Chinese Journal of Biochemistry and Molecular Biology. ( OsSUT2) 6314 kd, E2mail : edu. cn

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (6) : ( OsSUT2),,,,, (, ) Expression of a Fusion Protein Containing Non2transmembrane Region for Rice Sucrose Transporter 2 ( OsSUT2) in E coli and Generation of Its Polyclonal Antibody ZHAO Wei, WANG Xin2Sheng, LI Xiao2Rong, CHENG Wei,CHEN Xing, WANG Ying2Dian 3 ( College of Life Sciences, Beijing Normal University, Beijing , China) Abstract Sucrose transporter is a functional protein family related to the sucrose transportation and signal transduction in plants Using DNA recombination technology, it was prepared the specific antibody of rice sucrose transporter (OsSUT2) based on its typical sequence of hydrophilic non2transmembrane to provide efficient molecular tool in the research on the physiological function of this protein The cdna sequences of the hydrophilic non2transmembrane region of central loop (CL) and TACL ( Transmembrane and Apoplast regions and CL) of OsSUT2 were sub2cloned into the fusion expression vector pqe40 having dihydrofolate reductase (DHFR) to construct recombinant plasmid pqe402ossut22cl and pqe402 OsSUT22TACL, respectively The pqe402ossut22cl can be highly expressed in E coli M15, especially in E coli BL21 plyss However, the pqe402ossut22tacl cannot be expressed in E coli M15 DHFR2OsSUT22CL purified with SDS2PAGE gel was injected into rabbit to obtain the produce antiserum The specificity of obtained antibody was tested by Western blotting It was indicated that the raised antibody can specifically identify OsSUT2, and it can be efficiently used in the research on the physiological function of OsSUT2 Key words rice sucrose transporter 2, fusion protein, prokaryotic expression, antibody Q78,S (SUT1) Π, 4 (SUT4) [1 ] 2 (SUT2) [6 ] SUT2 (OsSUT2) [2 ] ( sucrose transporter, SUT) 6314 kd, 80, SUT, [3 5 ] : , : (No ), 12, 3 Tel : ; : E2mail edu cn 6 6 Received : January 25,2005 ;Accepted : March 31,2005 Supported by National Natural Science Foundation of China (No ), 3 : Π 595, 3 Corresponding author Tel : Tel : ; Fax : E2mail : edu cn

2 6 : (OsSUT2) 847 [7 ],, SUT p GEM2T2easy p GEX, SUT ( Bgl Nde [6,8 ], Sal Xho ) T4 DNA, Promega ;Pyrobest Taq DNA TaKaRa ; PCR OsSUT2 ; 2D2, ( IPTG) SIGMA ; OsSUT2, ; OsSUT2, ; (NC ) Western, Amersham Pharmacia ; Western OsSUT2 Blotting ; pqe40 E coli M15 QIAGEN, E coli BL21plysS OsSUT22TACL (204,, E coli DH5 112 OsSUT2 OsSUT2, OsSUT22CL (83, 8 kd) OsSUT22CL 22 kd) cdna (Fig 1) Fig 1 The predicted structure models of OsSUT2, OsSUT22CL and OsSUT22TACL OsSUT2 contains 12 transmembrane domains indicated with columns and an extra central loop indicated with CL ; OsSUT22TACL contains an central loop, two transmembrane domains indicated with TM and two regions outside cell indicated with AL pqe40 OsSUT2 (DHFR),, OsSUT22CL OsSUT22TACL cdna pqe40, pqe402ossut22cl pqe402 OsSUT22TACL, OsSUT22CL cdna pqe402ossut22cl : 5 2 p GEX, GST2OsSUT22CL 113 OsSUT2 pqe40 p GEX, GG AGATCT GAGATCCCGCTGGAACCA23,

3 5 2GG GTCGACTCAATGCCTCATGCTAGTCAA23, [9 Bgl Sal ; ] pqe402ossut22tacl : GG AGATCT TGGATGGCTGTTGGAAACGT2 3, 5 2GG GTCGAC TCATAGCAAACC AAATGCACCTT23, Bgl DHFR2OsSUT22CL, Sal ; p GEX2OsSUT22 CL : 5 2GGCATATG GAGATCCCG CTGGAACCA23, 5 2GG CTCGAGTCAATGCCTCATGCTA GTCAA23, ( ELISA) Nde Xho, , 114 pqe402ossut22cl pqe402ossut22 TACL pgex2ossut2 2CL 100 mg 6 d RNA,, 100 l (50 mmolπl OsSUT2 OsSUT22CL OsSUT22TACL Tris2HCl, 5 mmolπl EDTA, 5 mmolπl Na2 p GEM2T2easy, diethyldithiocarbamate, 1 mmolπl NaHSO 3, 100 gπml DH 5 PMSF, ph 810), rπmin 15 min, DNA, Bgl Sal, 100 g pqe40,, 12 % SDS2PAGE,200 ma pqe402ossut22cl pqe402ossut22tacl, NC (4,1 h) 115 % p GEX2OsSUT22CL 3 % PBST ( + 10 % M15 BL21 plyss, Tween 20,pH 712) 1 h GST2OsSUT22CL 115 NC 1 h,pbst pqe402ossut22cl pqe402ossut22 IgG 1 h,pbst 5 min 3,BCIPΠNBT TACL M15 BL21 plyss ( Π ) 4, 5 ml LB 10 min ( 100 mgπl ), LB ( 100 mgπl ), rπmin 3 4 h, A , IPTG 1 mmolπl, rπmin 4 h 1 ml (2 000 g 5 min), Bgl Sal Fig 2 SDS2PAGE,12 % SDS2PAGE, pqe402ossut22cl 250 bp, ImageMasterR VDS, pqe402ossut22tacl 600 bp DE (Amersham Pharmacia) DNA, OsSUT22CL p GEX2OsSUT22CL OsSUT22TACL, DHFR BL21 plyss 37, 300 rπmin 4 p GEX2OsSUT22CL h, 12 % SDS2PAGE, DNA, Nde Xho, 250 bp GST2OsSUT22CL, GST2 ( Fig 2) DNA, OsSUT22CL, 5 mgπl h, pqe402ossut22cl BL21 plyss 12 % SDS2PAGE,, mgπ, 10 d 117 Westhern, pqe402ossut22cl pqe402ossut22tacl DNA, 1 % GST OsSUT22CL

4 6 : (OsSUT2) 849 Fig 2 Restriction analysis of the vectors pqe402ossut22cl, pqe2 OsSUT22TACL and pgex2ossut22cl 1 : DNA marker ; 2 : pqe402ossut22cl digested by Bgl and Sal ; 3 : pqe402ossut22tacl digested by Bgl and Sal ; 4 : p GEX2OsSUT22TACL digested by Nde and Xho Arrowheads indicate the products digested by enzymes Digested products were separated on 1 % agarose gel (Fig 3) 212 D HFR2OsSUT22CL, D HFR2OsSUT22TACL pqe402ossut22cl BL21 plyss GST2OsSUT22CL, 1 mmolπl IPTG pqe402ossut22cl M15 DHFR2 OsSUT22CL pqe402ossut22 TACL M15, 37, BL21 plyss DHFR2OsSUT2 2CL 28, 1 mmolπl IPTG (Fig 4A), Fig 3 37, DHFR2OsSUT22CL M15 pqe402ossut22cl M15 12 %, BL21 plyss, 34 kd, 31 % Fig 4B,p GEX2, pqe402ossut22tacl M15 OsSUT22CL BL21 plyss, (48 kd) GST2OsSUT22CL, 28, pqe402 Fig 3 Expression of DHFR2OsSUT22CL and DHFR2OsSUT22TACL Induced by IPTG in E coli M15 1 : Standard protein ; 2 : DHFR2OsSUT22TACL uninduced by IPTG at 37 ; 3 : DHFR2OsSUT22TACL induced by IPTG at 37 ; 4 : DHFR2 OsSUT22TACL uninduced by IPTG at 28 ; 5 : DHFR2OsSUT22TACL induced by IPTG at 28 ; 6 : DHFR2OsSUT22CL uninduced by IPTG at 37 ; 7 : DHFR2OsSUT22CL induced by IPTG at 37 Arrowhead indicates DHFR2OsSUT22CL The 100 g per lane of total protein was separated on 12 % SDS2PAGE OsSUT22TACL M15 Fig 4 Expression of DHFR2OsSUT22CL and GST2OsSUT22CL Induced by IPTG in E coli BL21 plyss and E coli M15 (A) 1 : Standard protein ; 2 : DHFR2OsSUT22CL in BL21 plyss uninduced ; 3 : DHFR2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours ; 4 : DHFR2OsSUT22CL in M15 uninduced ; 5 : DHFR2OsSUT22CL in M15 induced by IPTGfor 4 hours (B) 1 : Standard protein ; 2 : GST2OsSUT22CL in BL21 plyss uninduced ; 3 : GST2OsSUT22CL in BL21 plyss induced by IPTGfor 4 hours Arrowheads indicate DHFR2OsSUT22CL and GST2OsSUT22CL, respectively Total protein of 100 g per lane was separated on 12 % SDS2PAGE Standard protein is given at the left

5 OsSUT2,, 12 % SDS2PAGE NC,, Fig 5, OsSUT2,, 64 kd, OsSUT2,, GST2OsSUT22CL M15, DHFR2OsSUT22CL,64 kd (Fig15) Fig 5 The specificity analysis on the anti2ossut2 serum by Western blotting 1 : Incubation with pre2immune serum ; 2 : Incubation with anti2ossut2 serum ; 3 : Incubation with anti2ossut2 serum pretreated by 5 mgπl GST2 OsSUT22CL Arrowhead indicates the objective band of OsSUT2 Total protein of 100 g per lane, which was extracted from the rice caryopses at the 6th day after heading, was separated on 12 % SDS2PAGE 3,Western,,, OsSUT2 (Fig 5) GST2OsSUT22CL,OsSUT22CL,, OsSUT2, OsSUT2 ( ),, ( E coli) OsSUT2, ( References),, OsSUT2,,, DHFR2OsSUT22TACL,, DHFR2OsSUT22 TACL (Fig 3), OsSUT2,,, OsSUT2,, DHFR2 OsSUT22CL, M15 12 %, BL21 plyss, 31 % ( Fig 4), BL21 plyss DHFR2OsSUT22CL BL21 plyss T7, [10, ], DHFR2OsSUT22CL 1 Sheen J, Zhou L, Jyun2Chyun J Sugars as signaling molecules Curr Opin Plant Biol, 1999, 2 : Chiou T, Bush D R Sucrose is a signal molecule in assimilate partitioning Proc Natl Acad Sci USA, 1998, 95 : Riesmeier J W, Willmitzer L, Frommer W B Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partitioning EMBO J, 1994, 13 : 1 7

6 6 : (OsSUT2) Lalonde S, Boles E, Hellmann H, Barker L, Patrick J W, Frommer W B,Ward J M The dual function of sugar carriers : transport and sugar sensing Plant Cell, 1999, 11 : K hn C, Hajirezaei M R, Fernie A R, Tunali U R, Czechowski T, Hirner B, Frommer W B The sucrose transporter StSUT1 localizes to sieve elements in potato tuber phloem and influences tuber physiology and development Plant Physiol, 2003, 131 : Barker L, K hn C, Weise A, Schulz A, Gebhardt C, Hirner B, Hellmann H, Schulze W, Ward J M, Frommer W B SUT2, a putative sucrose sensor in sieve elements Plant Cell, 2000, 12 : Rico L, Dieter L Strategies for prokaryotic expression of eukaryotic membrane proteins Traffic, 2001, 2 : Weise A, Barker L, K hn C, Lalonde S, Buschmann H, Frommer W B, Ward J M New subfamily of sucrose transporters, SUT4, with low affinityπhigh capacity localized in enucleate sieve elements of plants Plant Cell, 2000, 12 : Chiristian K, Ruth S, Norbert S, Gertrud L AmSUT1, a sucrose transporter in collection and transport phloem of the putative symplastic phloem loader Alonsoa meridionalis 214 Plant Physiol, 2004, 134 : ,,, ( Shen Yi2Jun, Yao Jian2Er, Yi Jin2Hua, Su Yong Advance in high density cultivation of recombinant E coli Pharm Biotechnol),2000, 7 (4) : H Science, 3,, H CFH,,CFH, CFH,CFH,,, CFH, CFH, CFH, CFH 7 1,,1 CFH CFH 3, CFH,,,,,,3 3,, CFH CFH,, CFH, CFH CFH, CFH ( N Seppa : Science News,March 12,2005,Vol 167,p 163)