ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:"


1 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Εάν το συνολικό ποσοστό βάσεων Α+Τ σε μία αλυσίδα DNA είναι 30%, το ποσοστό G+C στο RNA που προκύπτει από τη μεταγραφή της αλυσίδας αυτής είναι: Α. 20% Β. 30% Γ. 35% Δ. 70% 2. Πρωταρχικό τμήμα μήκους 15 ριβονουκλεοτιδίων περιέχει 5 Α και 3 U. Οι δεσμοί υδρογόνου που σπάζουν κατά την αντικατάσταση του πρωταρχικού τμήματος είναι: Α. 30 Β. 35 Γ. 37 Δ Η ασθένεια της κυστικής ίνωσης κληρονομείται με όμοιο τύπο κληρονομικότητας με τη (ν): Α. Οικογενή υπερχοληστερολαιμία Β. Αιμορροφιλία Α Γ. Β- θαλασσαιμία Δ. Μερική αχρωματοψία στο πράσινο-κόκκινο ΤΕΛΟΣ 1ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ 4. Ex vivo γονιδιακή θεραπεία είναι δυνατό να εφαρμοστεί για την αντιμετώπιση: Α. Της κυστικής ίνωσης Β. Της δρεπανοκυτταρικής αναιμίας Γ. Του διαβήτη Δ. Της μυϊκής δυστροφίας Duchenne 5. Για την παραγωγή ανθρώπινης ινσουλίνης από βακτήρια με τη μέθοδο της cdna βιβλιοθήκης δεν χρησιμοποιείται: Α. Το γονίδιο της προϊνσουλίνης Β. Η DNA πολυμεράση Γ. Η αντίστροφη μεταγραφάση Δ. Μόριο ανιχνευτής 1-Δ, 2-Γ, 3-Γ, 4-Β, 5-Α ΜΟΝΑΔΕΣ 25 [5 μονάδες για κάθε σωστή επιλογή] ΘΕΜΑ Β Β1. Να εξηγήσετε ποια οφέλη απορρέουν από την κλωνοποίηση των θηλαστικών ζώων. Πολλαπλασιασμός διαγονιδιακών ζώων. Η δημιουργία ενός διαγονιδιακού ζώου που παράγει τον ανθρώπινο παράγοντα πήξης του αίματος, για παράδειγμα, κοστίζει 1-2 εκατομμύρια ευρώ. Με κλωνοποίηση είναι δυνατό να παραχθούν πολλά πανομοιότυπα ζώα και συνεπώς μεγάλες ποσότητες του φαρμάκου. Προστασία ζώων από εξαφάνιση. Στις καταψύξεις πολλών ζωολογικών κήπων διατηρούνται ωάρια και σπερματοζωάρια ή έμβρυα ζώων, που κινδυνεύουν να εξαφανιστούν. Πυρήνες από αυτά τα κύτταρα είναι δυνατό να μεταφερθούν σε απύρηνα ωοκύτταρα του είδους τους και στη συνέχεια να κυοφορηθούν στο ίδιο ή σε συγγενικό είδος ζώου. ΜΟΝΑΔΕΣ 6 [3 μονάδες για κάθε μία από τις δύο παραγράφους] Β2. Να γράψετε τον ορισμό της ιχνηθέτησης και να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε ότι το DNA είναι το γενετικό υλικό. ΤΕΛΟΣ 2ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

3 ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ Ιχνηθέτηση είναι η σήμανση χημικών μορίων με τη χρήση ραδιενεργών ισοτόπων, φθοριζουσών ουσιών κ.τ.λ. Τα πειράματα των Hershey και Chase αποτέλεσαν την οριστική επιβεβαίωση ότι το DNA είναι το γενετικό υλικό των οργανισμών. Οι ερευνητές μελέτησαν τον κύκλο του βακτηριοφάγου Τ 2, ενώ είχαν ιχνηθετήσει τις πρωτεΐνες των φάγων με ραδιενεργό θείο ( 35 S) και το DNA τους με ραδιενεργό ( 32 P). Με τους ραδιενεργούς φάγους μόλυναν τα βακτήρια. Τα αποτελέσματα έδειξαν ότι μόνο το DNA των φάγων εισέρχεται στα βακτηριακά κύτταρα και είναι ικανό να δώσει τις απαραίτητες εντολές για να πολλαπλασιαστούν και να παραχθούν νέοι φάγοι. ΜΟΝΑΔΕΣ 6 (2+4) [2 μονάδες για τον ορισμό και 4 για την ορθή περιγραφή του πειράματος. Στην περίπτωση που ο υποψήφιος δεν αναφέρει τη φράση «ενσωματώνεται» για τα ραδιενεργά υλικά, μειώνεται κατά 1 μονάδα η βαθμολογία του] Β3. Να εξηγήσετε σε ποιες φάσεις της κλειστής καλλιέργειας ο πληθυσμός των μικροβίων παραμένει σταθερός και σε ποιους λόγους οφείλεται αυτό. Λανθάνουσα φάση: Κατά τη φάση αυτή ο πληθυσμός των μικροοργανισμών που προέρχεται από την αρχική καλλιέργεια παραμένει σχεδόν σταθερός. Αυτό οφείλεται στο ότι οι μικροοργανισμοί χρειάζονται κάποιο χρονικό διάστημα για να προσαρμοστούν στις νέες συνθήκες και να αρχίσουν να αναπτύσσονται. Στατική φάση: Ο πληθυσμός των μικροοργανισμών δεν αυξάνεται, είτε λόγω εξάντλησης κάποιου θρεπτικού συστατικού είτε λόγω συσσώρευσης τοξικών προϊόντων από το μεταβολισμό των μικροοργανισμών. ΜΟΝΑΔΕΣ 6 [3 μονάδες για κάθε σωστή απάντηση] Β4. Να εξηγήσετε σε ποιες περιπτώσεις παρατηρείται παντελής έλλειψη της κύριας ανθρώπινης αιμοσφαιρίνης HbA στον ανθρώπινο οργανισμό. Παντελής έλλειψη της HbA παρατηρείται στις ακόλουθες περιπτώσεις: 1. β-θαλασσαιμία: Η ασθένεια χαρακτηρίζεται από μεγάλη ετερογένεια, δηλαδή προκαλείται από πολλά διαφορετικά είδη γονιδιακών μεταλλάξεων, όπως αντικαταστάσεις, προσθήκες, ελλείψεις βάσεων. Τα συμπτώματα της ασθένειας διαφέρουν ως προς τη βαρύτητα μεταξύ των πασχόντων ατόμων και σχετίζονται με το είδος της μετάλλαξης που τα προκαλεί. Τα συμπτώματα είναι δυνατό να κυμαίνονται από σοβαρή αναιμία, κατά την οποία παρατηρείται παντελής έλλειψη πολυπεπτιδικής ΤΕΛΟΣ 3ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ αλυσίδας β και συνεπώς HbA, έως λιγότερο σοβαρή αναιμία, που χαρακτηρίζεται από ελάττωση της σύνθεσης της β αλυσίδας και σύνθεση της HbA σε πολύ μικρή ποσότητα. 2. Η δρεπανοκυτταρική αναιμία οφείλεται σε γονιδιακή μετάλλαξη αντικατάστασης βάσης στο γονίδιο της β πολυπεπτιδική αλυσίδας της HbA. Οι ασθενείς με δρεπανοκυτταρική αναιμία είναι ομόζυγοι για το μεταλλαγμένο γονίδιο β s και στο αίμα τους παράγουν αποκλειστικά HbS και καθόλου HbA. 3. Κατά την εμβρυική ζωή παράγεται HbF, ενώ δεν έχει ακόμη ξεκινήσει η παραγωγή της HbA.Πρόκειται για την εμβρυική αιμοσφαιρίνη. Αποτελείται από δύο πολυπεπτιδικές αλυσίδες α και δύο γ (σύσταση α 2 γ 2). ΜΟΝΑΔΕΣ 7 [3 μονάδες για τη β-θαλασσαιμία, και από 2 μονάδες για κάθε μία από τις άλλες δύο περιπτώσεις. Στο ζήτημα αυτό, είναι πιθανό να αναφέρθηκε η παντελής απουσία γονιδίων για την α αλυσίδα της αιμοσφαιρίνης, κατάσταση που δεν επιτρέπει την εμβρυική ανάπτυξη. Στην περίπτωση που ο υποψήφιος το αναφέρει, δεν βαθμολογείται.] ΘΕΜΑ Γ Γ1. Στο σχήμα απεικονίζεται η μείωση για τη δημιουργία γαμετών (κύτταρα 4,5,6,7) σε φυσιολογική γυναίκα, από την οποία γεννήθηκε άτομο με σύνδρομο Down. Ο γαμέτης 6 γονιμοποιήθηκε με φυσιολογικό σπερματοζωάριο (8) και προέκυψε το ζυγωτό (9) από το οποίο γεννήθηκε το άτομο αυτό. ΤΕΛΟΣ 4ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

5 ΑΡΧΗ 5ΗΣ ΣΕΛΙΔΑΣ 46 χρωμοσώματα χρωμοσώματα Ζυγωτό 9 8 i. Να γράψετε ποια είναι τα χαρακτηριστικά των ατόμων με σύνδρομο Down. ii. Να γράψετε τον πιθανό συνολικό αριθμό χρωμοσωμάτων των κυττάρων 2-7. Να εξηγήσετε την απάντησή σας. iii. Δεδομένου ότι στο 21 ο χρωμόσωμα εντοπίζεται το γονίδιο για την υπολειπόμενη ασθένεια της ομοκυστινουρίας, η εν λόγω γυναίκα είναι φορέας και ο σύζυγός της ομόζυγος για το φυσιολογικό αλληλόμορφο, να γράψετε τους πιθανούς γονότυπους του ατόμου με Down για την ομοκυστινουρία. Να μην αιτιολογήσετε την απάντησή σας. i. Τρισωμία 21 ή σύνδρομο Down: Πρόκειται για την πιο κοινή αριθμητική χρωμοσωμική ανωμαλία. Τα άτομα με το σύνδρομο αυτό παρουσιάζουν καθυστέρηση στην ανάπτυξη, χαρακτηριστικές δυσμορφίες στο πρόσωπο και διανοητική καθυστέρηση. Στον καρυότυπό τους εμφανίζεται ένα επιπλέον χρωμόσωμα 21, που προέρχεται από μη διαχωρισμό των χρωμοσωμάτων ή των χρωματίδων κατά τη μείωση. Με αυτόν τον τρόπο δημιουργείται ωάριο (σπανιότερα σπερματοζωάριο) με 2 χρωμοσώματα 21, η γονιμοποίηση του οποίου με ένα φυσιολογικό γαμέτη δημιουργεί ζυγωτό με τρισωμία 21. ΜΟΝΑΔΕΣ 2 ΤΕΛΟΣ 5ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

6 ΑΡΧΗ 6ΗΣ ΣΕΛΙΔΑΣ ii. iii. Οι αριθμητικές χρωμοσωμικές ανωμαλίες συμβαίνουν κατά τη διάρκεια της μείωσης, όταν δεν πραγματοποιείται φυσιολογικά ο διαχωρισμός των ομολόγων χρωμοσωμάτων κατά την 1η μειωτική διαίρεση ή των αδελφών χρωματίδων κατά τη 2η μειωτική διαίρεση. Το φαινόμενο ονομάζεται μη-διαχωρισμός και έχει ως αποτέλεσμα τη δημιουργία γαμετών με αριθμό χρωμοσωμάτων μεγαλύτερο ή μικρότερο του φυσιολογικού. Η γονιμοποίηση των μη φυσιολογικών γαμετών επιφέρει τη δημιουργία ζυγωτού με λανθασμένη ποσότητα γενετικού υλικού, το οποίο δεν αναπτύσσεται φυσιολογικά. Τα άτομα που προκύπτουν κατά αυτόν τον τρόπο έχουν περίσσεια ή έλλειψη μικρού αριθμού χρωμοσωμάτων και ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος ονομάζεται μονοσωμία ενώ η ύπαρξη ενός επιπλέον χρωμοσώματος τρισωμία. Στην περίπτωση που συνέβη μη διαχωρισμός χρωμοσωμάτων κατά την 1 η μειωτική διαίρεση: Κύτταρο 2: 22 χρωμοσώματα, κύτταρο 3: 24 χρωμοσώματα, κύτταρο 4 και 5: 22 χρωματίδες, συνεπώς 22 χρωμοσώματα, κύτταρο 6 και 7: 24 χρωματίδες, συνεπώς 24 χρωμοσώματα. Στην περίπτωση που συνέβη μη διαχωρισμός χρωματίδων κατά την 2 η μειωτική διαίρεση: Κύτταρο 2 και 3: 23 χρωμοσώματα, κύτταρο 4 και 5: 23 χρωμοσώματα, κύτταρο 6: 24 χρωματίδες, συνεπώς 24 χρωμοσώματα, κύτταρο 7: 22 χρωματίδες, συνεπώς 22 χρωμοσώματα. ΜΟΝΑΔΕΣ 6 [Στην περίπτωση που ο υποψήφιος δεν αναφέρθηκε στη θεωρία αφαιρούνται 2 μονάδες. Επίσης εάν δεν έχει λάβει 2 περιπτώσεις -1 η και 2 η μειωτική- αφαιρούνται 2 μονάδες] Έστω Α το φυσιολογικό αλληλόμορφο και α το υπεύθυνο για την ομοκυστινουρία αλληλόμορφο. Η μητέρα έχει γονότυπο Αα και ο πατέρας αα. Συνεπώς το άτομο με το σύνδρομο Down που προκύπτει από τους γονείς αυτούς είναι δυνατό να έχει γονότυπο ΑΑα αν ο μη διαχωρισμός συνέβη στην 1 η μειωτική διαίρεση, ή πάλι ΑΑα αλλά και Ααα, εάν ο μη διαχωρισμός συνέβη στη δεύτερη μειωτική της μητέρας. ΜΟΝΑΔΕΣ 1 [στην περίπτωση που ο υποψήφιος έχει γράψει τον έναν από τους δύο πιθανούς γονότυπους αφαιρείται 0,5 μονάδα] Γ2. Σε ένα εργαστήριο γενετικής ο αρσενικός λευκός ποντικός Κ διασταυρώθηκε πολλαπλές φορές με τον θηλυκό μαύρο ποντικό Μ. Από τις διασταυρώσεις τους προέκυψαν μόνον μαύροι ποντικοί. Μαύρος θηλυκός ποντικός της θυγατρικής γενιάς διασταυρώθηκε πολλαπλές φορές με λευκό αρσενικό και προέκυψαν μαύροι και λευκοί απόγονοι σε αναλογία 1:1. Να εξηγήσετε με διασταυρώσεις τους πιθανούς γονότυπους των ποντικών Κ και Μ. ΤΕΛΟΣ 6ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

7 ΑΡΧΗ 7ΗΣ ΣΕΛΙΔΑΣ Δεδομένου ότι από τις πολλαπλές διασταυρώσεις λευκού με μαύρο ποντικό προκύπτουν απόγονοι μόνον με μαύρο χρώμα συμπεραίνουμε ότι: Το αλληλόμορφο για το μαύρο επικρατεί σε εκείνο για το λευκό, Τα άτομα της πατρικής γενιάς είναι ομόζυγα για το χρώμα τριχώματος. Έστω ότι το γονίδιο είναι αυτοσωμικό. Συμβολίζουμε Β το γονίδιο για το μαύρο και β για το λευκό. Συνεπώς, τα άτομα της πατρικής γενιάς είναι ΒΒ το θηλυκό Μ και ββ το αρσενικό Κ. Οι διασταυρώσεις είναι: 1 η διασταύρωση 2 η διασταύρωση P : ΒΒ ββ P : Ββ ββ Γαμ. Β β Γαμ. Β, β β F : Ββ F : Ββ, ββ Φ.Α: 100% μαύρα Φ.Α: 1 μαύρο:1 λευκό Έστω ότι το γονίδιο είναι φυλοσύνδετο. Συμβολίζουμε Χ Β το γονίδιο για το μαύρο και Χ β για το λευκό. Συνεπώς, τα άτομα της πατρικής γενιάς είναι Χ Β Χ Β το θηλυκό Μ και Χ β Υ το αρσενικό Κ. Οι διασταυρώσεις είναι: 1 η διασταύρωση 2 η διασταύρωση P : Χ Β Χ Β Χ β Υ P : Χ Β Χ β Χ β Υ Γαμ. Χ Β Χ β, Υ Γαμ. Χ Β, Χ β Χ β, Υ F : Χ Β Χ β, Χ Β Υ F : Χ Β Χ β, Χ β Χ β, Χ Β Υ, Χ β Υ Φ.Α: 100% μαύρα Φ.Α: 1 μαύρο:1 λευκό ΜΟΝΑΔΕΣ 10 ΤΕΛΟΣ 7ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

8 ΑΡΧΗ 8ΗΣ ΣΕΛΙΔΑΣ [5 μονάδες για κάθε σωστή εξήγηση. Απώλεια 5 μονάδες εάν δεν ληφθεί η μία εκ των δύο περιπτώσεων και 3 μονάδες εάν δεν γίνουν οι αντίστοιχες διασταυρώσεις.] Γ3. Σε καλλιέργεια E.coli προστίθεται θρεπτικό υλικό το οποίο περιέχει ως πηγή άνθρακα λακτόζη και γλυκόζη (χρόνος t 0 ). Μετά την εξάντληση και των δύο πηγών (χρόνος t 2 ) προστέθηκε στην καλλιέργεια μόνον γλυκόζη. Καθ όλη τη διάρκεια της καλλιέργειας προσδιορίστηκε η συγκέντρωση της λακτόζης (καμπύλη α) και της β-γαλακτοσιδάσης (καμπύλη β). Η β-γαλακτοσιδάση είναι ένα από τα τρία ένζυμα που απαιτεί η διάσπαση της λακτόζης. Τα αποτελέσματα φαίνονται στο διάγραμμα: α β t 0 t 1 t 2 t 3 Δεδομένου ότι το βακτήριο σε περιβάλλον γλυκόζης και λακτόζης, διασπά πρώτα τη γλυκόζη να απαντήσετε στα ερωτήματα: i. Σε ποιο ή ποια χρονικά διαστήματα 0-t 1, t 1 -t 2 και t 2 -t 3 το οπερόνιο της λακτόζης βρίσκεται σε καταστολή; Να μην αιτιολογήσετε την απάντησή σας. ii. Πόσα μόρια mrna και πόσες πρωτεΐνες παράγονται από την έκφραση του οπερονίου της λακτόζης κατά το χρονικό διάστημα 0-t 1 και πόσα κατά το χρονικό διάστημα t 1 -t 2 ; Να αιτιολογήσετε την απάντησή σας. i. Το οπερόνιο της λακτόζης βρίσκεται σε καταστολή στα χρονικά διαστήματα 0-t 1 και t 2 - t 3, δεδομένου ότι σε αυτά δεν παράγεται το ένζυμο για τη διάσπαση της λακτόζης. ΜΟΝΑΔΕΣ 2 ii. Στο χρονικό διάστημα 0-t 1 το οπερόνιο βρίσκεται σε καταστολή και η πρωτεΐνη καταστολέας προσδένεται ισχυρά στον χειριστή, οπότε δεν μεταγράφονται τα δομικά γονίδια. Στο διάστημα αυτό παράγεται μία πρωτεΐνη, ο καταστολέας, και ένα μόριο ΤΕΛΟΣ 8ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

9 ΑΡΧΗ 9ΗΣ ΣΕΛΙΔΑΣ mrna, αυτό που κωδικοποιεί τον καταστολέα. Στο χρονικό διάστημα t 1 -t 2 το οπερόνιο επάγεται. Όταν στο θρεπτικό υλικό υπάρχει μόνο λακτόζη, ο ίδιος ο δισακχαρίτης προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο χειριστή. Τότε η RNA πολυμεράση είναι ελεύθερη να αρχίσει τη μεταγραφή. Η λακτόζη εντέλει λειτουργεί ως επαγωγέας της μεταγραφής του οπερονίου της. Τα τρία δομικά γονίδια μεταγράφονται σε ένα μόριο mrna. Το mrna μεταφράζεται σε τρία ένζυμα, καθώς περιέχει κωδικόνια έναρξης και λήξης για κάθε ένζυμο. Συνεπώς, στο διάστημα t 1 -t 2 από την έκφραση του οπερονίου παράγονται δύο μόρια mrna και 4 πρωτεΐνες. Το ένα mrna προέρχεται από τη μεταγραφή του ρυθμιστικού γονιδίου, το άλλο από τη μεταγραφή των τριών δομικών γονιδίων. Πρωτεΐνες είναι, μία ο καταστολέας και τα τρία ένζυμα για τη διάσπαση της λακτόζης. ΜΟΝΑΔΕΣ 4 [Στην περίπτωση που ο υποψήφιος δεν συμπεριλάβει στην απάντησή του την πρωτεΐνη καταστολέα ή/και το mrna που την κωδικοποιεί αφαιρούνται 2 συνολικά μονάδες, 1 για κάθε ένα.] ΘΕΜΑ Δ Από ανθρώπινο κύτταρο απομονώθηκε ένα μόριο μιτοχονδριακού DNA, το οποίο φέρει 4 θέσεις αναγνώρισης από την ενδονουκλεάση EcoRI. Το μόριο υποβάλλεται in vitro σε 2 κύκλους αντιγραφής. i. Πόσα μόρια μιτοχονδριακού DNA υπάρχουν μετά τους 2 κύκλους αντιγραφής; Να αιτιολογήσετε την απάντηση σας. Η αντιγραφή είναι γνωστό ότι γίνεται με ημισυντηρητικό τρόπο. Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του μορίου ανοίγει η διπλή έλικα και κάθε αλυσίδα λειτουργεί ως καλούπι για τη σύνθεση μίας νέας συμπληρωματικής αλυσίδας. Κατά αυτόν τον τρόπο προκύπτουν δύο θυγατρικά μόρια πανομοιότυπα με το μητρικό, καθένα εκ των οποίων αποτελείται από μία παλιά και μία καινούργια αλυσίδα. Συνεπώς, μετά τους 2 κύκλους αντιγραφής προκύπτουν 4 μόρια DNA. ΜΟΝΑΔΕΣ 4 Στα αντίγραφα του μιτοχονδριακού DNA προστίθεται EcoRI. Ταυτόχρονα από βακτήρια απομονώθηκαν 100 αντίγραφα ενός πλασμιδίου, κατάλληλου για την τεχνική της κλωνοποίησης, που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό στρεπτομυκίνη και μία θέση αναγνώρισης από την EcoRI, εκτός της αλληλουχίας του γονιδίου ανθεκτικότητας. Στα πλασμίδια προστίθεται ΤΕΛΟΣ 9ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

10 ΑΡΧΗ 10ΗΣ ΣΕΛΙΔΑΣ EcoRI και στη συνέχεια αυτά αναμιγνύονται με τα θραύσματα από το μιτοχονδριακό DNA και DNA δεσμάση. Κάθε θραύσμα μιτοχονδριακού DNA ενσωματώνεται σε πλασμίδιο. ii. Πόσα ανασυνδυασμένα και πόσα μη ανασυνδυασμένα πλασμίδια δημιουργούνται; Να αιτιολογήσετε την απάντηση σας. Το κάθε ένα μιτοχονδριακό DNA περιέχει 4 θέσεις αναγνώρισης από την περιοριστική ενδονουκλεάση και είναι κυκλικό μόριο. Συνεπώς, από την επίδραση της περιοριστικής δημιουργούνται 4 θραύσματα από κάθε μιτοχονδριακό DNA, άρα συνολικά 16 (4Χ4) θραύσματα μιτοχονδριακού DNA. Δεδομένου ότι κάθε θραύσμα ενσωματώνεται σε πλασμίδιο, προκύπτουν 16 ανασυνδυασμένα πλασμίδια και =84 μη ανασυνδυασμένα πλασμίδια, τα οποία και ξαναγίνονται κυκλικά δίχως να προσλάβουν μιτοχονδριακό DNA. ΜΟΝΑΔΕΣ 4 [Στην περίπτωση που ο υποψήφιος δεν συμπεριλάβει στην απάντησή του τα μη ανασυνδυασμένα πλασμίδια αφαιρούνται 2 μονάδες] Όλα τα πλασμίδια που προκύπτουν μεταφέρονται σε αποικία βακτηρίων με κατάλληλο θρεπτικό υλικό και επωάζονται σε κατάλληλη θερμοκρασία για 72 ώρες παρουσία του αντιβιοτικού στρεπτομυκίνη. Κάθε πλασμίδιο εισέρχεται σε ένα βακτήριο. iii. Πόσοι βακτηριακοί κλώνοι υπάρχουν στην καλλιέργεια μετά και την επώαση; Να αιτιολογήσετε την απάντηση σας. Κλώνος ονομάζεται ένα σύνολο από γενετικώς πανομοιότυπα μόρια, κύτταρα ή οργανισμούς. Τα 16 ανασυνδυασμένα πλασμίδια αποτελούν 4 κατηγορίες, καθώς σε κάθε κατηγορία έχει συνδεθεί ένα αντίγραφο θραύσματος του αρχικού μιτοχονδριακού DNA. Ως εκ τούτου, μετά την καλλιέργεια σε θρεπτικό υλικό με στρεπτομυκίνη, προκύπτουν 5 κλώνοι. Οι τέσσερις από αυτούς φέρουν αντίγραφα του μιτοχονδριακού DNA και ένας κλώνος περιέχει μη ανασυνδυασμένο πλασμίδιο. ΜΟΝΑΔΕΣ 4 [Στην περίπτωση που ο υποψήφιος δεν συμπεριλάβει στην απάντησή του τον κλώνο με τα μη ανασυνδυασμένα πλασμίδια αφαιρείται 1 μονάδα] Η ανάλυση βάσεων σε ένα από τα θραύσματα του μιτοχονδριακού DNA έδειξε ότι περιέχεται η αλληλουχία βάσεων: ΤΕΛΟΣ 10ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

11 ΑΡΧΗ 11ΗΣ ΣΕΛΙΔΑΣ (α) AATTCTAAACATΑΤ TTAAA ATGTTATATGATAAAGTGCATTTA TATATA AATACAG (β) GATTTGTAΤΑ AATTT TACAATATACTATTTCACGTAAAT ATATAT TTATGTCTCAA Yποκινητής 1 Υποκινητής 2 Η αλληλουχία περιέχει ένα ακέραιο συνεχές γονίδιο που κωδικοποιεί πεπτίδιο, τμήμα ενός άλλου γονιδίου, που επίσης κωδικοποιεί πεπτίδιο, καθώς και τους υποκινητές τους (οι οποίοι υποδεικνύονται με έντονα γράμματα). iv. Να εξηγήσετε ποιος είναι ο υποκινητής (1 ή 2) του ακέραιου γονιδίου και να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που κωδικοποιεί το εν λόγω γονίδιο. v. Να γράψετε την αλληλουχία των πρώτων τεσσάρων αμινοξέων του πεπτιδίου που κωδικοποιεί το μη ακέραιο γονίδιο, χωρίς να αιτιολογήσετε την απάντησή σας. vi. Η ανάλυση του μιτοχονδριακού DNA ενός άνδρα και μιας γυναίκας έδειξε ότι έχουν πανομοιότυπη αλληλουχία βάσεων. Να γράψετε δύο πιθανές συγγενικές σχέσεις που μπορεί να έχουν τα άτομα αυτά και να αιτιολογήσετε την απάντησή σας. iv. Κατά την έναρξη της μεταγραφής ενός γονιδίου, η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια της μίας αλυσίδας του DNA σύμφωνα με τον κανόνα συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετεί το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνδέει τα ριβονουκλεοτίδια, που προστίθενται το ένα μετά το άλλο με 3-5 φωσφοδιεστερικό δεσμό. Η μεταγραφή, όπως άλλωστε και η αντιγραφή, έχει προσανατολισμό 5 3. Η σύνθεση του RNA σταματά στο τέλος του γονιδίου, όπου ειδικές αλληλουχίες, που ονομάζονται αλληλουχίες λήξης της μεταγραφής επιτρέπουν την απελευθέρωση του μορίου RNA. Το μόριο του RNA που συντίθεται από τη μεταγραφή είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Το RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Το ακέραιο γονίδιο μεταγράφεται σε mrna και στη συνέχεια μεταφράζεται σε πεπτίδιο. Το RNA συντίθεται με προσανατολισμό 5 3 και η RNA πολυμεράση μεταγράφει τη μη κωδική αλυσίδα του DNA από το 3 προς το 5 άκρο της. Το μεταφραζόμενο τμήμα στο μόριο του mrna αρχίζει με το κωδικόνιο έναρξης, που είναι 5 AUG 3 και τελειώνει στο κωδικόνιο λήξης που είναι 5 UGA 3 ή 5 UAG 3 ή 5 UAA 3. Για να εντοπίσουμε ποια από τις δύο αλυσίδες ενός γονιδίου ΤΕΛΟΣ 11ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ

12 ΑΡΧΗ 12ΗΣ ΣΕΛΙΔΑΣ είναι η μη κωδική πρέπει διαβάζοντας την από το 3 προς το 5 άκρο της να εντοπίσουμε την τριπλέτα 3 TAC 5 και μετά βαδίζοντας με βήμα τριπλέτας (δεδομένου ότι το γονίδιο είναι συνεχές) να εντοπίσουμε μία από τις τριπλέτες 3 ACT 5 ή 3 ATC 5 ή 3 ATT 5. Τις προϋποθέσεις αυτές πληροί η πρώτη αλυσίδα, στην οποία τα άκρα της είναι: (α) AATTCTAAACATΑΤ TTAAA ATGTTATATGATAAAGTGCATTTA TATATA AATACAG (β) GATTTGTAΤΑ AATTT TACAATATACTATTTCACGTAAAT ATATAT TTATGTCTCAA Yποκινητής 1 Υποκινητής 2 Άρα ο υποκινητής του ακέραιου γονιδίου είναι ο 2 και η αλληλουχία του είναι: Το πεπτίδιο είναι: 3 ΑΤΑΤΑΤ 5 5 ΤΑΤΑΤΑ 3 H 2 N-met-his-phe-ile-ile-COOH ΜΟΝΑΔΕΣ 7 [Στην περίπτωση που ο υποψήφιος δεν συμπεριλάβει στην απάντησή του τη θεωρία από τη μεταγραφή αφαιρούνται 2 μονάδες. Επίσης, εάν αιτιολογήσει ορθά, αλλά δεν επιτύχει να εντοπίσει τη σωστή κωδική ή μη κωδική αφαιρούνται 2 μονάδες.] v. Το μεταφραζόμενο τμήμα στο mrna που προκύπτει από το μη ακέραιο γονίδιο είναι: 5 AU AUG UUU AGA AUU 3 Συνεπώς, τα 4 πρώτα αμινοξέα που κωδικοποιούνται από αυτό είναι: H 2 N met phe arg- ile- COOH vi. ΜΟΝΑΔΕΣ 2 Το ζυγωτό των ανώτερων οργανισμών περιέχει μόνο τα μιτοχόνδρια που προέρχονται από το ωάριο. Συνεπώς η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική. Πιθανές συγγενικές σχέσεις μεταξύ ατών των δύο ατόμων είναι: α. μητέρα και γιός, καθώς η γυναίκα κληροδότησε το μιτοχονδριακό DNA στον γιό της, β. αδέλφια, που έχουν κληρονομήσει αμφότερα το μιτοχονδριακό DNA της μητέρας τους. ΜΟΝΑΔΕΣ 4 [Στην περίπτωση που ο υποψήφιος αναφερθεί σε άλλες συγγένειες όπως ξαδέλφια από δύο αδελφές- που αιτιολογούν πανομοιότυπο μιτοχονδριακό DNA, λαμβάνει τις μονάδες] ΤΕΛΟΣ 12ΗΣ ΑΠΟ 13 ΣΕΛΙΔΕΣ



ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα