http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology K562 K562

Transcript

1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 367 OAZ1 K562 1 ** 2 ** 1 * 2 1 2* OAZ OAZ1 K562 OAZ1 plvx-neo- OAZ1-IRES-ZsGreen K562 Western FACS CD71 GPA hemin RT-PCR K562 GATA1 BCR / ABL TGFβ OAZ1 K562 OAZ1 CD71 + / GPA ± 2 09 % 4 07 ± 1 04 % 1 79 ± 2 36 % P < ± % P < 0 01 GATA1 BCR / ABL mrna OAZ1 TGFβ OAZ1 K562 TGFβ -1 OAZ1 R34 Effect of Ornithine Decarboxylase Antizyme 1 on the Erythroid Differentiation in Human Leukemia Cell Line K562 WU Bing-Ping 1 * * WANG Xing 2 * * MA Wen-Li 1 * ZHANG Si-Yi 2 ZHENG Wen-Ling 1 JIANG Li 2 * 1 Institute of Genetic Engineering Southern Medical University Guangzhou China 2 Guangdong General Hospital Guangdong Academy of Medical Sciences Guangzhou China Abstract Recently ornithine decarboxylase antizyme OAZ1 has been much concerned for its potentials in anti-tumor To investigate the role of OAZ1 in inducing the erythroid differentiation in human leukemia cell line K562 the lentivirus vector plvx-neo-oaz1-ires-zsgreen targeting gene OAZ1 modified at the frameshift site was constructed to transfect K562 cells OAZ1 overexpression efficiency was assessed by Western blotting The potential effect of OAZ1 in inducing erythroid differentiation were obtained by detecting two surface markers CD71 and GPA and the benzidine staining To explore the induction mechanism the relevant genes GATA1 BCR / ABL and TGFβ related with the differentiation and cancer formation of leukemia were detected by real-time RT-PCR adding the hemin-induced group The results showed that recombinant lentiviral vector and the overexpression cell line were successfully No No * Tel wenli@ fimmu com Tel jiangli27556@ vip 126 com * * Received December Accepted January Supported by National Natural Science Foundation of China No and Natural Science Foundation of Guangdong Province No and Leading Talent Project of Guangdong Province * Corresponding auther Tel wenli@ fimmu com Tel jiangli27556@ vip 126 com * * Co-first authors

2 constructed The positive rate of double labeling CD71 + / GPA + was ± 2 09 % in cells transfected with OAZ1 lentivirus which was significantly higher than that in the untreated cells 4 07 ± 1 04 % or in the treated cells with empty virus 1 79 ± 2 36 % P < 0 01 The positive rate of benzidine staining was ± % which was also significantly higher than that in other two groups P < 0 01 Quantitative results indicated that OAZ1 had more siginificant function on TGFβ than that in GATA1 or BCR / ABL In conclusion OAZ1 could effectively induce the erythroid differentiation in K562 cells and this induction is possiblely related to TGFβ signaling pathway Key words ornithine decarboxylase antizyme-1 OAZ-1 chronic myelogenous leukemia erythroid differentiation polyamine IgG-HRP OAZ1 Biomol CD71-PE CD235a -Percp IgG1-PE IgG1-1 Percp ebioscience G418 Merck ornithine decarboxylase antizyme OAZ PrimeScript RT SYBR Premix E Taq RNAiso ornithine Plus RNAfree ddh 2 O TaKaRa decarboxylase ODC 26S 1 2 ODC K562 10% RPMI μg / ml IU / ml 37 5% CO 2 OAZ1 2 ~ 3 d OAZ1 K K562 / OAZ Sigma EcoRI XbaI plvx-neo-ires-zsgreen OAZ1 OAZ1 JM109 plvx-neo-oaz1-ires-zsgreen 1 4 hemin 50 μmol / L DMSO K h OAZ1 2 ORF hemin ORF1 TCCTGATG 9 RD-PCR + 1 cdna OAZ1 K562 OAZ TCCTGATG TCCGATG OAZ1 TaKaRa 687 bp pmd19- OAZ1 T RPMI-1640 Gibco 4 plvx-neo-ires- Lentivirus ZsGreen VSVG prre REV 293T EcoRI XbaI T4 DNA Ligase 48 h NEB Qiagen OAZ1 GFP - 80 Western GAPDH K / ml 2 ml /

3 4 OAZ1 K IgG1-PE IgG1-Percp 12 h G μg / ml PBS / ml 20 μl 1 5 Western 3 K562 K562 / GFP K562 / OAZ1 PBS 2 RIPA PMSF 4 30 min 12% SDS-PAGE 1 7 RT-PCR OAZ1 GATA1 BCR / ABL PVDF 5% 2 h TGFβ HRP IgG ~ 2 Blast PAGE h ECL FluorChem 8900 K562 K562 / GFP K562 / OAZ1 hemin FACS CD71 GPA 10 6 / PBS 2 10 μl PCR 95 CD71 30 s 95 5 s s 40 PCR 55 A glycophorin GPA 4 30 min PBS 5 μl 0 2% 990 μl 10 μl 30% 5 min μmol / L hemin 96 h RNA RNAiso Plus PrimeScript RT cdna RT-PCR ~ / s nm FACS Table1 ACTB Table 1 Primer sequences of Real-time RT-PCR Primers Sequence 5'-3' Product length / bp OAZ1 NM_ F CTTCATTTGCTTCCACAAGAACC 82 R TCTCACAATCTCAAAGCCCAAA GATA1 NM_ F TTTCAGGTGTACCCATTGCTCA 198 R CCGCTCTGTCTTCAAAGTCTCC BCR / ABL AJ F TGGGTTTCTGAATGTCATCGTC 195 R GCCACAAAATCATACAGTGCAA TGFβ NM_ F CTGCCCCTACATTTGGAGCCTG 146 R GCTTGCGGCCCACGTAGTACAC ACTB NM_ F TGGCACCCAGCACAATGAA 186 R CTAAGTCATAGTCCGCCTAGAAGCA 1 8 x 珋 ± s Fig 1 SPSS plvx-neo-oaz1-ires- ZsGreen framshift 205 T plvx-neo-oaz1-ires-zsgreen 2 2 K T 48 h OAZ1 GFP 293T 48 h OAZ TU / ml GFP 10 8 TU / ml 687 bp pmd19-t K562 2 plvx-neo- K562 / GFP 48 h IRES-ZsGreen G418

4 OAZ1 Western K562 K562 / GFP K562 / OAZ1 OAZ1 Fig OAZ1 K CD71 GPA FACS Fig 4 K562 / OAZ1 CD71 + / GPA + K562 K562 / GFP P < 0 01 K562 K562 / GFP K562 / Fig 1 Validation of the recombinant lentivirus vector The recombinant lentivirus vector plvx-neo-oaz1-ires- ZsGreen was double digested by EcoRI and XbaI and then separated in 1% agarose gel electrophoresis M 2 kb DNA marker 1 ~ 3 plvx-neo-oaz1-ires-zsgreen the inserted target gene OAZ1 was 687 bp GFP CD71 + / GPA - P < 0 01 OAZ1 GPA CD71 K562 /GFP CD71 Table 2 95 % K562 / GFP Fig 5 K562 / OAZ1 G418 K562 K562 / GFP % ± % ± % K562 / GFP K562 / OAZ ± 90 % K562 / % K562 K562 / GFP P < OAZ1 OAZ OAZ1 K562 G % Fig 2 Table 2 Fig 3 Western blot analysis of OAZ1 expression levels in K562 K562 / GFP and K562 / OAZ1 Histogram in the right was the gray analysis of Western blotting in the left and normalization was done to GAPDH OAZ1 protein level in K562 / OAZ1 cells elevated approximately 1 5 times than that in other two groups K562 untreated control K562 / GFP negative control K562 / OAZ1 OAZ1 overexpression cell line The positive rate of cell differentiation markers Group Positive rate / % CD71 + / GPA - CD71 - / GPA + CD71 + / GPA + CD71 - / GPA - K ± ± ± ± 4 96 K562 / GFP ± 2 58 ** 0 00 ± ± ± 0 23 K562 / OAZ ± ± ± 2 09 ** 3 68 ± 2 47 Data were means ± S D from three independent experiments * * P < 0 01 vs K562 cells or K562 / GFP cells

5 4 OAZ1 K Fig 2 Green fluorescence detection by FACS left and fluorescence microscopic images right 200 The fluorescent rate and intensity of the K562 / OAZ1 cells were obviously less than the negative control coincidence with the micrograph A K562 / GFP the negative control group in which K562 cells were transfected with GFP virus B K562 / OAZ1 the overexpression group in which K562 cells were transfected with OAZ1-GFP virus Fig 4 Induction effect of OAZ1 on cells erythroid differentiation by detecting two surface markers CD71 and GPA The data represent one of three independent expriments Double staining positive rate CD71 + / GPA + in K562 / OAZ1 cells were significantly higher than that in other two groups A K562 untreated control B K562 / GFP negative control C K562 / OAZ1 OAZ1 overexpression cell line Fig 5 Benzidine staining analysis of the erythroid differentiation of cells 400 Cells expressing hemoglobin could oxidate benzidine staining forming the blue sediment in the active region Benzidine staining positive rate in K562 / OAZ1 cells were significantly higher than that in other two groups The date represent one of three independent expriments A K562 untreated control B K562 / GFP negative control C K562 / OAZ1 OAZ1 overexpression cell line

6 OAZ1 K562 GATA1 BCR / ABL TGFβ OAZ1 K562 hemin K562 RT-PCR GATA1 BCR / ABL TGFβ Fig 6 K562 / OAZ1 OAZ1 GATA1 BCR / ABL OAZ1 TGFβ Hemin OAZ1 K562 / GFP 9 GATA1 TGFβ OAZ1 OAZ1 Western OAZ1 TGFβ hemin 1 5 OAZ1 K562 K562 CD71 GPA Fig 6 Analysis of the relevant genes by real-time RT-PCR GATA1 BCR / ABL and TGFβ genes were analysed to explore the induction mechanism caused by OAZ1 K562 / GFP and K562 / OAZ1 cells were obtained K562 / Hemin cells were treated with 50 μmol / L hemin in 96 hours Normalization were completed to ACTB mrna * P < 0 05 * * P < 0 01 vs K562 cells or K562 / GFP cells P < 0 05 P < 0 01 vs K562 cells OAZ1 K562 K562 / GFP K562 / OAZ1 OAZ1 K562 OAZ1 GATA1 BCR / ABL TGFβ GATA1 A / T GATA A / G GATA 8 15 BCR / ABL P TGFβ K562 TGFβ / Smads TGFβ OAZ1 TGFβ mrna GATA1 BCR / ABL hemin OAZ1 9 hemin GATA1 TGFβ mrna 3 BCR / ABL OAZ1 hemin K562 P210 bcr / abl P210 bcr / abl PTK CyclinD1 Smad1 Aurora-A P210 bcr / abl OAZ1 TGFβ / Smads OAZ Hemin OAZ OAZ1 hemin OAZ1 OAZ1

7 4 OAZ1 K K562 Li Zheng Wen-Ling et al References 1 Agostinelli E Marques M P Calheiros R et al Polyamines fundamental characters in chemistry and biology J Amino Acids Schipper R G Cuijpers V M De Groot L H et al Intracellular localization of ornithine decarboxylase and its regulatory protein antizyme-1 J J Histochem Cytochem Kim J S Kim T L Cho E W et al Antizyme suppression leads to an increment of the cellular redox potential and an induction of HIF-1alpha its involvement in resistance to gamma-radiation J IUBMB Life Liu G Y Liao Y F Hsu P C et al Antizyme a natural ornithine decarboxylase inhibitor induces apoptosis of haematopoietic cells through mitochondrial membrane depolarization and caspases' cascade J Apoptosis Yamamoto D Shima K Matsuo K et al Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation H3K9me2 in human oral cancer cell line J PLoS One e Tsuji T Katsurano M Ibaragi S et al Ornithine decarboxylase antizyme upregulates DNA-dependent protein kinase and enhances the nonhomologous end-joining repair of DNA doublestrand breaks in human oral cancer cells J Biochemistry Koeffler H P Golde D W Human myeloid leukemia cell lines a review J Blood K562 Smads signal transduction and leukemic cells J J Shanghai J Wang Wei-Jia Zhang Yan The research progress of erythroid differentiation in human leukemia cell line K562 J Int J Labor Med K562 J Jiang Li Ma Wen- Screening of the differentiationrelated genes from K562 cells induced by hemin J Acta Anat Sin Matsufuji S Matsufuji T Miyazaki Y et al Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme J Cell Kurian L Palanimurugan R Godderz D et al Polyamine sensing by nascent ornithine decarboxylase antizyme stimulates decoding of its mrna J Nature Rato C Amirova S R Bates D G et al Translational recoding as a feedback controller systems approaches reveal polyaminespecific effects on the antizyme ribosomal frameshift J Nucleic Acids Res Lin Y Martin J Gruendler C et al A novel link between the proteasome pathway and the signal transduction pathway of the bone morphogenetic proteins BMPs J BMC Cell Biol J Jiang Li Ma Wen-Li Ornithine decarboxylase antizyme protein and inhibition of cell proliferation J J Med Mol Biol GATA-1 J Jin Cheng-Qiang Liu Fang The research progress of the transcription factor GATA-1 J Int J Immunol Melo J V The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype J Blood TGF-β / Smads J Shen Jing-Jing Zhong Lu Chen Fang-Yuan Relationship between TGF-β / Jiaotong Univ Health Sci Meulmeester E Ten Dijke P The dynamic roles of TGF-beta in cancer J J Pathol