Supplementary Material for Supplementary Material for Lee et al., Page 1 Disruption of Ttll5/Stamp gene in male mice causes sperm malformation and infertility Geun-Shik Lee, Yuanzheng He, Edward J. Dougherty, Maria Jimenez-Movilla, Matteo Avella, Sean Grullon, David S. Sharlin, Chunhua Guo, John A. Blackford, Jr., Smita Awasthi, Zhenhuan Zhang, Stephen P. Armstrong, Edra C. London, Weiping Chen, Jurrien Dean, and S. Stoney Simons, Jr.* From the Steroid Hormones Section, NIDDK/LERB, Laboratory of Cellular and Developmental Biology, NIDDK, Adipocyte Biology and Gene Regulation Section, NIDDK/LERB, Nuclear Receptor Biology Section, NIDDK/LERB, Genomic Core, NIDDK, and National Institutes of Health, Bethesda, MD *Address correspondence to Dr. S. Stoney Simons, Jr., Bldg. 1, Room 8N-37B, NIDDK/LERB, NIH, Bethesda, MD 892-1772 (e-mail: stoneys@helix.nih.gov; Phone: 31-496-6796; FAX: 31-2-3572)
Supplementary Material for Lee et al., Page 2 Tables Table S1: Oligonucleotide primers for RT-PCR quantitation of known genes involved in spermatogenesis. Oligonucleotide sequences PCR product Gene Gene bank ID Forward (5' to 3') Reverse (5' to 3') size (bp) Gopc NM_53187 TGTGCATGGTATTGGAGCAT AAAGCTTGGGAACAGCTCAA 17 Agfg1 (Hrb) NM_1472 CCTCGGTTCATGCGTCTATT TCTCCCAACAGGGATTTCAG 88 Csnk2a2 NM_9974 TGCTCATCCATACGCTCTTG AGCAGAGACCCTGCACATCT 83 Gba2 NM_172692 CAGGCGGTATACACGGTTCT GTTCTGCCAGGCTGAGATTC 112 Tekt2 NM_1192 CCCAAAGACTCCACCACACT TCTGAGCGTCCAGTTCATTG 148 Tekt4 NM_27951 ACAAGCCGTGGACCAGATAC TGGGTGCTCTCATTGGTGTA 126 Vdac3 NM_11696 ATAAACCTGGCATGGACAGC TCGGAGGGTCTGCGTATAAC 141 Sepp1 NM_142613 TGACAAAATCAGCCCATGAA TGAGTTGGGGAGAGGTATGC 125 Akap4 NM_142542 GTGAGAGCCCTTTCAGTTGC GGCATTGCTCTTCAGGTCTC 111 Spag6 NM_15773 TCGCAGCTGATTGTTAATGC CAGAATGAGCAGCCACGTAA 118 Gapdhs NM_885 CCAAGCCTGCTTCTTACTCG GACCACCTGGTCCTCTGTGT 98 Adcy1 (sac) NM_17329 AACGTTCGTGGAGTTGGTTC GACCTCGACAGAGGCTTGAC 119 Catsper1 NM_13931 CGGGTCCATGAGAAGTTGTT CGCTGCTTCACTGTCATGTT 134 Catsper2 NM_15375 TATCTTCATGCATCCCACCA AGGCTCGAGTCCTTCAACAA 134 Catsper3 NM_29772 GTTGATGGCTGGACTGACCT TGAAGGATGCAAGCAAGATG 97 Catsper4 NM_1133 CCTTATCTGCGAGGTTCTGC CCCATGTTCTGGAAATGCTT 1 Tnp1 NM_97 GCATGAGGAGAGGCAAGAAC AGGACGCTCTTCCGGTATTT 82 Tnp2 NM_13694 TCGACACTCACCTGCAAGAC CTTGTATCTTCGCCCTGAGC 148 H1fnt (H1t2) NM_2734 CAAGGAAAAGCATGCACAAA TTGGAGCCCATATGGAAAAG 115 Crem NM_11185 ACTAGCACGGGGCAATACAC TCTGCTAGTTGCTGGGGACT 134 Tbpl1 NM_113 GCACTGGAGCAACAAGTGAA GCCAAAACATTCACCACCTT 118 Papolb (Tpap) NM_19943 TGCACTGAGTGAAAGCATCC GGATTGGGTATGTTCGTTGC 15 Piwil1 (Miwi) NM_21311 AACCCTCTTCCAGGGACAGT CAGGCCACTGCTGTCATAGA 138 Spem1 NM_28855 TGTTACCCCTTGGTCTCTGG TTTTGTCCCCAGTCACCTTC 93
Supplementary Material for Lee et al., Page 3 Table S2: Microarray results from testes of wt and Stamp tm/tm mice of heterogeneous genetic background showing genes altered at the whole gene level. p-value Fold-Change Gene Symbol GeneBank ID (TM vs. Wt) (TM vs. Wt) Tshr NM_11648 1.18E-5 3.8353 Prps1l1 NM_29294 1.E-6 3.273 2812N1Rik AK191.1739 2.6625 Egr2 NM_1118.7268 1.9572 Tdgf1 NM_11562.2837 1.8829 Scn1a NM_9134 4.1E-5 1.8547 Acp1 NM_111239.521885 1.797 Snapc1 NM_178392.5254 1.7417 Gtf2a1 NM_175335.246929 1.7366 Ier3 NM_133662.134473 1.7131 Egr1 NM_7913.27533 1.767 Ier2 NM_1499.185166 1.6569 Rhbg NM_21375.1725 1.6182 Serpina3c NM_8458.385444 1.5849 Hdac9 NM_24124.529439 1.583 Fbxw15 NM_19936.3944 1.5629 Heg1 NM_175256.4889 1.5455 Nr4a1 NM_1444.696652 1.5352 151A3Rik ENSMUST62827.49243 1.549 Usp48 NM_13879.342822-1.57 Dio2 NM_15.23444-1.5346 Eif4e NM_7917.8991-1.5439 Fam5b BC49659.114799-1.5572 Pik3r4 NM_18139.32337-1.5657 Rrs1 NM_21511.419897-1.5765 Atp1a2 NM_1785.33287-1.5765 Cd84 NM_13489.345877-1.5876 Skiv2l2 NM_28151.5212-1.62 Skint9 NM_177864.33784-1.6333 1328 BC125243.349371-1.6359 Arg2 NM_975.417887-1.9331 Abhd14a NM_111271.283352-1.99 Nme6 NM_18757 5.3E-5-2.1
Supplementary Material for Lee et al., Page 4 References for the androgen-regulated genes (underlined with bold lettering) are as follow: Egr1 (5), Nr4a1 (2), Dio2 (7), Pik3r4 (4), Atp1a2 (1), and Arg2 (3, 6). References 1. Bolduc C, Yoshioka M, St-Amand J. 7. Transcriptomic characterization of the long-term dihydrotestosterone effects in adipose tissue. Obesity (Silver Spring) 15:117-1132. 2. DePrimo SE, Diehn M, Nelson JB, Reiter RE, Matese J, Fero M, Tibshirani R, Brown PO, Brooks JD. 2. Transcriptional programs activated by exposure of human prostate cancer cells to androgen. Genome Biol 3:RESEARCH32. 3. Doane AS, Danso M, Lal P, Donaton M, Zhang L, Hudis C, Gerald WL. 6. An estrogen receptor-negative breast cancer subset characterized by a hormonally regulated transcriptional program and response to androgen. Oncogene 25:3994-8. 4. Nakamura Y, Suzuki T, Igarashi K, Kanno J, Furukawa T, Tazawa C, Fujishima F, Miura I, Ando T, Moriyama N, Moriya T, Saito H, Yamada S, Sasano H. 6. PTOV1: a novel testosterone-induced atherogenic gene in human aorta. J Pathol 9:522-531. 5. Seenundun S, Robaire B. 7. Time-dependent rescue of gene expression by androgens in the mouse proximal caput epididymidis-1 cell line after androgen withdrawal. Endocrinology 148:173-188. 6. Velasco AM, Gillis KA, Li Y, Brown EL, Sadler TM, Achilleos M, Greenberger LM, Frost P, Bai W, Zhang Y. 4. Identification and validation of novel androgenregulated genes in prostate cancer. Endocrinology 145:3913-3924. 7. Xu Y, Chen SY, Ross KN, Balk SP. 6. Androgens induce prostate cancer cell proliferation through mammalian target of rapamycin activation and post-transcriptional increases in cyclin D proteins. Cancer Res 66:7783-7792.
Supplementary Material for Lee et al., Page 5 Table S3 Exon expression in Stamp tm/tm vs. Stamp +/+ mice (heterogeneous background) Probeset ID Gene Symbol RefSeq p-value (tm vs. wt) Fold-Change (tm vs. wt) 4751467 Aass NM_1393.44 1.6499 4493 Aass NM_1393.75 2.4676 4823284 Abcc9 NM_11511.312 1.515 4541445 Abcc9 NM_11511.257 1.5186 527 Abcc9 NM_11511.375 1.7343 5268216 Abhd14a NM_111271. -3.9236 491153 Abhd14a NM_111271.17-3.1288 43 Abhd14a NM_111271.213-2.31 572425 Abhd14a NM_111271.21-1.8991 491156 Abhd14a NM_111271.215-1.5229 5117172 Abhd14b NM_29631.29-1.7747 4741366 Abhd14b NM_29631.43-1.5114 458424 Actr1 NM_19785.9 2.797 4788397 Actr1 NM_19785.2 5.2431 519996 Aebp1 NM_9636.119-2.86 528971 Aebp1 NM_9636.13-1.9654 551629 Aim1 NM_172393.169-1.788 5141257 Aim1 NM_172393.224-1.7248 4874747 Aim1 NM_172393.89-1.6315 5413918 Aim1 NM_172393.41-1.5324 5195523 Aim1 NM_172393.2-1.5134 5473432 Aldoc NM_9657.489 1.5451 55792 Aldoc NM_9657.381 1.5478 431278 Ambp NM_7443.47-1.8619 476891 Ambp NM_7443.117-1.5113 4835853 Aox3 NM_23617.134-1.7547 53277 Aox3 NM_23617.41-1.5339 5231363 Arg2 NM_975.21-2.3489 4669438 Arg2 NM_975.3-2.3469 4326852 Arg2 NM_975.144-2.613 47472 Arg2 NM_975.18-1.9994 54292 Arg2 NM_975.52-1.819 4399312 Arg2 NM_975.111-1.7241 4614993 Arg2 NM_975.273-1.59 4955272 Arhgap1 NM_3113.455 1.5173 5261476 Arhgap1 NM_3113.242 1.8473 5544243 Arhgap1 NM_3113.457 1.966 5343547 Arid4a NM_181195.233 1.6158 5533658 Arid4a NM_181195.2 1.954 4371745 Atp1a2 NM_1785.236-1.925 55487 Atp1a2 NM_1785.342-1.7724 4444569 Atp1a2 NM_1785.88-1.682 4697386 Atp1a2 NM_1785.13-1.633 433392 Atp1a2 NM_1785.139-1.5937 458333 Atp1a2 NM_1785.36-1.5897 4388347 Atp1a2 NM_1785.318-1.5587 51576 Atp2c1 NM_17525. -7.2548 4646835 Atp2c1 NM_17525.2-5.575 5232217 Atp2c1 NM_17525.6-2.694 491351 Atp2c1 NM_17525.13-1.45
Supplementary Material for Lee et al., Page 6 4964319 Brip1 NM_17839.8-1.7361 485895 Brip1 NM_17839.37-1.6225 4947484 Bst2 NM_19895.95 1.5255 538837 Btg2 NM_757.111 1.834 4393644 Btg2 NM_757.65 1.9193 491411 Btg2 NM_757.43 2.378 54387 Btg2 NM_757.373 2.3563 4311249 C3 NM_9778.258 1.513 561514 C3 NM_9778.26 1.5137 4688264 C3 NM_9778.177 1.5454 4831742 Camkv NM_145621.134 1.5345 4541781 Camkv NM_145621.321 1.6173 5299356 Car5a NM_78.12-2.1 545762 Car5a NM_78.31-1.5998 524 Ccl22 NM_9137.161-1.68 5398229 Ccl22 NM_9137.269-1.5944 5273191 Cd84 NM_13489.192-3.2824 5227163 Cd84 NM_13489.315-3.91 4847599 Cd84 NM_13489.77-2.9 4467596 Cd84 NM_13489.467-1.7392 4885969 Cds2 NM_138651.87 1.61 4764913 Cds2 NM_138651.316 1.6152 496794 Cln3 NM_997.417 1.564 5377189 Cln3 NM_997.13 1.5864 4456199 Cln3 NM_997.177 1.6932 432922 Cntn6 NM_17383.23-1.825 564768 Cntn6 NM_17383. -1.5156 535164 Col1a1 NM_7742.59 1.56 4675817 Col1a1 NM_7742.211 1.553 5487434 Col4a1 NM_9931.373 1.512 4842375 Col4a1 NM_9931.18 1.5361 52498 Cyb561d2 NM_197.18-2.3645 4367176 Cyb561d2 NM_197.95-1.7649 5587878 Cyb561d2 NM_197.236-1.6757 458798 Cybb NM_787.241 1.886 453998 Cybb NM_787.234 1.9761 43766 Dctd NM_178788.45-1.6449 5251 Dctd NM_178788.316-1.6248 448998 Dhx3 NM_133347.98-1.8938 5477 Dhx3 NM_133347.133-1.855 5686 Dio2 NM_15.243-2.95 4618997 Dio2 NM_15.89-1.8462 483155 Dio2 NM_15.334-1.6882 462154 Dio2 NM_15.27-1.6822 4449671 Dio2 NM_15.322-1.6178 537485 Dio2 NM_15. -1.5196 52622 Dmkn NM_28618.235-2.36 46765 Dmkn NM_28618.94-1.8169 4853726 Dock11 NM_19947.227 1.5456 456738 Dock11 NM_19947.396 1.895 483167 Dpp1 NM_19921.412-1.5868 5526715 Dpp1 NM_19921.1-1.581 4918416 Efnb1 NM_111.433 1.5121 477432 Efnb1 NM_111.36 1.71 5481286 Efnb1 NM_111.76 1.81 4633715 Egr1 NM_7913.219 2.391
Supplementary Material for Lee et al., Page 7 4412277 Egr1 NM_7913.395 2.6521 479728 Egr1 NM_7913.29 2.7592 4472382 Egr1 NM_7913.395 3.5151 45534 Egr1 NM_7913.428 3.6181 4635827 Egr2 NM_1118.64 1.5281 4878614 Egr2 NM_1118.391 2.324 4547678 Egr2 NM_1118.167 3.5843 4725158 Eif2ak4 NM_13719.43-2.1714 514557 Eif2ak4 NM_13719.491-1.5673 516914 Ell3 NM_145973.47 1.5321 4912978 Ell3 NM_145973.53 1.654 4871386 Errfi1 NM_133753.15 1.5635 45188 Errfi1 NM_133753.369 1.6257 592523 Errfi1 NM_133753.41 1.71 4974656 Ets2 NM_1189.156 1.6988 5249764 Ets2 NM_1189.19 2.2692 4919666 Evc NM_21292.391 1.5372 4535163 Evc ENSMUST315.281 1.5579 5597854 Fads1 NM_1494.97 1.5388 5388214 Fads1 NM_1494.11 1.553 43321 Fads1 NM_1494.93 1.7191 59745 Fam179b BC6217.9 2.211 475 Fam179b BC6217.1 2.89 4575462 Fam55b NM_369.245-2.61 46157 Fam55b NM_369.91-1.9596 58371 Fbxw15 NM_19936.18 1.7686 5376845 Fbxw15 NM_19936.269 1.8558 5419197 Fmn2 NM_19445.78-2.924 4667571 Fmn2 NM_19445.123-2.468 52348 Fos NM_1234.337 1.9965 44829 Fos NM_1234.424 2.33 4817672 Fos NM_1234.1 2.8461 539558 Fosl2 NM_837.31 1.5358 447316 Fosl2 NM_837.395 1.6513 535 Gad2 NM_878.68-1.7199 5292148 Gad2 NM_878.413-1.7178 4825369 Gldc NM_138595.21-1.5176 4551799 Gldc NM_138595.44-1.511 5225793 Gpr98 NM_553.234-2.3392 4364879 Gpr98 NM_553.221-1.593 5166989 Hdac9 NM_24124. 1.5199 43319 Hdac9 NM_24124.443 1.583 439433 Hdac9 NM_24124.14 1.8494 5386721 Hdac9 NM_24124.4 1.9169 47325 Hdac9 NM_24124.12 2.9759 5689 Hemk1 ENSMUST35196.2-13.1269 4636919 Hemk1 NM_133984. -2.7666 5353821 Hlcs NM_139145.16-2.363 4496352 Hlcs NM_139145.448 1.5488 498173 Hsdl1 NM_175185.36-1.6374 5322165 Hsdl1 NM_175185.51-1.56 4797123 Hspa12a NM_175199.449 1.58 5281567 Hspa12a NM_175199.8 1.555 516366 Hspa12a NM_175199.487 1.6247 474348 Ier2 NM_1499.47 1.6481 55649 Ier2 NM_1499.271 2.143
Supplementary Material for Lee et al., Page 8 5183781 Ier3 NM_133662.59 1.6312 5361 Ier3 NM_133662.144 2.55 4442739 Igf2bp1 NM_9951.58-1.6735 4431559 Igf2bp1 NM_9951.325-1.6626 4944486 Igh AY7699.34 1.5646 4448286 Igh AY7699. 1.9512 4688427 Il1b NM_8361.64 1.5418 4611184 Il1b NM_8361.167 1.8925 4425868 Il31ra NM_139299.192-4.4742 4577352 Il31ra NM_139299.191-2.534 544783 Il31ra NM_139299.6-2.473 533618 Il31ra NM_139299.38-2.964 55562 Il31ra NM_139299.91-1.9376 517516 Itih2 NM_1582.311 1.5943 4569424 Itih2 NM_1582.326 2.1981 48938 Itpr3 NM_8553.1 1.5429 4979886 Itpr3 NM_8553.398 1.7882 58488 Kcnh5 NM_17285.245 1.9316 443316 Kcnh5 NM_17285.69 2.338 4878981 Kcnh5 NM_17285.143 2.97 57996 Kcnh5 NM_17285.53 3.585 579913 Kcnj9 NM_8429.474-2.13 4485754 Kcnj9 NM_8429.56-1.69 4396536 Klc1 NM_845.78 1.553 4581312 Klc1 NM_845.3 2.191 4925169 Kremen1 NM_32396.265 1.5328 4963369 Kremen1 NM_32396.292 1.5537 49364 Kremen1 NM_32396.3 1.6811 54538 Kremen1 NM_32396.17 1.8944 55849 Kremen1 NM_32396.162 2.55 4656189 Lcat NM_849.21 1.6493 4367597 Lcat NM_849.31 1.7912 4351512 Ldlr NM_17.284 1. 534971 Ldlr NM_17.4 1.819 4551856 Ldlr NM_17.13 1.933 485587 Ldlr NM_17.51 2.2116 5167144 Lipi NM_177142.85-1.7822 5241955 Lipi NM_177142.472-1.6396 4822961 Lipi NM_177142.497-1.93 52145 Lrrc9 NM_37.177 2.1225 5525389 Lrrc9 NM_37.5 2.4776 553449 Ltbp3 NM_85.446 1.6727 4829966 Ltbp3 NM_85.32 1.72 576963 Mdga2 NM_71.147 2.539 483759 Mdga2 NM_71.15 2.729 5214695 Mdga2 NM_71.85 2.1283 4787321 Mdga2 NM_71.88 2.345 555785 Mdga2 NM_71.82 2.34 5572526 Mdga2 NM_71.131 3.6136 553966 Mdga2 NM_71.5 4.573 478 Mfap4 NM_29568.78 1.5591 5136672 Mfap4 NM_29568.286 1.5815 4355563 Mpped1 NM_17261.17-1.8555 51799 Mpped1 NM_17261.241-1.6763 532988 Mrpl3 NM_53159.6-2.2936 48684 Mrpl3 NM_53159.9-2.486
Supplementary Material for Lee et al., Page 9 5224534 Mtmr7 NM_1699.424-1.8238 4925189 Mtmr7 NM_1699.411-1.7611 4692954 Mtmr7 NM_1699.23-1.7585 4841113 Mtus1 NM_15863.7-2.3867 482154 Mtus1 NM_15863.25-1.7176 558975 Nek11 NM_172461.11-2.5582 5267972 Nek11 NM_172461.29-2.1129 46151 Nme6 NM_18757.1-6.8734 5266395 Nme6 NM_18757.7-4.7395 559135 Nme6 NM_18757.29-1.9171 54564 Nme6 NM_18757.98-1.8448 4916172 Nphp3 NM_28721.2-1.7335 558535 Nphp3 NM_28721.477-1.6846 58993 Nphp3 NM_28721.256-1.6653 5162776 Nr4a1 NM_1444.3 1.5226 517194 Nr4a1 NM_1444.1 1.56 558765 Nr4a1 NM_1444.15 1.6713 4352254 Nr4a1 NM_1444.15 1.7857 5171752 Nr4a1 NM_1444.346 2.232 5448768 Nrxn3 NM_172544.2 7.1 4996321 Nrxn3 AK1295.9 7.123 49563 Nrxn3 NM_172544.9 11.2823 4744864 Oasl1 NM_1459.449 1.58 4422883 Oasl1 NM_1459.349 1.41 4647838 Oma1 NM_2599.146-1.63 533579 Oma1 NM_2599.1-1.5571 438429 Osbpl1 NM_148958.224-1.575 49192 Osbpl1 NM_148958.1-1.5513 5484683 Osmr NM_1119.399-1.5692 4433842 Osmr NM_1119.394-1.5451 5491177 Oxsr1 NM_133985.36-3.2265 5588618 Oxsr1 NM_133985.89-1.6914 481788 Oxsr1 NM_133985.8-1.5758 4626739 Pcnt NM_8787.259-1.7125 56489 Pcnt NM_8787.475-1.11 45426 Pcnt NM_8787.11-1.5487 5298818 Pde2a NM_18548.322 1.677 43893 Pde2a NM_18548.435 1.68 59688 Pik3r4 NM_18139.1-4.1297 43881 Pik3r4 NM_18139.35-2.3351 5449499 Pik3r4 NM_18139.33-2.2369 59661 Pik3r4 NM_18139.6-1.74 4784867 Pkhd1l1 NM_138674.145-1.6839 571477 Pkhd1l1 NM_138674.322-1.58 5538 Plk3 NM_1387.242 1.7348 4574474 Plk3 NM_1387.288 1.7787 4628195 Plk3 NM_1387.88 1.978 53873 Plk3 NM_1387.226 2.1 4816434 Prkch NM_8856.241 1.511 5215818 Prkch NM_8856.259 1.6145 5494239 Prkch NM_8856.82 1.693 4787816 Prkch NM_8856.323 1.8114 5544549 Prkch NM_8856.93 1.8216 4981142 Prkch NM_8856.67 1.9491 5385984 Prkch NM_8856.92 2.75 444213 Prmt3 NM_1337.449-1.7539
Supplementary Material for Lee et al., Page 1 4667366 Prmt3 NM_1337.422-1.6845 463959 Prps1l1 NM_29294.23 1.5149 483272 Prps1l1 NM_29294.1 3.3324 4594315 Prps1l1 NM_29294. 3.5535 5282734 Prps1l1 NM_29294. 12.5184 4997955 Ptprv NM_7955.237 1.513 56142 Ptprv NM_7955.265 1.5115 5126444 Ptprv NM_7955.365 1.5542 49128 Ptprv NM_7955.122 1.57 4899898 Ptprv NM_7955.361 1.6898 518388 Ptprv NM_7955.398 1.8946 57225 Ptprv NM_7955.15 1.9382 5297896 Rbm34 BC141278.174-1.5843 527882 Rbm34 BC141278.252-1.557 4543 Ren1 NM_31192.175 1.5 4819988 Ren1 NM_31192.76 1.6937 552779 Ren1 NM_31192.469 1.725 443684 Ren1 NM_31192.66 1.854 498511 Rhbg NM_21375.9 1.5212 4325268 Rhbg NM_21375.132 1.6294 45569 Rhbg NM_21375.77 1.7223 4673247 Rhbg NM_21375.88 2.18 5375125 Rhbg NM_21375.52 2.7416 4998598 Rhoj NM_23275.5 1.5852 57797 Rhoj NM_23275.117 1.6489 453615 Ros1 NM_11282.88-2.2717 4361 Ros1 NM_11282.345-1.93 41648 Ros1 NM_11282.421-1.5623 451914 Rrp9 NM_1456.193 1.5391 45485 Rrp9 NM_1456.49 1.561 4559932 Runx1t1 NM_111127.361 1.69 45599 Runx1t1 NM_111127.2 1.7428 4541863 Sc4mol NM_25436.391 1.8174 4654742 Sc4mol NM_25436.177 1.8939 55426 Scn1a NM_9134.93 1.5942 4828569 Scn1a NM_9134.94 1.7227 548216 Scn1a NM_9134.35 1.7494 5431911 Scn1a NM_9134.213 1.9999 5228712 Scn1a NM_9134.119 2.188 516738 Scn1a NM_9134.19 2.688 558843 Scn1a NM_9134.38 2.13 5419137 Scn1a NM_9134.156 2.18 54888 Scn1a NM_9134.14 2.61 4792561 Scn1a NM_9134.167 2.2811 5177475 Scn1a NM_9134.381 2.335 4546867 Scn1a NM_9134.5 2.4861 53638 Scn1a NM_9134.3 2.495 5299585 Scn1a NM_9134.67 2.99 475224 Scn1a NM_9134.8 2.6825 4627217 Scn1a NM_9134.4 3.579 51579 Scn1a NM_9134.8 4.7551 43369 Serpina3b NM_17324.365 2.19 5235953 Serpina3b NM_17324.245 2.139 526816 Serpina3b NM_17324.137 2.6284 5558661 Serpina3c NM_8458.59 1.6278 5485765 Serpina3c NM_8458.311 1.6754
Supplementary Material for Lee et al., Page 11 461853 Serpina3c NM_8458.41 1.73 51379 Serpina3c NM_8458.214 1.8798 55629 Serpina3g NM_9251.5 19.328 5164692 Serpina3g NM_9251.11 29.7838 45481 Serpina3g NM_9251.2 36.794 5412356 Serpina3g NM_9251.2 68.8566 568241 Shisa5 NM_25858.159 1.5457 4772547 Shisa5 NM_25858.7 1.5565 5358275 Skiv2l2 NM_28151.115-2.133 4465141 Skiv2l2 NM_28151.337-1.8354 4532266 Skiv2l2 NM_28151.34-1.8141 4937215 Skiv2l2 NM_28151.274-1.7771 548719 Skiv2l2 NM_28151.391-1.7386 5171862 Skiv2l2 NM_28151.4-1.5359 52488 Slamf7 AF46791.15-1.598 513425 Slamf7 NM_144539.142-1.5537 4834977 Slc25a41 NM_175333.56-1.62 5349653 Slc25a41 NM_175333.5-1.5268 455552 Slc38a1 NM_1386.249 1.6473 4396157 Slc38a1 NM_1386.79 1.67 4788862 Slc38a1 NM_1386.231 1.817 558438 Slc38a1 NM_1386.4 1.815 45249 Slc38a1 NM_1386.71 2.27 4475568 Slc38a1 BC3378.127 2.3257 48117 Slc39a14 NM_1135151.445 1.5356 4872559 Slc39a14 NM_14488.387 1.5497 532815 Slc47a1 NM_26183.487 1.7224 443581 Slc47a1 NM_26183.293 2.3344 455889 Slc7a2 NM_7514.494 1.5352 4733328 Slc7a2 NM_7514.74 1.6535 4659514 Slc7a2 NM_7514.286 1.8354 5444364 Slc7a2 NM_1447.1 2.2734 534215 Slit2 NM_17884.248 1.528 444369 Slit2 NM_17884.476 2.2153 5449671 Snapc1 NM_178392.1 1.581 4321446 Snapc1 NM_178392.195 1.52 4757183 Snapc1 NM_178392.246 1.921 4652625 Snapc1 NM_178392.428 2.663 45472 Snapc1 NM_178392.93 2.14 4632246 Snapc1 NM_178392.23 3.615 4626991 Speg NM_7463.385-1.6173 4382286 Speg NM_7463.1-1.5326 4881642 Spna1 NM_11465.231-2.4531 5144376 Spna1 NM_11465.2-1.5336 5354575 Spna1 NM_11465.12-1.54 5615852 Ston2 NM_175367.44 1.7475 535623 Ston2 NM_175367.44 2.4873 5392356 Ston2 NM_175367.3 2.4973 5536819 Ston2 NM_175367.2 2.8443 4384629 Ston2 NM_175367.1 3.39 4742865 Ston2 NM_175367. 3.543 4337648 Susd4 NM_144796.386 1.68 547783 Susd4 NM_144796.137 1.7426 5213391 Tbc1d9 NM_111134.483-3.8 4988514 Tbc1d9 NM_111134.194-2.348 4361236 Tbc1d9 NM_111134.472-1.5261
Supplementary Material for Lee et al., Page 12 5175 Tdgf1 NM_11562.151 1.5671 5395477 Tdgf1 NM_11562.3 3.3826 55819 Tep1 NM_9351.25 1.5192 581236 Tep1 NM_9351.116 1.6514 53183 Tep1 NM_9351.156 1.657 551886 Tg NM_9375.135 1.5548 557482 Tg NM_9375.5 1.6233 4924122 Tgfbi NM_9369.289-2.1934 4991317 Tgfbi NM_9369.374-1.7245 5132665 Thbs1 NM_1158.229 1.5431 543 Thbs1 NM_1158.143 1.5523 493654 Thbs1 NM_1158.1 1.6976 4876471 Thbs1 NM_1158.88 1.7749 4415786 Thbs1 NM_1158.4 1.9168 5489953 Tm7sf2 NM_28454.269 1.5526 518268 Tm7sf2 NM_28454.49 1.5994 58861 Tmem115 NM_1974.5-3.643 4552879 Tmem115 NM_1974.4-2.3682 5335926 Tmem115 NM_1974.51-2.315 5117626 Tmem195 NM_178767.366-1.8642 5465191 Tmem195 NM_178767.384-1.5435 5566585 Trf NM_133977.293 1.514 4967444 Trf NM_133977.234 1.8344 5483671 Tshr NM_11648.53 2.5717 5158199 Tshr NM_11648. 4.38 444889 Tshr NM_11648.1 4.838 517271 Tshr NM_11648.1 4.669 463387 Tshr NM_11648.3 5.876 4554444 Tshr NM_11648.5 5.78 487388 Tshr NM_11648.1 6.558 4387335 Tshr NM_11648.5 6.7299 5418436 Tshr NM_11648.1 7.6667 51129 Tshr NM_11648.1 8.7363 54541 Tshr NM_11648.3 14.2 4537529 Ttll5 NM_181423. -294.7 4927582 Ttll5 NM_181423. -77.2434 553753 Ttll5 NM_181423.5-3.4252 5578115 Ttll5 NM_181423.32-3.1844 4848712 Ttll5 NM_181423. -2.959 594849 Ttll5 NM_181423.1-2.6842 4968626 Ttll5 NM_181423. -2.634 529446 Ttll5 NM_181423.4-2.5933 5243391 Ttll5 NM_181423.2-2.5882 5521171 Ttll5 NM_181423. -2.5769 5143384 Ttll5 NM_181423.5-2.573 558378 Ttll5 NM_181423.1-2.5477 475831 Ttll5 NM_181423.12-2.52 5246111 Ttll5 NM_181423.6-2.4674 547722 Ttll5 NM_181423. -2.4597 446319 Ttll5 NM_181423. -2.3739 465362 Ttll5 NM_181423. -2.3682 4615781 Ttll5 NM_181423.3-2.3646 5345141 Ttll5 NM_181423.6-2.359 543453 Ttll5 NM_181423. -2.3348 5568898 Ttll5 NM_181423. -2.2475 466868 Ttll5 NM_181423. -2.2417
Supplementary Material for Lee et al., Page 13 491858 Ttll5 NM_181423.1-2.2157 521488 Ttll5 NM_181423.19-2.69 4311 Ttll5 NM_181423.1-2.13 4584716 Ttll5 NM_181423.8-2.1792 5321377 Ttll5 NM_181423.4-2.1587 4612994 Ttll5 NM_181423. -2.19 5597974 Ttll5 NM_181423. -2.1264 48448 Ttll5 NM_181423. -2.1223 5217313 Ttll5 NM_181423. -2.859 5298531 Ttll5 NM_181423.1-2.536 48494 Ttll5 NM_181423.4-1.7447 5328781 Tusc4 NM_18879.143-1.7293 4879223 Tusc4 NM_18879.41-1.786 46672 Tusc4 NM_18879.32-1.6198 4998263 Vash1 NM_177354.291 1.53 48147 Vash1 NM_177354.65 2.115 47289 Vav1 NM_11691.116-1.897 44873 Vav1 NM_11691.28-1.5241 4393622 Vcam1 NM_11693.433 1.655 51324 Vcam1 NM_11693.12 1.6583 492444 Vcam1 NM_11693.344 1.7843 52282 Vsig8 NM_177723.94-1.8971 52756 Vsig8 NM_177723.39-1.61 5252446 Vsig8 NM_177723.6-1.5249 513173 Xdh NM_11723.14 1.5644 4375137 Xdh NM_11723.132 1.6636 453296 Zan NM_11741.222 1.5361 5158219 Zan NM_11741.373 1.7452 5274543 Zfp276 NM_497.192 1.56 53211 Zfp276 NM_497.164 1.6763 517814 Zfp36 NM_11756.363 1.9534 52755 Zfp36 NM_11756.115 2.11 4772 Zfp69 NM_15788.34-1.799 528362 Zfp69 NM_15788.112-1.5286 5334924 Zfp7 NM_1851.213-1.65 437433 Zfp7 NM_1851.482-1.517 5276329 Zmynd1 NM_53253.8-2.1616 4983933 Zmynd1 NM_53253.7-1.5546
Supplementary Material for Lee et al., Page 14 Table S4 Abundance of transcribed STAMP exons (from chromosome 12) in TM vs WT mice Probe Start (bp) Probe Stop (bp) Probeset ID Alternative splicing Fold change TM vs. WT. Exon Exon id p value 1 2 87167527 87167557 5143384 175785-2.57.457976 3 87172898 8717295 5217313 175786-2.86 4.99E-6 4 87184747 87184799 4584716 175789-2.179.78782 5 87186211 87186279 4968626 17579-2.63 4.25E-5 6 87197 871927 5597974 175791-2.126 2.91E-6 7 8719833 87198412 5246111 175795-2.467.6137 8 9 875477 875524 4612994 175798-2.141 1.59E-5 1 87217444 87217518 466868 17584-2.242 4.1E-5 11 87219351 87219411 5243391 17585-2.588.5778 12 872334 872425 48448 17586-2.122 4.63E-5 13 8723123 8723174 465362 175811-2.368 3.5E-5 14 87231971 87237 594849 175812-2.684.128215 15 8723378 87233152 543453 175813-2.335 4.81E-5 16 87239973 87239999 5578115 175816-3.184.31963 16 8718 8753 491858 175816-2.216.16575 17 8723 872428 475831 175817-2.5.124771 18 87249755 8724985 5568898 175818-2.247 3.78E-6 19 87258643 87258718 558378 175821-2.548 6.66E-5 21 8718 872187 48494 175823-1.745.293 22 87263912 87263982 5298531 175825-2.54 5.15E-5 23 87266598 8726679 4927582 175826-77.243 1.27E-6 24 8726788 87267855 4537529 175827 294.7 4.76E-8 25 8727824 8727941 5345141 175829-2.351.58593 26 87273676 87273758 4311 175831-2.1.115646 27 87274245 87274361 521488 175832-2.7.192857 27 87274498 87274593 5321377 175832-2.159.352234 28 8728329 87288 4615781 175834-2.365.323571 29 8729758 8729765 547722 175838-2.4 1.19E-5 3 87336982 87337145 446319 175849-2.374 4.66E-5 31 87353598 87353642 4848712 175855-2.959 1.2E-5 31 87353718 8735389 5521171 175855-2.577 4.82E-5 32 87361483 8736155 529446 175859-2.593.354341 33 34 8739417 87394679 553753 175871-3.425.483463 Ave. fold reduction other than deleted exons 23 and 24: -2.41 SD:.338 n: 31 SEM:.61
Supplementary Material for Lee et al., Page 15 Supplementary Figures Fig. S1: Movie of sperm from wt/wt and tm/tm STAMP in IVF solution and in proximity of oocytes. (See separate file labeled IVF movie.wmv )
Supplementary Material for Lee et al., Page 16 Fig. S2: Assignment of missing doublet in axonema of Stamptm/tm mice. Normal 9+2 microtubule axonemal structure of wt/wt sperm is shown in bottom right panel. Missing doublet 4 (in red) in tm/tm sperm was identified as described in Experimental Procedures of main text.
Supplementary Material for Lee et al., Page 17 Fig. S3: Comparison of spermatogenesis-relating gene expressions in Stamp tm/tm mice. WT Ht TM 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 Gopc Agfg1 Csnk2a2 Gba2 Tekt2 Tekt4 1 1 1 8 1 1 8 Vdac3 Sepp1 Akap4 Spag6 Gapdhs Adcy1 1 1 1 1 8 1 1 1 8 Catsper1 Casper2 Catsper3 Catsper4 Tnp1 Tnp2 1 1 1 1 8 1 1 1 8 H1fnt Crem Tbpl1 Papolb Piwil1 Spem1 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 1 1 1 8 The expression levels of 24 spermatogenesis-related genes were measured in the testis of Stamp +/+ (black filled bar), Stamp +/tm (gray filled bar) and Stamp tm/tm (white filled bar) mice (n=3 each genotype) by RT-PCR (see Table 1 for list of primers) after total RNA was reverse-transcribed to first-stand complementary DNA (cdna) using SuperScript III, First- Strand Synthesis SuperMix for qrt-pcr (Invitrogen) according to the manufacturer s directions. Relative transcript abundance was normalized with glyceraldehyde-3-phosphate dehydrogenase and graphed (Average ± SEMs of duplicate values for all samples).
Supplementary Material for Lee et al., Page 18 Fig. S4: Histology of photoreceptors and cochlea of wt and Stamptm/tm mice of different ages.
Supplementary Material for Lee et al., Page 19 Methods: Retina and cochlea at specified ages were dissected and fixed in freshly prepared 2% paraformaldehyde/3% glutaraldehyde in phosphate buffered saline (PBS) for 24 hr at 4 C with mild rocking. Samples were then washed 3x in PBS at room temperature for 1 min each, followed by dehydration through a graded series of alcohol. Prior to dehydration, cochleas, but not retinas, were decalcified in 1 mm EDTA in PBS for 14 days refreshing the decalcification solution every 2-3 days. Retinal and cochlear tissues were then embedded in methacrylate plastic according to the manufactureʼs directions (Polysciences, Warrington, PA), sectioned at 4 μm using a rotary microtome, stained in aqueous Gillʼs #1 hematoxylin, and coverslipped in Permount. Groups of 2 cochlea from a single mouse, per age, and genotype, were analyzed. Images were captured using Nikon DS-Ri1 camera mounted on a Nikon Eclipse 8i microscope. Description: Histological examination comparing retina and cochlea from Stamp WT and MT mice at 3 and 7 months of age. Retinal and cochlear structures in Stamp MT mice were normal at both ages. No degeneration of photoreceptors or cochlear inner (open arrowheads) or outer (closed arrowheads) hair cells was evident. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inter plaxiform layer; GCL, ganglion cell layer; ohc, outer hair cell; ihc, inner hair cell; tm, tectorial membrane; is; inner sulcus; tc, tunnel of corti.