Research Paper Corynebacterium crenatum γ- EC γ-glutamyl kinase prob. prob PCR. prob prob. C. crenatum ΔproB

Transcript

1 Acta Microbiologica Sinica November 2011 ISSN CN / Q http / / journals. im. ac. cn / actamicrocn Research Paper γ- L * L- L- L Corynebacterium crenatum γ- EC γ-glutamyl kinase prob prob PCR prob prob C. crenatum prob ΔproB ΔproB ΔproB PCR γ- prob ΔproB 9. 6% L % α- prob γ- L- Q814 A L- L- L- N- 1-2 L- γ- 3 γ- L N- L- car L- argi 8 * Tel / Fax dingjy@ sun. im. ac. cn mypicture@ 163. com

2 γ- L / N L γ- L- L- 1 Fig. 1 Diagram of the central metabolism and the biosynthesis of several amino acids of C. glutamicum. Abbreviations PEPCk PEP carboxykinase PEPCx PEP carboxylase PYC pyruvate carboxylase argj ornithine acetyltransferase ProB γ-glutamyl kinase NAG N- Acetyl-glutamate γ-gp γ-glutamylphosphate. Dashed arrows indicate pathways consisting of several reactions solid arrows indicate single reactions LB E. coli C. crenatum 2LB 4% C. crenatum 13 3LB 10% TaKaRa L- BBI 4 PEP Sigma 20 g NH 4 2 SO 4 7 g ATP Bio Basic Inc NADH K 2 HPO 4 3H 2 O 0. 3 g KH 2 PO g MgSO 4 7H 2 O Ameresco 0. 4 g NaCl 0. 1 g FeSO 4 7H 2 O 25 mg MnSO 4 H 2 O MJ PTC mg CaCl 2 H 2 O 50 mg 0. 4 mg BIO-RAD MicroPulser TM Beckman DU800 Alphalmager EC Agilent mg 50 mg 400 mg

3 1478 Xiaoman Li et al. / Acta Microbiologica Sinica Table 1 1 The strains and plasmids used in this work Strains or plasmids Characteristics Source Escherichia coli DH5α C. crenatum φ80 LacZΔM15 deor reca1 enda1 hsdr17 Stored in this lab his - SG R This lab ΔproB his - SG R pro with prob knock-out This study ΔproB-C his - SG R ΔproB complemented with pbs57-prob This study Plasmids pmd19-t T-vector 2. 7 kb Amp R lacz TaKaRa Co. pk18mobsacb Mobilizable E. coli vector Km R Suc S Sch fer A 11 pt-fprob pmd19-t containing prob upstream fragment from This study pt-bprob pmd19-t containing prob downstream fragment from This study pt-prob pmd19-t containing 1. 2kb PCR fragment of prob gene This study pk18-fprob pk18mobsacb containing prob upstream fragment from This study pk18-δprob pk18mobsacb containing prob in-frame deletion fragment ΔproB from This study pbs57 E. coli-c. glutamicum shuttle expression vector Km R This lab pbs57-prob pbs57 containing prob from to generate prob expression or complementation for ΔproB This study his - no cell growth without histidine addition on minimal medium SG sulfaguanidine pro - no cell growth without proline addition on minimal medium. ΔproB ph g NH 4 2 SO 4 35g K 2 HPO 4 3H 2 O 1 g Table 2 Primers for gene amplification and gene disruption KH 2 PO g MgSO 4 7H 2 O 0. 4 g FeSO 4 7H 2 O Primers Sequences 5' 3' Size / bp Restriction site 20 mg MnSO 4 H 2 O 20 mg 0. 1 mg ΔproB ph % E. coli 0. 2 mg CaCO 30 g 50 mg 400 mg P2 P1 AAGTGACAGAGCTTCCCGAC TCTAGA TTATGCGCGCCTG GCGTAGTTGG TTTAAA TAAGGAAGCTA XbaⅠ DraⅠ 37 C. crenatum μg / ml P3 50 μg / ml GGT AAGCTT AGCCAGCGCC CTCGCATTGT 29 HindⅢ CGG TCTAGA ACTGCGCCAG 1. 2 DNA P4 AGGACACAAC E. coli 12 E. coli 29 XbaⅠ CaCl 2 C. crenatum GAC TCTAGA TGATGATGGC P5 29 XbaⅠ 1. 3 prob PCR C. glutamicum R γ- prob GenBank accession number AP prob prob 2 Primer premier 5. 0 P3 P4 prob FproB P5 P6 prob BproB PCR 20 μl Tris-HCl ph s 68 1 min μl EasyTaq DNA min P6 GCGGTGGAAG CAC GAATTC TGGCTGTCAG GAAGTGGCTC 29 EcoRⅠ Boxed bases indicate restriction sites bold bases indicate Shine-Dalgarno sequence underlined bases indicate homologous sequences with prob P1 P2 prob γ ΔproB ΔproB-C h 50 mmol / L r / min 15 min min

4 γ- L / ml 55 g / L FeCl 3 20 g / L SBA-40C 21 ml / L HCl γ- A 535 γ r / min 250 L mol - 1 cm - 1 γ- Agilent nmol γ Agilent A 40mmol / L NaH 2 PO 4 ph7. 8 B 193-ΔproB 4 30 ACN MeOH v / v / v 18 2 DAD 338 nm 262 nm r / min 15 min 10 min r / min 10 min μm 15 A 340 NADH Agilent L mol - 1 cm mmol / L H 2 SO ml / min 1 nmol NADH NAD μl DAD 210 nm ΔproB h 50 mmol / L Tris-HCl ph mmol / L NaCl 2 HEPES 100 mmol / L 20% - 20 PCR 1. 2 kb 3% CTAB pmd19-t E. coli DH5α 0. 3% 1 min LB prob 1246 bp 1221 bp 16 A 340 C. crenatum prob 1 nmol NADH % GenBank 17 JF ΔproB prob DraⅠ XbaⅠ r / min 12 h 12 h 100 mmol / L Tris- HCl ph % 5 coli DH5α LB r / min 12 h prob pbs mol / L HCl prob 600 nm 2. 2 pk18-δprob 10 min μm Zorbax Eclipse-AAA 2. 0 ml / min Aminex HPX-87H BioRad prob DNA P1 P2 pt-prob ORF GTG 406 C. glutamicum R prob % 8 DraⅠ Xba Ⅰ pt-prob pbs57 prob E DNA P3

5 1480 Xiaoman Li et al. / Acta Microbiologica Sinica P4 P5 P6 PCR 1. 1 kb 2. 4 prob pmd19-t E. coli DH5α LB PCR pt-fprob pt-bprob HindⅢ XbaⅠ pt-fprob FproB Hind Ⅲ Xba Ⅰ ΔproB pk18mobsacb FproB PCR bp E. coli DH5α LB 2 prob pk18-fprob Xba E. coli DH5α LB prob DNA pk18-δprob prob 2 Fig. 2 prob PCR 2. 3 prob of prob of PCR fragment of prob of ΔproB. pk18-δprob LB ΔproB ΔproB-C pk18-δprob h pk18-δprob DNA DNA ΔproB ΔproB-C 3 3 prob pk18-δprob sacb DNA Ⅰ EcoRⅠ pt-bprob BproB Xba Ⅰ EcoR Ⅰ pk18- FproB BproB PCR prob prob 3 prob ΔproB ΔproB-C ΔproB 2. 1 pbs57-prob Fig. 3 The growth of ΔproB and ΔproB-C on prob ΔproB minimal medium. Ⅰ Minimal medium containing histidine Ⅱ LB Minimal medium containing histidine and proline. a C. crenatum b C. crenatum ΔproB c C. crenatum ΔproB-C ΔproB prob ΔproB DNA P3 P6 PCR PCR Characterization of defined prob knock-out mutant by PCR analysis. M. DNA marker Trans5K DNA Marker 1. PCR fragment ΔproB-C.

6 γ- L / γ ΔproB ± U / mg ΔproB-C ± U / mg % prob ΔproB ΔproB prob 2. 5 prob prob L ΔproB % 4-A L ΔproB ΔproB L g / L % 4-B Fig. 4 prob production profiles ΔproB A B Time course of and ΔproB fermentation A cell growth profiles B glucose consumption and L-arginine Strains 3 Table 3 Comparison of fermentation parameters of the two strains Parameters P Arg / g / L X max / g / L Q S / g / L h R X / g / L h Y P / S g / g Y X / S g / g Φ g / L h ΔproB P Arg Arginine Production X max The maximum Cell Dry weight Q S Glucose consumption rate R X Average Growth Rate Y P / S Arginine yield on Glucose Y X / S Biomass yield on Glucose Φ Arginine productivity ΔproB ΔproB % 31. 2% α- 145% 194% 70% 9. 1% 31. 4% 49. 7% 5

7 1482 Xiaoman Li et al. / Acta Microbiologica Sinica Table 4 4 The analysis of by-product amino acids in fermentation broth c Amino acid / mg / L Strains Aspartate Asparagine Isoleucine Lysine Threonine ± ± ± ± ± ΔproB ± ± ± ± ± Methionine Glutamate Glutamine Citrulline Serine ± ± ± ± ± ΔproB ± ± ± ± ± Tyrosine Phenylalanine Alanine Valine Leucine ± ± ± ± ± ΔproB ± ± ± ± ± Table 5 5 The analysis of organic acids in fermentation broth c Organic acid / g / L Strains Citirc acid Acetic acid Lactic acid Succinic acid Malic acid ± ± ± ± ± ΔproB ± ± ± ± ± Pyruvate α-ketoglutaric acid PEP ± ± ± ΔproB ± ± ± prob α- 3 α- L γ- prob L- L- prob 2. 6 γ- L- prob L % prob α- ΔproB prob α- 75% 44% ΔproB L ΔproB 50% α- Table 6 Specific activity of PEPCx and PYC of and ΔproB Strains PEPCx / U / mg protein Specific enzyme activity PYC / U / mg cell dry weight ± ± ΔproB ± ± 13. 9

8 γ- L / Xu Y Labedan B Glansdorff N. Surprising Arginine prob Biosynthesis a Reappraisal of the Enzymology and Evolution of the Pathway in Microorganisms. Micorobiology and molecular biology review prob Reengineering of a Corynebacterium glutamicum L ΔproB Arginine and L-Citrulline Producer. Applied and prob Environmental Microbiology prob 10. N-. Acta Microbiologica Sinica Sh fer A Tauch A J ger W Kalinowski J Thierbach ΔproB G Pühler. A. Small mobilizable multi-purpose cloning ArgR vectors derived from the Escherichia coli plasmids pk18 argr and pk19 selection of defined deletions in the N- argb chromosome of Corynebacterium glutamicum. Gene Sambrook J Russell DW ΔproB argr argb Jang KH Britz ML. Improved electrotransformation frequencies of Corynebacterium glutamicum using cellsurface mutants. Biotechnology Letters Flynn NE Meininger CJ Haynes TE Wu G. The 545. metabolic basis of arginine nutrition and 14 Hayzer DJ Leisinger T. The gene-enzyme relationships pharmacotherapy. Biomedicine & Pharmacotherapy of proline biosynthesis in Escherichia coli. Journal of de Jonge WJ Kwikkers KL te Velde AA van Deventer SJ Nolte MA Mebius RE Ruijter JM Lamers MC general microbiology O' Regan M Thierbach G Bachmann B Villeval D Lepage P Viret JF Lemoine Y. Cloning and nucleotide Lamers WH. Arginine deficiency affects early B cell sequence of the phosphoenolpyruvate carboxylase-coding maturation and lymphoid organ development in transgenic gene of Corynebacterium glutamicum ATCC Gene mice. Journal of Clinical Investigation Bian K Murad F. Nitric oxide NO - biogeneration regulation and relevence to human diseases. Frontiers in 16. CD945. Acta Microbiologica Sinica bioscience Lu CD. Pathways and regulation of bacterial arginine metabolism and perspectives for obtaining arginine overproducing strains. Applied Microbiology and Biotechnology Food Science prob ΔproB. L- argh prob γ-. China Biotechnology proa 1kb proa Tuchman M Rajagopal BS McCann MT Malamy MH. -5- proc Enhanced production of arginine and urea by genetically prob engineered Escherichia coli K-12 strains. Applied and 600bp Environmental Microbiology bp prob ORF 9 Ikeda M Mitsuhashi S Tanaka K Hayashi M Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry

9 1484 Xiaoman Li et al. / Acta Microbiologica Sinica Henderson JW Ricker RD Bidlingmeyer BA Woodward C. Rapid Accurate Sensitive and Reproducible HPLC Analysis of Amino Acids. AAA Techical note P Publication No Chinnici F Spinabelli U Riponi C Amati A. Optimization of the determination of organic acids and sugars in fruit juices by ion-exclusion liquid chromatography. Food Composition and Analysis Ankri S Serebrijski I Reyes O Leblon G. Mutations in the Corynebacterium glutamicum proline biosynthetic pathway A natural bypass of the proa step. Journal of Bacteriology Serebrijski I Wojcik F Reyes O Leblon G. Multicopy Suppression by Asd Gene and Osmotic Stress-Dependent Complementation by Heterologous proa in proa Mutants. Journal of Bacteriology Lee SY Park JM Lee JH Chang ST Park JS Kim YH Min J. Interaction of Transcriptional Repressor ArgR with Transcriptional Regulator FarR at the argb Promoter Region in Corynebacterium glutamicum. Applied and Environmental Microbiology Lee SY Shin HS Park JS Kim YH Min J. Proline reduces the binding of transcriptional regulator ArgR to upstream of argb in Corynebacterium glutamicum. Applied Microbiology and Biotechnology Effect of gamma-glutamyl kinase gene knock-out on metabolism in L-arginine-producing strain Corynebacterium crenatum Xiaoman Li 1 2 Zhi Zhao 1 Yingzi Zhang 1 Yu Wang 1 Jiuyuan Ding 1* 1 Institute of Microbiology Chinese Academy of Sciences Beijing China 2 Graduate School of the Chinese Academy of Sciences Beijing China Abstract Objective In order to optimize precursor supply for L-arginine biosynthesis we constructed a Corynebacterium crenatum mutant with gamma-glutamyl kinase gene prob in-frame deletion. The effects of prob knock-out on physiological characteristics of the mutant were investigated. Methods The upstream and downstream fragments of prob were cloned from C. crenatum chromosome and ligated to integration vector. The mutant C. crenatum ΔproB was obtained by homologous recombination. The mutant phenotype can be reversed by complementation with prob gene from the expression vector. The physiological characteristics of the mutant were investigated by measurement of the activities of phosphoenolpyruvate carboxylase PEPCx and pyruvate carboxylase PYC. Results The prob gene in-frame deletion was screened and confirmed by PCR gamma-glutamyl kinase determination and complementation. The mutant lost the ability of growth on minimal medium without proline addition. The prob knock-out mutant resulted a decrease of cell mass by 9. 6% and an increase of L-arginine accumulation by 13. 6% compared with that of the parent strain. The analysis of by-products of fermentation broth showed that the concentrations of glutamate-related and aspartate-related amino acids increased and the concentrations of α-ketoglutaric acid PEP and succinic acid decreased. The specific activities of PEPCx and PYC increased in ΔproB. Conclusion The prob gene knock-out of the strain blocked branch catabolism of L-glutamate and improved efficiency of the glucose utilization and L-arginine accumulation. Keywords Corynebacterium crenatum gamma-glutamyl kinase gene knock-out L-arginine Corresponding author. Tel / Fax dingjy@ sun. im. ac. cn Received 4 May 2011 / Revised 27 May 2011