IpaD. IpaD : (Sd 1 )

Σχετικά έγγραφα
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Identification of Fish Species using DNA Method

Escherichia coli (LFD1).

High mobility group 1 HMG1

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS

Original Article. Corynebacterium. (

Το άτομο του Υδρογόνου

Υγιεινή Εγκαταστάσεων Βιομηχανιών Τροφίμων

Αλληλεπίδραση ακτίνων-χ με την ύλη

Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

HONDA. Έτος κατασκευής

CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Streptococcus pneumoniae. in silico. PfbA. M. Yamaguchi et al. Microbes Infect., 8: A. Martner et al. Infect. Immun., 77: , 2009

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Πρωτοπαθής και δευτεροπαθής αντοχή του μυκοβακτηριδίου

CHAPTER INTRODUCTION... 1 CHAPTER REVIEW OF LITERATURE...


Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1

rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1

Βιοπληροφορική. Ενότητα 10: Αναζήτηση Ομοιοτήτων σε ΒΔ Ακολουθιών - Blast, (1/2) 1ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

SUPPLEMENTARY INFORMATION

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Medicago marina 2012

Estimation of grain boundary segregation enthalpy and its role in stable nanocrystalline alloy design

ΓΗ ΚΑΙ ΣΥΜΠΑΝ. Εικόνα 1. Φωτογραφία του γαλαξία μας (από αρχείο της NASA)

Shiraia sp. Slf14 III

Παπαγεωργίου Χρυσοβαλάντης - Ιωάννης

Βιοπληροφορική. Ενότητα 8: Αναζήτηση Ομοιοτήτων σε Βάσεις Δεδομένων Ακολουθιών, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

Βιοπληροφορική. Ενότητα 10: Αναζήτηση Ομοιοτήτων σε ΒΔ Ακολουθιών - Blast, (2/2) 1ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

30s 56 60s 72 60s dntp cm s s s 23

Φπκαηίσζε: ε επηδεκηνινγηθή δηεξεύλεζε θξνπζκάησλ κε κνξηαθέο ηερληθέο

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Βιοπληροφορική. Ενότητα 14: Μοντέλα Πολλαπλής Στοίχισης (2/2), 1.5ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5

Key words : Vero toxin, O157, enterohemorrhagic E. coli, antibiotics

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Νόµοςπεριοδικότητας του Moseley:Η χηµική συµπεριφορά (οι ιδιότητες) των στοιχείων είναι περιοδική συνάρτηση του ατοµικού τους αριθµού.

ΣΥΝΤΟΜΟ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Δημήτρης Tζαμαρίας

19 Ενδοκρινολόγος. Φάρµακα που στοχεύουν το β- κύτταρο ΕΥΡΥΔΙΚΗ ΠΑΠΑΔΟΠΟΥΛΟΥ ΕΙΣΑΓΩΓΗ ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ

Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

China Academic Journal Electronic Publishing House. All rights reserved.

svari Real-time RT-PCR RSV

Ζητήματα Τυποποίησης στην Ορολογία - ο ρόλος και οι δράσεις της Επιτροπής Ορολογίας ΤΕ21 του ΕΛΟΤ

Electronic Supplementary Information (ESI)

Discontinuous Hermite Collocation and Diagonally Implicit RK3 for a Brain Tumour Invasion Model

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

An experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N

Βιοπληροφορική. Ενότητα 8: Αναζήτηση Ομοιοτήτων σε Βάσεις Δεδομένων Ακολουθιών, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Scrub Nurse Robot: SNR. C++ SNR Uppaal TA SNR SNR. Vain SNR. Uppaal TA. TA state Uppaal TA location. Uppaal

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Ι ΙΟΤΗΤΕΣ ΤΩΝ ΑΤΟΜΩΝ. Παππάς Χρήστος Επίκουρος Καθηγητής

P Ë ³μ,.. μ μ³μ²μ,.. ŠμÎ μ,.. μ μ,.. Š μ. ˆ œ ˆ Š Œˆ ŠˆŒ ƒ Œ Ÿ ˆŸ Š ˆ ˆ -ˆ ˆŠ

ER-Tree (Extended R*-Tree)

Molecular Analysis about the Pathogenicity of Shiga toxin-producing

Παρουζίαζη ζηην Ημερίδα ΥΝΕΡΓΕΙΑ 15 Ιανουαρίου A success story: Waste management in UK. Γπ. Θάνορ Μποςπηζάλαρ

Table of Contents 1 Supplementary Data MCD

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

College of Life Science, Dalian Nationalities University, Dalian , PR China.

ΝΟΜΟΣ ΤΗΣ ΠΕΡΙΟ ΙΚΟΤΗΤΑΣ : Οι ιδιότητες των χηµικών στοιχείων είναι περιοδική συνάρτηση του ατοµικού τους αριθµού.

Electrolyzed-Reduced Water as Artificial Hot Spring Water

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

Πανδηµική γρίπη A(H1N1) 2009 και η σηµασία του εµβολιασµού στη συλλογική ανοσία. Συλλογική ανοσία. (herd immunity) ιασπορά της µόλυνσης: όλοι επίνοσοι

ΠΕΡΙΟΔΙΚΟΣ ΠΙΝΑΚΑΣ ΣΤΟΙΧΕΙΩΝ

PHOS π 0 analysis, for production, R AA, and Flow analysis, LHC11h

Βιοπληροφορική. Ενότητα 17: Δομή Πρωτεϊνών, 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Conductivity Logging for Thermal Spring Well

2R2. 2 (L W H) [mm] Wire Wound SMD Power Inductor. Nominal Inductance Packing Tape & Reel. Design Code M ±20%

Τμήμα Επιδημιολογικής Επιτήρησης και Παρέμβασης

TGFp FSH INH INH

Βιοπληροφορική. Ενότητα 7: Στοίχιση ακολουθιών ανά ζεύγη Τεχνικές Στοίχισης Ακολουθιών, (1/2) 1ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ.

Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1

Supporting Information

ACCESS Immunoassay System. HIV combo QC4 & QC5. Για την παρακολούθηση της απόδοσης συστήματος του προσδιορισμού Access HIV combo.

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

Βιοπληροφορική. Ενότητα 5: Στοίχιση ακολουθιών ανά ζεύγη, 2 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Πρόσκληση υποβολής προσφοράς

Optimization, PSO) DE [1, 2, 3, 4] PSO [5, 6, 7, 8, 9, 10, 11] (P)

ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

«ΘΕΜΑΤΑ ΑΣΤΙΚΟΥ ΣΧΕΔΙΑΣΜΟΥ» ΔΙΔΑΣΚΟΥΣΕΣ: ΒΑΪΟΥ Ντ., ΜΑΝΤΟΥΒΑΛΟΥ Μ., ΜΑΥΡΙΔΟΥ Μ. «Gentrification Friendly» γειτονιές στο κέντρο της Αθήνας(;)

Η φυματίωση στην Ελλάδα και τον κόσμο. Σ.Η. Κωνσταντόπουλος

MAX-QUALITY ELECTRIC CO; LTD Thin Film Precision Chip Resistors. Data Sheet

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

"#$%&#%$'(!)*!+$',+-.$+/!,%&/')0$)#'.,(!1.#2!#$.02)(02+#'!3(456!$'-'+/!+!

Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA

α α Pneumocystis jirovecii

Electronic Supplementary Information

Appendix B Table of Radionuclides Γ Container 1 Posting Level cm per (mci) mci

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Na/K (mole) A/CNK

Transcript:

25 1390 30 25 52 IpaD -N 3 3 4 3 3 *2 1 ( )... -( )... -.1 ( ) - -.2 ( ) - -.3 ( ) - -.4 Saadati_m@yahoo.com 77104934 ( ) : * : :. : IpaD.. -N IpaD -N. PCR -N : pgem PCR.. PCR IpaD :. IpaD -N IpaD :.. IpaD -N IpaD :...(1 2).(3) M.(4). Lps O 77... 60 (Sd 1 )

52 26. 344 -N IpaD 5 : 5 :. 3 TCATGAATTCAGAACAACAAATCAG 3 TCTTAAG CTTTTAAGTATATGAACTAACG 5 EcoRI 5. HindIII. (TTA).. PCR. PCR LB ) (15) CTAB/NaCl. PCR ( 2 1 PCR ) X 50-35.5 (10MgSO4 X 1 5 ) mm(10dntp mm1 5 Pmol0.2 1 Pmol0.2 1 µg/µl1 ( ) 2 ( ) 1 DNA Pfu u/µl0.5-1.25 0/ 5 c94 c94 c58 c72 c72..1 5 1 1 2/20 5 1 30 1 PCR.2..(5) IpaD IpaD 37 332 IpaD.(6) Ipa 999 IpaD.(7).(8) ( IpaA,B,C,D Ipa ) IpaD.. IpaC IpaB.(6 8 9) (10) IpaC IpaB (TTSS) CD44.(11 12) IpaD IpaD 161 72 -N IpaD..(8) IpaD.(13 14) IpaD -N. -.. IpaD. Gene SRS ) Oligo. (Bank

52 27 100 PCR DNA.1.2. 344 PCR.3 110 234 E.. pgem PCR coli ) PCR (. ) PCR ( (.(2 (.(3 ) ( ) 344. PCR.2 IpaD -N PCR.1 ( ). 100 DNA.2 ). IpaD -N PCR.3 (. PCR. webcuttre 110 234 EcoRV PCR EcoRV PCR.. 12 Taq pgem PCR 3 datp pgem 5 PCR IpaD ( ).(16) 14 12. pgem -T4 PCR. pgem pgem-.(17) pgem-ipad E. coli.dh5α IpaD.(18) - pgem (1 : E. coli. PCR. pgem-ipad (2. DNA E. coli PCR EcoRI HindIII (3.. ( ) BLAST Megalign. Protean pgem-ipad.3 1 Pfu PCR PCR 344. 12 EcorV 344 EcoRV 234 110.(1 ) 344..1 3018. pgem pgem-ipad.2. 100 DNA.3 PCR.1 12 EcoRV bp bp344

52 28.(22) -N 162 72.(8) IpaD. IpaD IpaD -C -N -N IpaD.(23) IpaD - 2008 WIPO -N IpaD. Anti-IpaD.(13) IpaD -N 344 PCR IpaD PCR E. coli DH5α pgem. -N. ( ). IpaB IpaC. ) IpaD 483 163 (IpaD 161 55 BLAST 4 98.11 7. 4 Megalign. IpaD 3. IpaD ). 4 Protean (.... VirG.(19). Lps Ipa...(20 21) 37 IpaD. IpaD IpaD. -N.. REFERENCES 1. Key B, Clemens J, Kotloff. Generic protocol to estimate the burden of shigella diarrhoea and dysenteric mortal. Tex Book. 1999;pp 146-151. 2. Johnson J, Alverez CM, Sanz JC, Ramiro R. Late detection of a shigellosis outbreak in a school in Madrid. Euro Surveillance. 2005;10: 268-70. 3. Hale TL. Genetic basis of virulence in Shigella species. Microbiol.Rev. 1991;55:206 224.

52 29 4. Clerc P, Sansonetti PJ. Entry of Shigella flexneri into HeLacells: evidence for directed phagocytosis involving actin polymerization andmyosin accumulation. Infect. Immun. 1987. 55:2681 2688. 5. Hale TL, Oaks EV, Formal SB. Identification and antigenic characterization of virulence-associated, plasmid-coded proteins of Shigella spp. and enteroinvasive Escherichia coli. Infect Immun.1985. 50: 620-629. 6. Picking WL, Nishioka H, Hearn PD, Baxter MA, Harrington AT, Blocker A, Picking WD.IpaD of Shigella flexneri Is Independently Required for Regulation of Ipa Protein Secretion and Efficient Insertion of IpaB and IpaC into Host Membranes. Infection and Immunity, Mar. 2005;73:1432 1440. 7. Venkatesan MM, Buysse JM, kopecko DJ.Characterization of invasion plasmid antigen genes (ipabcd) from Shigella flexneri. Proc. Natl. Acad. Sci. USA. 1988;85: 9317-9321. 8. Stensrud, K.F., Adam, P.R., La mar, C.D., Olive, A.R., Lushington, G.H. Sudharsan, R., Shelton, N.L., Givens, R.S., Picking, W.L. and Picking, W,D. Deoxycholate Interacts with IpaD of Shigella flexneri ininducing the Recruitment of IpaB to the Type III Secretion Apparatus Needle Tip. Biological Chemistry.238: 27, 18646-18654. 2008. 9. Espina M, Olive AJ, Kenjale R, Moore DS, Ausar F, Kaminski RW, Oaks EV, Middaugh CR, Picking WD and. Picking WL. IpaD Localizes to the Tip of the Type III Secretion System Needle of Shigella flexneri. Infect Immun. 2006;74(8): 4391 4400. 10. Skoudy A, Mounier J, Aruffo A, Ohayon H, Gounon P, Sansonetti P and Guy Tran Van Nhieu. CD44 binds to the Shigella IpaB protein and participates in bacterial invasion of epithelial cells. Cell. Microbiol. 2000;2: 19 33. 11. Blocker A, Gounon P, Larquet E, Niebuhr K, Cabiaux V, Parsot C and Sansonetti P. The Tripartite Type III Secretion of Shigella Flexneri Inserts IpaB and IpaCinto Host Membranes. J. Cell Biol. 1999;147: 683 693. 12. Adam T, Arpin M, Prevost MC, Gounon P and, Sansonetti PJ.Cytoskeletal rearrangements and the functional role of T-plastin duringentry of Shigella flexneri into HeLa cells. J. Cell Biol.1995;129: 367 381. 13. Patent services data base, World Intellectual property Organization (WIPO) Title of patent: shigella ipad protein and its use as a vaccine against shigella infection, 2008.patent IP: WO 2008044149 20080417. 14. Sani, M. Weapons of Mass Secretion:The Type III Secretion System of Shigella flexneri, Printed in the Netherlands by Gildeprint Drukkerijen BV, Enschede. paper version ISBN: 90-367-2933-5. 15. Bando SY, Valle GR, Luiz MM, Trabulsi R and Moreira Filho CA. characterization of enteroinvasive Esherichia coli and shigella strains by RAPD analysis. FEMS Microbiology Letters: 1998 165: 159-165 16. Promega instructions for use of products A1360, A1380, A3600 and A3610. pgem-t and pgem-t Easy Vector Systems, technical manual printed in USA, N; 042,pp 1-8 17. Laboratory Protocols Cimmyt, Applied Molecular Genetics Laboratory Third Edition. ISBN:968-6923- 30-6.2008,P:71-72 18. Sambrook J and Russell D. MolecularCloning, A Laboratory Manual. The Hanahan Method forpreparation and Transformation of competent E.coli high-efficiency Transfomation. Cold Spring Harbor Laboratory Press. 2001.

52 30 19. Agerberth B, Sweden S.A, Kane A, Bardhan PK and et al. text book. Guidelines for the control of shigellosis, including epidemics due to Shigella dysenteriae type 1. Printed by the WHO Document Production Services, Geneva, Switzerland. ISBN 92 4 159233. 2005. Pp.9-11. 20. Kevin R, Turbyfill K, Sam W, Joseph B And Edwin V. Recognition of Three Epitopic Regions on Invasion Plasmid Antigen C by Immune Sera of Rhesus Monkeys Infected with Shigella flexneri 2a. Infection and Immunity, 1995.63: 3927 3935. 21. Lingling Z, Wang Yu, Andrew J, Olive N, Smith D, William D. Picking R.N. Guzman D. and Wendy L. Identification of the MxiH Needle Protein Residues Responsible for Anchoring Invasion Plasmid Antigen D to the Type III Secretion Needle Tip. J. Biological Chemistry, 2007. 282: 44, pp. 32144 32151. 22. Turbyfill K.R, Jennifer A.M, Corey P.M, and Edwin V.O. Identification of Epitope and Surface- Exposed Domains of Shigella flexneri Invasion Plasmid Antigen D (IpaD). Infection and Immunity,1998. 66:1999 2006. 23. Johnson S, Roversi P, Espina M, Olive A, Deane JE, Birket S, Fieldd T, Picking WD, Blocker A,. Galyov EE, Picking WL, Lea SM. Self-Chaperoning of the Type III Secretion System needle tip proteins IpaD and BipD. J Biol Chem. 2007;282(6): 4035-4044.