirna PI3K / AKT

High mobility group 1 HMG1

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

ACTA CHINESE MEDICINE. diabetic nephropathies DN 24. urine protein quantitation in 24 hours 24hUTP serum creatinine Scr

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

NF-κB TSLP. Expression of TSLP and NF-κB in patients with adenomyosis

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΣΤΙΣ «ΚΛΙΝΙΚΕΣ ΚΑΙ ΚΛΙΝΙΚΟΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΤΡΙΚΕΣ ΕΙΔΙΚΟΤΗΤΕΣ»

Η ΦΛΕΓΜΟΝΩ ΗΣ ΑΝΤΙ ΡΑΣΗ ΤΟΥ ΓΑΣΤΡΙΚΟΥ ΒΛΕΝΝΟΓΟΝΟΥ ΣΤΗ ΛΟΙΜΩΞΗ ΜΕ ΕΛΙΚΟΒΑΚΤΗΡΙ ΙΟ ΤΟΥ ΠΥΛΩΡΟΥ ΠΡΙΝ ΚΑΙ ΜΕΤΑ ΤΗ ΘΕΡΑΠΕΙΑ

Το Βιολογικό Ρολόι: Θεµελιώδης Ρυθµιστής της Φυσιολογίας των Οργανισµών

A X All-trans retinoic acid ATRA LS174T

Construction and Evaluation of Lentiviral Vector pita-hbp1

nasopharyngeal carcinoma NPC 30% 20% CNE-2R CNE-2 Human-6v3. 0 CNE-2R 2 CNE-2R CNE-2 2 Toll

Science of Sericulture

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Aβ42 Alzheimer's disease AD insulin degrading enzyme IDE.

30s 56 60s 72 60s dntp cm s s s 23

Chapter 1. Fingolimod attenuates ceramide induced blood-brain barrier dysfunction in multiple sclerosis by targeting reactive astrocytes

TGFp FSH INH INH

Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1

Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

BGP TRACP-5b BGP TRACP-5b P 0.05

Chinese Journal of Biochemistry and Molecular Biology RNA.

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Biapenem BIPM Lot No g mg

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Chinese Journal of Biochemistry and Molecular Biology. p38mapk

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

HepG hotmail. com. HepG2 Bid Bcl-2. HepG2 G0 /G1 Bid Bcl-2. HepG2. HepG2

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

19 Ενδοκρινολόγος. Φάρµακα που στοχεύουν το β- κύτταρο ΕΥΡΥΔΙΚΗ ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΙΣΑΓΩΓΗ ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Supporting Information

Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου. Ερευνήτρια Β βαθμίδας. B.Sc.

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Cdk6 Cdk6

Shiraia sp. Slf14 III

Differential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection

Survivin sirna. Inhibitory effect of small interference RNA targeting survivin nanospheres on human pancreatic carcinoma BXPC-3 cell growth

Βιταμίνη D και καρκίνος

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

4T1 BALB /c Western GFP. Establishment of a mouse mammary cancer model stably expressing human HER2 / neu gene and luciferase gene

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Vol. 35 No Journal of South-Central University for Nationalities Nat. Sci. Edition Jun TNFα. . MDSCs

0. 35g kg ~ 2. 0cm 10min. Nar- 15μL 6mm

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

GDNF 220YL) 2,52. (glial cell line2de2. 015d 15d rived neurotrophic factor GDNF) 1993 Lin B49 (L15) (FBS) (poly2l2lysin, pll) (laminin, LN) GDNF GDNF

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology

SUPPLEMENTARY INFORMATION

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

Effect of extract method on pharmacokinetics of baicalin and berberine in dogs

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

B16F10 SDS-PAGE. Annexin V-FITC /PI

Chinese Journal of Biochemistry and Molecular Biology. psilencer 2. 0-FucT Ⅶ 2

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 1 retinoblastoma gene 1 RB1 NMD

Chinese Bulletin of Life Sciences. mtor mtor mtor. mtor signaling pathway and cancer. ZHENG Jie

coronary heart disease CHD 40% [1] atherosclero- sis AS 52.27±5.3 2~6. / polycyclic aromatic hydrocarbons PAHs

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

KLT SMMC Anti - tumor effect in vitro of coix seed oil injection on the human liver cancer cell SMMC and the mechanism study

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

ΜΕΤΑΠΤΥΧΙΑΚΗ ΕΡΕΥΝΗΤΙΚΗ ΔΙΑΤΡΙΒΗ

w o = R 1 p. (1) R = p =. = 1

MSM Men who have Sex with Men HIV -

Nguyen Hien Trang* **

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology ELISA Tnf-α mrna Il-1β mrna TNF-α IL-1β 12 h

Conductivity Logging for Thermal Spring Well

SABiosciences PCR Array Catalog #: PAHS-021 SA+ SCF 4h stimulaton AVG(Ct) Position Unigene Refseq Symbol Description shcontr shcontr-4h shgskβ A01

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Κόπωση και ποιότητα ζωής ασθενών με καρκίνο.

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Chinese Journal of Biochemistry and Molecular Biology. CHO., 3 hfgl2p ( ) LUC hfgl2p ( - 997) LUC hfgl2p ( - 816) LUC ; hfgl2p (2468)LUC

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΓΡΟΤΙΚΗΣ ΟΙΚΟΝΟΜΙΑΣ & ΑΝΑΠΤΥΞΗΣ

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression.

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology

Effects of ginkgolide B on the development of embryonic rat midbrain neurons

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

< (0.999) Graft (0.698) (0.483) <0.001 (0.698) (<0.001) (<0.001) 3 months (0.999) (0.483) (<0.001) 6 months (<0.

M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

Transcript:

ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 2 28 2 152 ~ 157 p53 * 414000 breast cancer resistance protein BCRP ATP p53 wild type p53wt-p53 MCF-7 wt-p53 -κb nuclear factor-κbnf-κb BCRP p53 Saos-2 wtp53 BCRP p53 wt-p53 BCRP MatInspector BCRP p53 IκB Saos-2 NF-κB Saos-2 NF-κB p53 BCRP p53 Saos-2 BCRP NF-κB p53 -κb R730 Q753 Transcriptional Regulation of Breast Cancer Resistance Protein BCRP by p53 in p53-null Saos-2 cells WU Xin-Gang * PENG Shu-BinL Si-PingZHANG Nian-FengZOU Jin Department of Basic Medical SciencesYueyang Higher Vocational and Technical CollegeYueyang 414000Hunan China Abstract Breast cancer resistance protein BCRP is a member of the ATP-binding cassette ABC transporter superfamily BCRP confers drug resistance in cancer by transporting chemotherapeutic agents such as mitoxantronetopotecanand methotrexate Although a recent study demonstrated that wild type p53 wt-p53 may suppress BCRP expression through the nuclear factor-κb NF-κB pathway in breast cancer cell line MCF-7which expresses wt-p53 at low levelthe detailed molecular mechanisms of transcriptional regulation on BCRP remain unclear Herewe set out to reveal the exogenous p53's role on the expression of BCRP In the human osteosarcoma cell line Saos-2a p53-null cell linetransient transfection assays showed that the BCRP expression was activated by wt-p53 but not p53 mutants p53 R175H and p53 R248W We further co-transfected the p53 expression plasmid with BCRP luciferase promoter reporter construct into the Saos-2 celland the results revealed that wt-p53 may facilitate the BCRP promoter activity Howeverwe did not find any p53 binding site by applying MatInspector StrikinglyNF-κB activity inhibition downplayed the activation effect of BCRP promoter activity by wtp53 These results suggested that transcriptional activation of BCRP by wt-p53 is NF-κB- dependent Key words breast cancer resistance protein BCRP p53 nuclear factor-κb NF-κB 2011-11-22 2011-12-27 No YZ1104G * Tel 13873069242 E-mail wu_alwin@ yahoo com cn Received November 22 2011 Accepted December 27 2011 Supported by Yueyang Higher Vocational and Technical College No YZ1104G * Corresponding author Tel 13873069242 E-mail wu_alwin@ yahoo com cn

2 p53 153 multidrug resistancemdr p53 BCRP MDR ATP P P- 1 glycoproteinp-gp multidrug resistance proteinmrp breast 1 1 cancer resistance proteinbcrp Saos-2 ATCC BCRP 1998 Doyle 10% RPMI-1640 Gibco BRL MCF-7 / AdrVp 37 5% CO 2 pc53-sn3 pc53-175 pc53-248 1 2 p53 p53 p53 R175H p53 R248W pbcrp-luc 50% p53 BCRP pbabe / 60% IκBα NF-κB IκBα 70% p53 MCF-7 1 2 p53 NF-κB BCRP Primer 3 3 p53 Saos-2 Invitrogen Table 1 Table 1 Primers used to perform reverse transcription PCR Primer Sequence 5' 3' Length of PCR product / bp p53 Forward CCAGCCAAAGAAGAAACCAC 194 Reverse TATGGCGGGAGG TAGACTGA BCRP Forward CACCTTATTGGCCTCAGGAA 206 Reverse CCTGCTTGGAAGGCTCTATG β-actin Forward ACCGTGGAGAAGAGCTACGA 309 Reverse GTACTTGCGCTCAGAAGGAG 1 3 Lipofectamine 2000 Invitrogen 1 d 24 2 μg 10 5 / RNA 90% ~ 95% - 70 100 μl 1 5 RT-PCR 5 μl 5 min 20 RevertAid Fermantas min 4 ~ 6 h RNA 1 5 μg Oligo dt 15 1 μl 48 h 1 4 RNA 70% 4 7 500 r / min 5 min DEPC 0 5 μg / μl RNase-free 12 μl 70 5 min 5 min 5 TRIzol Gibco BRL 4 μl 10 mmol / L dntp 2 μl RNA PBS TRIzol 1 μl 20 U 37 5 min MMV 1 5 ml EP 5 min 1 μl 15U 42 60 min 70 10 10 min 4 12 000 r / min min RT-PCR 1 μl 10 PCR 15 min Mg 2 + 2 μl 2 mmol / L dntp 2-20 20 min 4 12 000 r / min 20 minμl 1 μl 1μL Taq

154 28 0 5 μl 20 μl PCR 94 5 min 94 1 min 55 1 min72 1 min 30 72 10 min 1 5% 2 1 6 PBS 1 000 2 1 p53 Saos-2 BCRP r / min 10 min PBS p53 Saos-2 150 mmol / L NaCl 50 mmol / L Tris-HCl ph8 0 0 1% NP-40 1mmol / L PMSF 50 ~ 100 μl 30 min 30 s 4 12 000 r / min 30 min Bio-Rad - 70 1 7 Western 50 μg 5 Fig 1 Effects of exogenous p53 on BCRP 0 35 mol / L Tris-HClpH6 8 36% expression p53-null Saos-2 cells were transfected 0 012% 10 28% SDS 5% with 2μg of p53 expression plasmids or empty vectors β- 5 min 10% SDS pcmv-bam-neo After 48 hoursthe cells were 100 V 2 h 4 100 V harvested A Total RNA was extracted First-strand 80 min PBST 5% 2 cdna was synthesized with 1 5 μg of total RNA and a BCRP cdna fragment 206 bp was amplified by PCR h p53 Santa Cruz 1 1 000 β-actin was used as an internal control B Cell BCRP ALEXIS 1 100 β- lysates were prepared Proteins were separated by 10% Actin Sigma 1 10 000 5% SDS-PAGEtransferred onto nitrocelluloseand 1 h PBST HRP immunoblotted with an anti-bcrp monoclonal antibody ZYMED 1 1 000 BXP-21and followed by ECL detection β-actin was ZYMED 1 1 000 5% used as a loading control 1 h PBST SuperSignal Pierce 1 8 1 d 10 5 / Saos-2 Fig 2 24 90% ~ 95% p53 BCRP p53 48 h 0 3 μg p53 BCRP 1 PBS 200 μl 0 3 μg p53 BCRP Promega Saos-2 EP 4 12 000 r / min 10 min p53 BCRP 20 μl 100 μl 2 3 NF-κB p53 BCRP Promega Lumi-Scint 3 1 9 SPSS 14 0 t BCRP mrna p53 BCRP Fig 1 2 2 p53 BCRP p53 BCRP IκB-α Bioscan 10 s NF-κB NF-κB 30 s 50 μl 50 μl 2 β- Fig 3 NF-κB 1 33 mg ONPG 200 mmol / L p53 BCRP Na 2 HPO 4 2 mmol / L MgCl 2 100 mmol / L β- PBS ph 7 3 405 nm 630 nm 3 ELx800 Bio-Tek BCRP ABC

2 p53 155 Fig 2 Effects of exogenous p53 on BCRP promoter activity A Saos-2 cells were transfected with different dose of wild type p53 wt-p53 expression plasmids pc53-sn3 and BCRP luciferase promoter reporter construct The total concentration of DNA was adjusted to 1 μg with empty vector pcmv-bam-neo Luciferase activity was measured after 48 hours of transfection and normalized by β-galactosidase activity Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 B Saos-2 cells were transfected with 0 3μg of wt-p53 or mutant p53 expression plasmids and BCRP luciferase promoter reporter construct Luciferase activity was measured after 48 hours of transfection Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 Fig 3 NF-κB plays an important role in p53- mediated BCRP repression Saos-2 cells were transfected with wt-p53 expression plasmids or empty vector BCRP luciferase promoter reporter construct and different dose of a dominant-negative IκB-α mutant expression plasmid pbabe / IκB Luciferase activity was measured after 48 hours Values are expressed as the percentage of the relative luciferase activity 100% in cell extract from Saos-2 cells that were transfected with empty vector and without pbabe-iκb Values are mean ± SE n = 3 Statistical significance compared with control * P < 0 05 ** P < 0 01 populationsp SP 1 2 BCRP 4 ~ 6 BCRP estrogen response elementere progesterone response elementpre BCRP BCRP -1 hypoxiainducible factor 1HIF-1 7 / HIF-2 8 BCRP hypoxia response elementhre PTEN / PI3K / AKT 9 MEK-ERK-RSK 10 11 IL-1βIL-6 TNF-α c-myc 12 k-ras 13 cjun 14 MSX2 15 -β TGF-β 16 17 18 BCRP 3 p53 MCF-7 p53 BCRP MDR p53 Saos-2 9- SN38 p53 BCRP p53 Imatinib - p53 R175H - Gefitinib Erlotinib BCRP DNA p53 R248W BCRP BCRP side p53

156 28 p53 p53 p53 consensus binding sites 2 5' -RRRCWWGYYYN-3' R = G AW = T A Y = C T N = A C T G 0 ~ 13 MatInspector BCRP p53 p53 BCRP Ryan 19 Re-introduction p53 Saos-2 RKO -κb nuclear factor-κbnf-κb Benoit 20 p53 NF-κB -2 cyclooxygenase-2 Cox-2 NF-κB Cox-2 p53 NF-κB J J Pharmacol Exp Ther 3 MCF-7 p53 BCRP NF-κB BCRP p50 BCRP 21 p53 NFκB p53 NF-κB MCF-7 / MX J Inflamm Res 2009 22 Saos-2 p53 BCRP NF-κB IκBα NF-κB NF-κB NF-κB p53 BCRP NF-κB p53 BCRP References 1 Ding XWWu JHJiang CP ABCG2 a potential marker of stem cells and novel target in stem cell and cancer therapy J Life Sci 2010 86 17-18 631-637 2 Ishikawa TNakagawa H Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics J J Exp Ther Oncol 2009 8 1 5-24 3 Wang XWu XWang Cet al Transcriptional suppression of breast cancer resistance protein BCRP by wild-type p53 through the NF-κB pathway in MCF-7 cells J FEBS Lett 2010 584 15 3392-3397 4 Yasuda SKobayashi MItagaki Set al Response of the ABCG2 promoter in T47D cells and BeWo cells to sex hormone treatment J Mol Biol Rep 2009 36 7 1889-1896 5 Wang HUnadkat JDMao Q Hormonal regulation of BCRP expression in human placental BeWo cells J Pharm Res 2008 25 2 444-452 6 Wang HZhou LGupta Aet al Regulation of BCRP / ABCG2 expression by progesterone and 17beta- estradiol in human placental BeWo cells J Am J Physiol Endocrinol Metab 2006 290 5 E798-807 7 Krishnamurthy PRoss D DNakanishi Tet al The stem cell member Bcrp / ABCG2 enhances hypoxic cell survival through interations with hemej J Biol Chem2004279 23 24218-24225 8 Martin CMFerdous AGallardo Tet al Hypoxia-inducible factor-2alpha transactivates Abcg2 and promotes cytoprotection in cardiac side population cells J Circ Res 2008 102 9 1075-1081 9 Hartz AMMadole EKMiller DSet al Estrogen receptor beta signaling through phosphatase and tensin homolog / phosphoinositide 3-kinase / Akt / glycogen synthase kinase 3 downregulates blood-brain barrier breast cancer resistance protein 2010 334 2 467-476 10 Imai YOhmori KYasuda Set al Breast cancer resistance protein / ABCG2 is differentially regulated downstream of extracellular signal-regulated kinase J Cancer Sci 2009 100 6 1118-1127 11Mosaffa FLage HAfshari JTet al Interleukin-1β and tumor necrosis factor-α increase ABCG2 expression in MCF-7 breast carcinoma cell line and its mitoxantrone-resistant derivative 58 10 669-676 12Porro AIraci NSoverini Set al c-myc oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34 + hematopoietic progenitor cells J Mol Cancer Res2011 9 8 1054-1066 13Meyer SEHasenstein JRBaktula Aet al Kruppel-like factor 5 is not required for K-RasG12D lung tumorigenesisbut represses ABCG2 expression and is associated with better diseasespecific survival J Am J Pathol 2010 177 3 1503-1513 14Bark HXu HDKim SHet al P-glycoprotein down-regulates expression of breast cancer resistance protein in a drug-free state J FEBS Lett 2008 582 17 2595-2600 15Hamada SSatoh KHirota Met al The homeobox gene MSX2 determines chemosensitivity of pancreatic cancer cells via the regulation of transporter gene ABCG2 J J Cell Physiol 2012 227 2 729-738 16Ehata SJohansson EKatayama Ret al Transforming growth factor-β decreases the cancer-initiating cell population within diffuse-type gastric carcinoma cells J Oncogene 2011 30 14 1693-1705 17Liu XJing XYJin Set al Insulin suppresses the expression and function of breast cancer resistance protein in primary cultures of rat brain microvessel endothelial cellsj Pharmacol Rep 2011 63 2 487-493 18Tan KPWang BYang Met al Aryl hydrocarbon receptor is a transcriptional activator of the human breast cancer resistance protein BCRP / ABCG2 J Mol Pharmacol 2010 78 2 175-185

2 p53 157 19Ryan KMErnst MKRice NRet al Role of NF-κB in p53- mediated programmed cell death J Nature2000404 6780 892-897 20Benoit Vde Moraes EDar NAet al Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-κbj Oncogene2006 25 42 5708-5718 21 BATF2 / SARI p53 NF-κB J Lu ZhaoZheng Shao-PengNiu Jinget al BATF2 / SARI induces tumor cell apoptosis by inhibiting p53- dependent NF-κB activity J Chin J Biochem Mol Biol 2011 27 6 524-532 22Webster GAPerkins ND Transcriptional cross talk between NFκB and p53 J Mol Cell Biol199919 5 3485-3495 DNA Cell CTCF CTCF CTCF DNA CTCF 5 000 CTCF CTCF DNA CTCF DNA DNA - Paul Flicek CTCF 5 000 CTCF CTCF Duncan Odom CTCF CTCF CTCF Science DailyJan 122012