Gateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp

Σχετικά έγγραφα
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

M. marburgensis DX01 M. thermoautotrophicus M. marburgensis Marburg. MCR I mrna

svari Real-time RT-PCR RSV

Identification of Fish Species using DNA Method

Progress in Plant Resistance Induced by Salicylic Acid

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Shiraia sp. Slf14 III

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna

Cellular Physiology and Biochemistry

Science of Sericulture

College of Life Science, Dalian Nationalities University, Dalian , PR China.

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +

A/A Είδος Προδιαγραφές

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

ΟΔΗΓΟΣ ΓΙΑ ΤΗΝ ΑΠΟΣΤΟΛΗ ΔΕΙΓΜΑΤΩΝ SEQUENCING. Sample Requirements

Nguyen Hien Trang* **

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

Ara h 2. pet - 32a + Origami. Western blotting ELISA SDS - PAGE Ara h 2 F - Ara h 2. IgE

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Simultaneous Quantification of Jasmonic and Salicylic Acids in Tomato Plants by Gas Chromatography

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Journal of Shanghai Normal University Natural Sciences Feb SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

30s 56 60s 72 60s dntp cm s s s 23

JOURNAL OF MICROBIOLOGY May 2011 Vol. 31 No. 3. PCR bp BCCP. pet-28a Escherichia coli BL21 DE3 Ni-NTA

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

Capillary Gel Electrophoresis for Ligase Detection Reaction Products

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent

Fe II aq Fe III oxide electron transfer and Fe exchange: effect of organic carbon

Study on the Solubility of Kiwi Fruit Seed Oil in Supercritical Carbon Dioxide

Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography

CorV CVAC. CorV TU317. 1

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

Approximation Expressions for the Temperature Integral

Physical and Chemical Properties of the Nest-site Beach of the Horseshoe Crab Rehabilitated by Sand Placement

ΠΡΟΣΚΛΗΣΗ ΕΝΔΙΑΦΕΡΟΝΤΟΣ KAI ΚΑΤΑΘΕΣΗΣ ΠΡΟΣΦΟΡΩΝ ΓΙΑ ΤΗΝ ΑΝΑΘΕΣΗ ΤΗΣ ΠΡΟΜΗΘΕΙΑΣ

P450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , ; 2.

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Σχέση στεφανιαίας νόσου και άγχους - κατάθλιψης

Isolation, purification and partial characterization of the 2N2acetyl2D2 glucosaminidase from the pupae of Helicoverpa armigera

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Biapenem BIPM Lot No g mg

ΠΡΟΚΗΡΥΞΗ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

Digesting Plasmid DNA with Restriction Endonuclease s under the Condition of Microwave-heating

Reading Order Detection for Text Layout Excluded by Image

Regulation of abscisic acid on plant resistance to water stress

The pathway of the ozonation of 2,4,62trichlorophenol in aqueous solution

Supporting Information

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

TGFp FSH INH INH

J. of Math. (PRC) 6 n (nt ) + n V = 0, (1.1) n t + div. div(n T ) = n τ (T L(x) T ), (1.2) n)xx (nt ) x + nv x = J 0, (1.4) n. 6 n

, DYY-8B, ; : Centrifuge 11 R. min

Εκτεταμένη περίληψη Περίληψη

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

http / /xuebao. jxau. edu. cn. orfh79 orfh79 pet - 28a - orfh79 pgex5x orfh79

High mobility group 1 HMG1

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΕΠΑΝΑΣΧΕΔΙΑΣΜΟΣ ΓΡΑΜΜΗΣ ΣΥΝΑΡΜΟΛΟΓΗΣΗΣ ΜΕ ΧΡΗΣΗ ΕΡΓΑΛΕΙΩΝ ΛΙΤΗΣ ΠΑΡΑΓΩΓΗΣ REDESIGNING AN ASSEMBLY LINE WITH LEAN PRODUCTION TOOLS

ESI for. A simple and efficient protocol for the palladium-catalyzed. ligand-free Suzuki reaction at room temperature in aqueous DMF.

Σχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Neutralization E#ects of Acidity of Rain by Cover Plants on Slope Land

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία ΑΓΧΟΣ ΚΑΙ ΚΑΤΑΘΛΙΨΗ ΣΕ ΓΥΝΑΙΚΕΣ ΜΕ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ

Transcript:

2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM 22 4. 0 ~ 5. 0 10 6 cfu/ ml 2. 4 ~ 3. 0 10 7 cfu 1 250 bp cdna Gateway Q785 A 1000-2286 2010 04-0791 - 06 Construction of a cdna Library of Pepper for Yeast Two - hybrid Analysis Using Gateway Technology QIU Ai-lian LIU Lin-lin CAI Han-yang ZHU Wan-li HUANG Mu-kun CHEN Xiong HE Shui-lin * ZHANG Jian * College of Life Science Fujian Agriculture and Forestry University Fuzhou 350002 China Abstract It s an important prerequisite work to construct a cdna library for isolating a specific cdna u- sing yeast two - hybrid technology. In this study after successfully extracting total RNA and isolating mrna of pepper the authors synthesized three - frame cdnas performed BP reactions to generate corresponding entry libraries and then performed LR reactions to transfer cdna into destination vector of pdest TM 22 directionally and quickly to form a high - quality destination library using Gateway technology. It has been detected that both entry library and destination library in this report have a high titer of 4. 0 ~ 5. 0 10 6 cfu /ml and contain a total clones of 2. 4 ~ 3. 0 10 7 cfu with an average insert size of about 1 250 bp it can be suitable for analyzing the interaction protein cdna of the interested destination gene of pepper by two - hybrid system. Key words pepper entry library destination library Gateway yeast two - hybrid 1-7 2010-04 - 27 2010-05 - 26 30571128 2008J003 2008J0049 2007F3013 1977 - E - mail qiual888@ sina. com *

792 32 cdna 20 80 RNA mrna Gateway λ BP LR cdna LR cdna Gateway 95% 8 - Gateway 10 Gateway Ohara 11-12 cdna 2003 Invitrogen Gateway CloneMiner TM cdna Library Construction Kit cdna 13-14 cdna cdna cdna ProQuest TM ROP WRKY Gateway SA cdna cdna 1 1. 1 1. 1. 1 RNA 120 # 1. 1. 2 TRIzol Reagent CloneMiner TM cdna Library Construction Kit LR Clonase Enzyme Mix PureLink TM HiPure Plasmid DNA Midiprep Kit Invitrogen Oligotex TM - dt30 Super mr- NA Purification Kit BsrGⅠ NEB 1. 1. 3 3 cdna cdna 5 3 attb1 A RFA 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGG - 3 3 - CCCCTGTTGAAACATGTTTTTTCAACCp 5 B RFB 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGGA - 3 3 - CCCCTGTTGAAACATGTTTTTTCAACCTp 5 C RFC 5 - TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAA - 3 3 - CCCCTGTTGAAACATGTTTTTTCAACCTTp 5 Invitrogen 1. 2 1. 2. 1 RNA mrna salicylic acid SA 20 d 20 μmol /L SA 12 h RNA RNA TRIzol 1 g 10 ml TRIzol RNase TRIzol RNA 600 μg RNA Oligotex TM - dt30 Super mrna mrna 10 g /L

4 Gateway cdna 793 1. 2. 2 cdna 3 3 cd- NA 2 μg mrna CloneMiner TM cdna attb1 3 cdna 3 cdna 1-20 cdna 11-20 5 μlcdna 9 10 cdna 11-20 cdna BP cdna 3 4 5 6 7/2-20 cdna 1. 2. 3 1. 5 ml 10 μlbp cdna 100 ng /μl 1 μl pdonr TM 222 250 ng /μl 1 μl 5 BP ClonaseTM Reaction Buffer 2 μl TE Buffer ph 8. 0 3 μl 3 μl BP Clonase TM Enzyme mix 2 ~ 5 BP 16 ~ 20 h DH10B 40% S O C 100 μl - 80 1. 2. 4 1 S O C 100 μl 10-2 10-3 10-4 100 μl 50 μg /ml LB cfu /ml = / ml Total cfu = cfu /ml ml 2 2 3 cdna 22 Gateway BsrG I pdonr TM 222 M13 Forward - 20 5 - GTAAAACGACGGCCAG - 3 M13 Reverse 5 - CAGGA AACAGCTATGAC -3 PCR 1. 2. 5 1 1 /2 cdna 50 ml 50 μg /ml LB 200 r /min 37 6 h OD 1. 0 PureLink TM HiPure DNA cdna TE 2 3 DNA 50 ng DNA pdest TM 22 LR DH10B 1. 2. 4 PCR 22F 5 - TATAACGCGTTTGGAA TCACT - 3 22R 5 - AGCCGACAACCTTGATTGGAGAC - 3 2 2. 1 RNA mrna RNA OD 260 /280 = 2. 11 1 μg /μl 600 μl 10 g /L RNA 28 S 18 S 28 S rrna 18 S rrna 2 5 S rrna RNA 1 Oligotex TM - dt30 Super mrna mrna 0. 5 ~ 12 kb rrna mrna 2 mrna 6 μg cdna 2. 2 cdna cdna cdna 1-20 11-20 3 3 4 5 6 7 /2 1 ~ 2. 5 kb 4 cdna 1

794 32 A 10 g /L B A 10 g/l agarose gel B Formaldehyde denaturing gel. Fig. 1 1 RNA Electrophoresis of pepper total RNA Fig. 2 2 M DL15 000 Marker. mrna Agarose gel electrophoresis of mrna A 11-14 B 9 A tube 11-14 B tube 9. M 1 DL15 000 Marker M 2 DL2 000 Marker. M 1 DL15 000 Marker M 2 DL2 000 Marker. 3 cdna Fig. 4 The pooled cdna of tube 3 - tube 6 Fig. 3 Agarose gel electrophoresis of size fractionated cdna and half of tube 7 4 2. 3 3-6 1/2 7 cdna 3 cdna attb1 attb2 Gateway BP cdna pdonr TM 222 cdna 3 cdna 4. 0 10 6 cfu /ml 2. 4 10 7 cfu /ml 22 PCR 5 A 100% 0. 5 ~ 3. 0 kb 1. 3 cdna EST cdna 2. 4 LR cdna pdest TM 22 cdna 3. 0 10 7 24 PCR 6 A 100% 0. 5 ~ 3. 0 kb 1. 2 cdna 3 Gateway λ

4 Gateway cdna 795 1-22 22 CK pdonr222 A PCR B 1-22 1-22 clones CK pdonr TM 222 A PCR detection B Restriction analysis M DL2 000Marker. Fig. 5 5 A cdna Qualifing the entry cdna library of reading frame A 1-24 1-24 1-24 1-24 clones M DL15 000 Marker. Fig. 6 6 cdna PCR PCR detection of the destination cdna library BP LR BP DNA LR PCR BP cdna LR cdna BP LR PCR mrna 5 cdna N 3 attb 1 cdna 3 cdna cdna plate spotting assay PSA cdna cdna 11-20 9 10

796 32 SA SA SA SA 6-7 SA mrna cdna Proquest TM SA SA 1 Desikan R Cheng M K Bright J et al. ABA hydrogen peroxide and nitric oxide signalling in stomatal guard cells J. J Exp Bot 2004 55 395 205-212. 2 Neill S R Desikan R Hancock J Hydrogen peroxide signalling J. Curr Opin Plant Biol 2002 5 5 388-395. 3 Konigshofer H Tromballa H W Loppert H G. Early events in signalling high - temperature stress in tobacco BY2 cells involve alterations in membrane fluidity and enhanced hydrogen peroxide production J. Plant Cell Environ 2008 31 12 1771-1780. 4 Miller G Suzuki IV Rizhsky L et al. Double mutants deficient in cytosolic and thylakoid ascorbate peroxidase reveal a complex mode of interaction between reactive oxygen species plant development and response to abiotic stresses J. Plant Physiol 2007 144 4 1777-1785. 5 Boussiba S Rikin A ERichmond A The role of abscisic acid in cross - adaptation of tobacco plants J. Plant Physiol 1975 56 2 337-339. 6 Vasiukova N I Ozeretskovskaia O L. Induced plant resistance and salicylic acid A review J. Prikl Biokhim Mikrobiol 2007 43 4 405-411. 7 Yalpani N Raskin I. Salicylic acid a systemic signal in induced plant disease resistance J. Trends Microbiol 1993 1 3 88-92. 8 Hartley J L Temple G F Brasch M A. DNA cloning using in vitro site - specific recombination J. Genome Res 2000 10 11 1788-95. 9 Wu X Webster S R Chen J. Characterization of tumor - associated Chk2 mutations J. J Biol Chem 2001 276 4 2971-2974. 10 Gomes M D Lecker S H Jagoe R T et al. Atrogin - 1 a muscle - specific F - box protein highly expressed during muscle atrophy J. Proc Natl Acad Sci U S A 2001 98 25 14440-14445. 11 Ohara O Temple G Directional cdna library construction assisted by the in vitro recombination reaction J. Nucleic Acids Res 2001 29 4 22. 12 Ohara O Temple G. Characterization of size - fractionated cdna libraries generated by the in vitro recombination - assisted method J. DNA Res 2002 9 2 47-57. 13. Gateway JH505 cdna J. 2005 45 6 963-965. 14. cdna J. 2005 28 2 1-4.