Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε μιας από τις ακόλουθες ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner Α2. Σε ένα προκαρυωτικό κύτταρο δεν υπάρχουν: Α. Ριβοσώματα Β. Μεταγραφικοί παράγοντες Γ. Γονίδια που μεταγράφονται σε trna Δ. Γονίδια που μεταγράφονται σε snrna Α3. Η γραμμή τριχοφυΐας με κορυφή κληρονομείται με: Α. Αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας Β. Αυτοσωμικό επικρατή τύπο κληρονομικότητας Γ. Φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας Δ. Φυλοσύνδετο επικρατή τύπο κληρονομικότητας Α4. Τα μονοκλωνικά αντισώματα που χρησιμοποιούνται ως ανοσοδιαγνωστικά παράγονται από: Α. Ανθρώπινα Β λεμφοκύτταρα Β. Τον σπλήνα ποντικών Γ. Τα υβριδώματα Δ. Καρκινικά κύτταρα ΤΕΛΟΣ 1ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

2 ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ Α5. Άνδρας πάσχει από ασθένεια που οφείλεται σε μιτοχονδριακό γονίδιο. Εξαιτίας αυτού, η πιθανότητα να γεννηθεί απόγονος με την ίδια ασθένεια είναι: Α. 0% Β. 100% Γ. 0%, εάν ο απόγονος είναι θηλυκό άτομο Δ. 100%, εάν ο απόγονος είναι αρσενικό άτομο ΜΟΝΑΔΕΣ 25 Α1- Δ, Α2- Δ, Α3- Β, Α4- Γ, Α5- Α. [Ο υποψήφιος βαθμολογείται με 5 μονάδες για κάθε σωστή επιλογή.] ΘΕΜΑ Β Β1. Να γράψετε στο τετράδιό σας τις δομές που αναφέρονται στον πίνακα, κατά σειρά αυξανόμενου μεγέθους. Νουκλεοτίδιο Μεταφασικό χρωμόσωμα Χρωματίδα Νουκλεόσωμα Βραχίονας Καρυότυπος ΜΟΝΑΔΕΣ 6 Νουκλεοτίδιο, νουκλεόσωμα, βραχίονας, χρωματίδα, μεταφασικό χρωμόσωμα, καρυότυπος. [Ο υποψήφιος βαθμολογείται με 1 μονάδα για κάθε σωστή θέση.] Β2. Να εξηγήσετε για ποιους λόγους ένα μόριο mrna είναι δυνατό να μεταφερθεί από ένα ευκαρυωτικό κύτταρο σε ένα βακτήριο και να παραχθεί σε αυτό η πολυπεπτιδική αλυσίδα που κωδικοποιεί. ΜΟΝΑΔΕΣ 4 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

3 ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Αυτό πρακτικά σημαίνει ότι το mrna από οποιονδήποτε οργανισμό μπορεί να μεταφραστεί σε εκχυλίσματα φυτικών, ζωικών ή βακτηριακών κυττάρων in vitro και να παραγάγει την ίδια πρωτεΐνη. Τα ριβοσώματα αποτελούν θέσεις για τη μετάφραση οποιουδήποτε mrna. [Ο υποψήφιος βαθμολογείται με 3 μονάδες για την πρώτη απάντηση και με 1 μονάδα για τη δεύτερη.] Β3. Να εξηγήσετε τι είναι τα θνησιγόνα γονίδια. ΜΟΝΑΔΕΣ 5 Τα αλληλόμορφα γονίδια που προκαλούν πρόωρο θάνατο κατά την εμβρυική ζωή (συνήθως πριν από την 8 η εβδομάδα) ονομάζονται θνησιγόνα. Τα θνησιγόνα αλληλόμορφα προκαλούν αυτόματες αποβολές, δηλαδή πρόωρο τερματισμό της κύησης. Όταν ένας άνδρας και μία γυναίκα έχουν ο καθένας από ένα υπολειπόμενο θνησιγόνο αλληλόμορφο για το ίδιο γονίδιο, κάθε απόγονός τους έχει 25% πιθανότητα να είναι ομόζυγος για αυτά και συνεπώς να μην επιβιώνει μέχρι τη γέννηση. [Ο υποψήφιος βαθμολογείται με 5 μονάδες για την πλήρη περιγραφή. Στην περίπτωση που δεν αναφερθεί η πιθανότητα 25% ο υποψήφιος βαθμολογείται μόνον με 3 μονάδες.] Β4. Να περιγράψετε τη μέθοδο γονιδιακής θεραπείας της κυστικής ίνωσης. ΜΟΝΑΔΕΣ 5 Στην περίπτωση της κυστικής ίνωσης εφαρμόζεται η in vivo γονιδιακή θεραπεία, μέσω έξυπνων ιών-φορέων που προσβάλλουν τα κύτταρα του ιστού που πάσχει. Η διαδικασία που ακολουθείται είναι η ακόλουθη: Το φυσιολογικό γονίδιο ενσωματώνεται σε αδενοϊό (έξυπνος ιός-φορέας που προσβάλει ένα συγκεκριμένο είδος ιστού ή κυττάρου). Ο ανασυνδυασμένος αδενοϊός εισέρχεται στον οργανισμό με ψεκασμό με τη βοήθεια βρογχοσκοπίου και μολύνει τα κύτταρα του αναπνευστικού συστήματος. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

4 ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ Το φυσιολογικό γονίδιο ενσωματώνεται στο γονιδίωμα του οργανισμού και παράγει το φυσιολογικό προϊόν. [Ο υποψήφιος βαθμολογείται με 5 μονάδες για την πλήρη περιγραφή, αντίστοιχα για κάθε πρόταση.] Β5. Να γράψετε ποια είναι τα απαραίτητα θρεπτικά συστατικά για την ανάπτυξη μικροοργανισμών σε καλλιέργεια και να εξηγήσετε τον ρόλο τους. ΜΟΝΑΔΕΣ 5 Η ανάπτυξη των μικροοργανισμών απαιτεί την εξασφάλιση από το περιβάλλον ορισμένων θρεπτικών συστατικών. Θρεπτικά συστατικά είναι: Άνθρακας. Για τους αυτότροφους οργανισμούς πηγή άνθρακα είναι το CO 2 της ατμόσφαιρας, ενώ για τους ετερότροφους πηγή άνθρακα αποτελούν οι διάφορες οργανικές ενώσεις, όπως οι υδατάνθρακες. Άζωτο. Για τους περισσότερους μικροοργανισμούς πηγή αζώτου αποτελούν τα αμμωνιακά (ΝΗ 4 + ) ή τα νιτρικά ιόντα (NO 3 - ). Μεταλλικά ιόντα. Τα μεταλλικά ιόντα είναι απαραίτητα για την πραγματοποίηση χημικών αντιδράσεων στο κύτταρο και ως συστατικά διαφόρων μορίων. [Ο υποψήφιος βαθμολογείται με 5 μονάδες για την πλήρη περιγραφή, αντίστοιχα για κάθε πρόταση.] ΘΕΜΑ Γ Γ1. Τα γονίδια που σχετίζονται με τη σύνθεση των α-αλυσίδων της αιμοσφαιρίνης εντοπίζονται στην κορυφή του μικρού βραχίονα του χρωμοσώματος 16. Έλλειψη και των 4 γονιδίων αντιπροσωπεύει μη βιώσιμη κατάσταση. Σε σωματικό κύτταρο φυσιολογικού άνδρα στην αρχή της μεσόφασης συνέβη μετατόπιση του συγκεκριμένου τμήματος του χρωμοσώματος 16 στο χρωμόσωμα 19, όπως φαίνεται στο σχήμα: ΤΕΛΟΣ 4ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

5 ΑΡΧΗ 5ΗΣ ΣΕΛΙΔΑΣ i. Να αναφέρετε τις πιθανές συνέπειες που γνωρίζετε ότι είναι δυνατό να προκύψουν από τη μετατόπιση ή την αμοιβαία μετατόπιση τμημάτων μεταξύ των διαφόρων μη ομόλογων χρωμοσωμάτων (μονάδες 5). ii. Στο συγκεκριμένο κύτταρο γίνεται μείωση και παράγονται σπερματοζωάρια. Να εξηγήσετε ποιος είναι ο πιθανός αριθμός γονιδίων για την α αλυσίδα της αιμοσφαιρίνης στα σπερματοζωάρια που προέκυψαν (μονάδες 4). Να γράψετε ποια είναι η πιθανότητα από τη γονιμοποίηση αυτών των σπερματοζωαρίων με απολύτως φυσιολογικά ωάρια να προκύψει έμβρυο με φυσιολογικό αριθμό γονιδίων για την α αλυσίδα της αιμοσφαιρίνης και ποια η πιθανότητα να προκύψει μη βιώσιμο έμβρυο (μονάδες 4). ΜΟΝΑΔΕΣ 13 (5+4+4) i. Η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος χρωμοσώματος και στη συνέχεια επανένωσής του σε άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις συμβαίνει ανταλλαγή τμημάτων μεταξύ μη ομολόγων χρωμοσωμάτων, κατά τις οποίες συνήθως δεν χάνεται γενετικό υλικό και δεν προκαλείται μεταβολή στον φαινότυπο των ατόμων που τις φέρουν. Όμως είναι πιθανό από τα άτομα αυτά να γεννηθούν απόγονοι με χρωμοσωμικές ανωμαλίες επειδή κατά τον συνδυασμό των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη φυσιολογικοί γαμέτες. Επιπλέον, η μετατροπή ενός πρωτοογκογονιδίου σε ογκογονίδιο μπορεί να είναι το αποτέλεσμα μίας γονιδιακής μετάλλαξης ή μίας χρωμοσωμικής ανωμαλίας, συνηθέστερα μετατόπισης. Τέτοιες μεταλλάξεις είναι υπεύθυνες για την εμφάνιση καρκίνου. [Ο υποψήφιος βαθμολογείται με 5 μονάδες για την πλήρη περιγραφή, 2 για την περιγραφή της μη αλλαγής του φαινότυπου, 2 για τους μη φυσιολογικούς γαμέτες και 1 για την αναφορά στα πρωτο-ογκογονίδια. ] ii. Κατά τη μείωση, παράγονται γαμέτες σε κάθε έναν από τους οποίους μεταφέρεται ένα χρωμόσωμα από κάθε ζεύγος ομολόγων χρωμοσωμάτων του γονικού ατόμου. Επίσης κατά τον σχηματισμό γαμετών, τα χρωμοσώματα κάθε γονέα συνδυάζονται με τυχαίο ΤΕΛΟΣ 5ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

6 ΑΡΧΗ 6ΗΣ ΣΕΛΙΔΑΣ τρόπο. Συνεπώς, σε έναν γαμέτη που προκύπτει από το κύτταρο αυτό είναι δυνατό να μεταφερθεί: Το πρώτο χρωμόσωμα από το ζεύγος 16 και το πρώτο από το ζεύγος 19, οπότε υπάρχουν 4 γονίδια για την α αλυσίδα, Το πρώτο χρωμόσωμα από το ζεύγος 16 και το δεύτερο από το χρωμόσωμα 19, οπότε υπάρχουν 2 γονίδια για την α αλυσίδα, Το δεύτερο χρωμόσωμα από το ζεύγος 16 και το πρώτο από το ζεύγος 19, οπότε υπάρχουν 2 γονίδια για την α αλυσίδα, Το δεύτερο από το ζεύγος 16 και το δεύτερο από το ζεύγος 19, οπότε δεν υπάρχουν γονίδια για την α αλυσίδα. [Ο υποψήφιος βαθμολογείται με 2 μονάδες για την αιτιολόγηση του τρόπου με τον οποίο γίνεται ο διαχωρισμός των χρωμοσωμάτων στη μείωση και 2 μονάδες για τον αριθμό των γονιδίων σε κάθε είδος γαμέτη.] Γνωρίζουμε ότι στα σωματικά κύτταρα του ανθρώπου τα γονίδια για την α αλυσίδα της αιμοσφαιρίνης είναι διπλά, δηλαδή σε κάθε χρωμόσωμα υπάρχουν 2 γονίδια και συνεπώς συνολικά 4 γονίδια για την α αλυσίδα. Τα απολύτως φυσιολογικά ωάρια έχουν 2 γονίδια για την α αλυσίδα, άρα στα ζυγωτά που θα προκύψουν ο αριθμός των εν λόγω γονιδίων θα είναι αντίστοιχα: Συνεπώς, η πιθανότητα να προκύψουν ζυγωτά με φυσιολογικό αριθμό γονιδίων για την α αλυσίδα είναι 2/4 ή 50%. Η πιθανότητα να προκύψει μη βιώσιμο έμβρυο, δηλαδή χωρίς γονίδιο για την α αλυσίδα είναι 0%. [Ο υποψήφιος βαθμολογείται με 2 μονάδες για την αιτιολόγηση του αριθμού των γονιδίων για την α αλυσίδα στα σωματικά κύτταρα και μονάδα για κάθε σωστή πιθανότητα.] Γ2. Το μαύρο και κίτρινο χρώμα τριχώματος στις γάτες αποτελεί μονογονιδιακό χαρακτήρα. Ένα θηλυκό άτομο μπορεί να είναι μαύρο, μαυροκίτρινο ή κίτρινο και οι αρσενικοί γάτοι είναι μαύροι ή κίτρινοι. Από συνεχείς διασταυρώσεις ενός αρσενικού γάτου με το ίδιο θηλυκό (πατρική γενιά) προκύπτουν στην πρώτη θυγατρική γενιά απόγονοι σε σταθερή φαινοτυπική αναλογία: 1 θηλυκό κίτρινο : 1 θηλυκό μαυροκίτρινο : 1 αρσενικό μαύρο : 1 αρσενικό κίτρινο i. Να εξηγήσετε ποιος είναι ο τύπος κληρονόμησης του τριχώματος στις γάτες. ΤΕΛΟΣ 6ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

7 ΑΡΧΗ 7ΗΣ ΣΕΛΙΔΑΣ ii. Να συμβολίσετε κατάλληλα τα αλληλόμορφα για το κίτρινο και μαύρο χρώμα τριχώματος στις γάτες, να γράψετε και να αιτιολογήσετε τους γονότυπους και φαινότυπους των ατόμων της πατρικής γενιάς. (Δεν απαιτείται διασταύρωση και αιτιολόγηση των αναλογιών. Το φύλο στις γάτες καθορίζεται όπως στον άνθρωπο.) ΜΟΝΑΔΕΣ 12 (6+6) i. Δεδομένου ότι υπάρχουν άτομα με μαυροκίτρινο τρίχωμα συμπεραίνουμε ότι τα αλληλόμορφα για το χρώμα τριχώματος είναι συνεπικρατή. Συνεπικρατή ονομάζονται τα γονίδια που εκφράζονται και τα δύο αλληλόμορφα στο φαινότυπο των ετερόζυγων ατόμων. Επιπλέον, η ιδιότητα δεν κληρονομείται με όμοιο τρόπο σε θηλυκά και αρσενικά άτομα, αφού υπάρχουν μόνον θηλυκά άτομα μαυροκίτρινα. Συνεπώς, το γονίδιο για το χρώμα είναι φυλοσύνδετο. Ο τύπος κληρονομικότητας του τριχώματος στις γάτες είναι φυλοσύνδετος συνεπικρατής. [Ο υποψήφιος βαθμολογείται με 3 μονάδες για τα συνεπικρατή και 3 μονάδες για τα φυλοσύνδετα και την αντίστοιχη αιτιολόγηση.] ii. Συμβολίζουμε με Χ Κ το αλληλόμορφο για το κίτρινο χρώμα τριχώματος και Χ Μ το αλληλόμορφο για το μαύρο. Τα αρσενικά άτομα έχουν δύο διαφορετικά φυλετικά χρωμοσώματα ΧΥ, ενώ τα θηλυκά έχουν δύο όμοια φυλετικά χρωμοσώματα ΧΧ. Φυλοσύνδετα είναι τα γονίδια που βρίσκονται στην περιοχή του Χ χρωμοσώματος που δεν έχει αλληλόμορφο στο Υ. Τα αρσενικά άτομα κληρονομούν Χ χρωμόσωμα από τη μητέρα και Υ από τον πατέρα, ενώ τα θηλυκά άτομα κληρονομούν Χ χρωμόσωμα και από τον πατέρα. Δεδομένου ότι στη θυγατρική γενιά προκύπτουν αρσενικοί απόγονοι με μαύρο και άλλοι με κίτρινο χρώμα, το θηλυκό άτομο της πατρικής γενιάς έχει γονότυπο Χ Κ Χ Μ και φαινότυπο μαυροκίτρινο χρώμα. Το αρσενικό άτομο της πατρικής γενιάς έχει γονότυπο Χ Κ Υ και φαινότυπο κίτρινο χρώμα, διότι στη θυγατρική γενιά προκύπτουν θηλυκά κίτρινα, δηλαδή άτομα με γονότυπο Χ Κ Χ Κ. [Ο υποψήφιος βαθμολογείται με 2 μονάδες για τον σωστό συμβολισμό, 2 για την αιτιολόγηση της κληρονόμησης των Χ και Υ χρωμοσωμάτων σε θηλυκά και αρσενικά άτομα και 2 για τους σωστούς γονότυπους και φαινότυπους των ατόμων της πατρικής γενιάς.] ΘΕΜΑ Δ Η παρακάτω αλληλουχία αποτελεί ώριμο mrna που απομονώθηκε από ανθρώπινο κύτταρο με σκοπό τη δημιουργία cdna βιβλιοθήκης και κωδικοποιεί τη σύνθεση τετραπεπτιδίου. 5 GAAUUCAUGCCAUUUUAUUGAGAAUUC 3 ΤΕΛΟΣ 7ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

8 ΑΡΧΗ 8ΗΣ ΣΕΛΙΔΑΣ Δ1. Να γράψετε την αλληλουχία βάσεων του δίκλωνου DNA που παράγεται από αυτό το mrna κατά την κατασκευή της cdna βιβλιοθήκης και να σημειώσετε 5 και 3 τα άκρα της. Να αιτιολογήσετε την απάντησή σας. Να αναφέρετε (ονομαστικά) ποια ένζυμα χρησιμοποιήθηκαν για την κατασκευή του δίκλωνου αυτού DNA. 3 CTTAAGTACGGTAAAATAACTCTTAAG 5 5 GAATTCATGCCATTTTATTGAGAATTC 3 ΜΟΝΑΔΕΣ 9 (3+4+2) Μία αλυσίδα cdna δημιουργείται με πρότυπο ένα μόριο mrna. Από τη διαδικασία της αντίστροφης μεταγραφής παράγονται υβριδικά μόρια cdna-mrna. Στη συνέχεια το RNA διασπάται με κατάλληλες χημικές ουσίες ή αποδιατάσσεται με θέρμανση και η αλυσίδα cdna χρησιμεύει σαν καλούπι για τη σύνθεση της συμπληρωματικής DNA αλυσίδας. Το αποτέλεσμα είναι η δημιουργία δίκλωνου μορίου DNA. Κάθε αλυσίδα νουκλεοτιδίων σχηματίζεται από τη σύνδεση νουκλεοτιδίων με 3-5 φωσφοδιεστερικό δεσμό και για τον λόγο αυτό έχει προσανατολισμό 5 3. Επίσης οι δύο αλυσίδες DNA είναι αντιπαράλληλες, δηλαδή, όπου η μία έχει 5 άκρο ή άλλη απέναντι της έχει 3 άκρο. Η σύνθεση της συμπληρωματικής αλυσίδας cdna πραγματοποιείται από το ένζυμο αντίστροφη μεταγραφάση. Η σύνθεση του δίκλωνου DNA πραγματοποιείται από το ένζυμο DNA πολυμεράση. [Ο υποψήφιος βαθμολογείται με 3 μονάδες για την αλληλουχία, 4 μονάδες για την πλήρη αιτιολόγηση και με 1 μονάδα για την αναφορά σε κάθε ένα από τα 2 απαραίτητα ένζυμα.] Δ2. Το δίκλωνο DNA που προκύπτει τέμνεται από την περιοριστική ενδονουκλεάση EcoRI προκειμένου να εισαχθεί σε πλασμίδιο. Να γράψετε την αλληλουχία βάσεων στο θραύσμα σημειώνοντας τα 5 και 3 άκρα του και να αιτιολογήσετε την απάντησή σας. Η EcoRI αναγνωρίζει την αλληλουχία: ΤΕΛΟΣ 8ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ ΜΟΝΑΔΕΣ 3 (1+2) 5 -GAATTC-3 3 -CTTAAG-5 την οποία και κόβει σε κάθε αλυσίδα μεταξύ της G και της A (με κατεύθυνση 5 3 ) αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα κομμένα άκρα. Συνεπώς, μετά την επίδραση της EcoRI στο δίκλωνο DNA προκύπτει το τμήμα:

9 ΑΡΧΗ 9ΗΣ ΣΕΛΙΔΑΣ 3 GTACGGTAAAATAACTCTTAA 5 5 AATTCATGCCATTTTATTGAG 3 [Ο υποψήφιος βαθμολογείται με 2 μονάδες για την αλληλουχία που αναγνωρίζει η περιοριστική ενδονουκλεάση και τα άκρα της αλληλουχίας και 1 μονάδα για το θραύσμα] Δ3. Η παρακάτω αλληλουχία αποτελεί τμήμα πλασμιδίου που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης του γονιδίου για το τετραπεπτίδιο. 3 CAGCTC CTTAAGG.5 5 GTCGAG GAATTCC.3 ΥΠΟΚΙΝΗΤΗΣ Το τμήμα 3 CAGCTC 5 5 GTCGAG 3 αποτελεί υποκινητή του πλασμιδίου. Το πλασμίδιο θραύεται μία φορά με την EcoRI στο εσωτερικό του τμήματος. Να γράψετε τα άκρα του πλασμιδίου μετά τη θραύση του. Να μην αιτιολογήσετε την απάντησή σας. ΜΟΝΑΔΕΣ 1 3 CAGCTC CTTAA 5 GTCGAG G GG.5 AATTCC.3 [Ο υποψήφιος βαθμολογείται με 1 μονάδα.] Δ4. Αντίγραφα από τα θραύσματα DNA του ερωτήματος Δ2 αναμίχθηκαν με αντίγραφα του ανοιγμένου πλασμιδίου και DNA δεσμάση, οπότε προέκυψαν ανασυνδυασμένα πλασμίδια με δύο διαφορετικές αλληλουχίες βάσεων. i. Να γράψετε τις δύο αλληλουχίες βάσεων των ανασυνδυασμένων πλασμιδίων, τις οποίες και να ονομάσετε (με επιλογή σας) «πλασμίδιο 1» και «πλασμίδιο 2». ii. Με τα ανασυνδυασμένα πλασμίδια 1 και 2 μετασχηματίζονται βακτήρια κατάλληλα για κλωνοποίηση. Να εξηγήσετε σε ποια βακτήρια (αυτά που μετασχηματίστηκαν με το πλασμίδιο 1 ή σε αυτά που μετασχηματίστηκαν με το πλασμίδιο 2) θα παραχθεί το τετραπεπτίδιο. ΜΟΝΑΔΕΣ 10 (3+7) ΤΕΛΟΣ 9ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ

10 ΑΡΧΗ 10ΗΣ ΣΕΛΙΔΑΣ ΑΠΑΝΤΗΣΗ i. Η σύνδεση των θραυσμάτων DNA με τον φορέα κλωνοποίησης στηρίζεται στη συμπληρωματικότητα των άκρων που δημιουργούνται από την περιοριστική ενδονουκλεάση. Συνεπώς, το ανοιγμένο πλασμίδιο είναι δυνατό να συνδεθεί με τα θραύσματα από το ερώτημα Δ2 με δύο διαφορετικούς τρόπους: Πλασμίδιο 1 3 CAGCTCCTTAA GTACGGTAAAATAACTCTTAA GG 5 5 GTCGAGGAATT CATGCCATTTTATTGAGAATTCC 3 Πλασμίδιο 2 3 CAGCTCCTTAAGAGTTATTTTACCGTACTTAA GG 5 5 GTCGAGGAATTCTCAATAAAATGGCATGAATT CC 3 [Ο υποψήφιος βαθμολογείται με 1 μονάδα για την αιτιολόγηση του τρόπου σύνδεσης λόγω συμπληρωματικότητας και από 1 μονάδα για κάθε σωστή αλληλουχία στα πλασμίδια 1 και 2.] ii. Για να γίνει η μεταγραφή ενός γονιδίου, η RNA πολυμεράση συνδέεται με τον υποκινητή του γονιδίου με τη βοήθεια μεταγραφικών παραγόντων, προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA και μεταγράφει τη μία αλυσίδα του DNA που ονομάζεται μη κωδική. Από τη μεταγραφή προκύπτει μόριο RNA με προσανατολισμό 5 3, το οποίο είναι συμπληρωματικό και αντιπαράλληλο με τη μη κωδική αλυσίδα. Συνεπώς η μεταγραφόμενη αλυσίδα σε κάθε περίπτωση (τόσο στο πλασμίδιο 1 όσο και στο 2) είναι η πρώτη. Όμως, μόνον από τη μεταγραφή του πλασμιδίου 1 προκύπτει mrna κατάλληλο για τη σύνθεση του τετραπεπτιδίου, διότι μόνο από τη μεταγραφή αυτού προκύπτει RNA με τα κωδικόνια AUG CCA UUU UAU UGA. [Ο υποψήφιος βαθμολογείται με 3 μονάδες για τη σύνδεση της RNA πολυμεράσης με τον υποκινητή, 2 μονάδες για την αντιπαραλληλία και 2 μονάδες για την εύρεση του πλσμιδίου.] Δ5. Σήμερα φαρμακευτικά πεπτίδια είναι δυνατό να παραχθεί επίσης από ζώα gene pharming. Να εξηγήσετε για ποιο λόγο η μέθοδος gene pharming πλεονεκτεί έναντι της μεθόδου παραγωγής ανθρώπινων φαρμακευτικών πρωτεϊνών από βακτήρια. ΜΟΝΑΔΕΣ 2 ΑΠΑΝΤΗΣΗ Η μέθοδος gene pharming στηρίζεται στην παραγωγή πρωτεϊνών από κύτταρα των μαστικών αδένων των ζώων, όπως προβάτων και αγελάδων ώστε να είναι δυνατή η συλλογή της πρωτεΐνης από το γάλα των ζώων. Η μέθοδος σε σχέση με την παραγωγή πρωτεϊνών από βακτήρια, παρουσιάζει το πλεονέκτημα ότι από τα διαγονιδιακά ζώα παράγονται πρωτεΐνες όμοιες με αυτές που παράγονται από τον ανθρώπινο οργανισμό αλλά και πολύπλοκες πρωτεΐνες που τα βακτήρια δεν είναι δυνατό να συνθέσουν διότι στερούνται τους μηχανισμούς τροποποίησης των πρωτεϊνών που διαθέτουν οι ευκαρυωτικοί οργανισμοί. ΤΕΛΟΣ 10ΗΣ ΑΠΟ 10 ΣΕΛΙΔΕΣ [Ο υποψήφιος βαθμολογείται με 2 μονάδες.]

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ. Η Επιτροπή Παιδείας της ΠΕΒ

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 30 Μαΐου 2012 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΘΗΜ / ΤΞΗ: ΙΟΛΟΓΙ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝ) ΗΜΕΡΟΜΗΝΙ: 22/01/2017 ΕΠΙΜΕΛΕΙ ΔΙΓΩΝΙΣΜΤΟΣ: ΝΟΤ ΛΖΡΚΗ ΘΕΜ Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. πό τη διασταύρωση ελέγχου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. A Α2. Γ Α3. Α4. Β Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 30 ΜΑΪΟΥ 2012 ΑΠΑΝΤΗΣΕΙΣ B1. Τα µονοκλωνικά αντισώµατα µεταξύ των άλλων χρησιµοποιούνται και για την επιλογή οργάνων συµβατών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΚΥΡΙΑΚΗ 27/03/2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΠΤΑ (7) ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα


ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β

ΘΕΜΑ Α ΘΕΜΑ Β. Σωστό το β ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΚΑΤΕΥΘΥΝΣΗΣ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2012 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία

Διαβάστε περισσότερα