Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer

Σχετικά έγγραφα
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

TABLE OF CONTENTS Page

Capillary Gel Electrophoresis for Ligase Detection Reaction Products

A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon

Methodology Research on Loss of Heterozygosity of APC Gene Detection Exon 11 of Gastric Cancer by Capillary Electrophoresis

30s 56 60s 72 60s dntp cm s s s 23

, DYY-8B, ; : Centrifuge 11 R. min

Identification of Fish Species using DNA Method

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )

College of Life Science, Dalian Nationalities University, Dalian , PR China.

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Supporting Information

SUPPLEMENTARY INFORMATION

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Supplementary Information

ER-Tree (Extended R*-Tree)

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Evolution of Novel Studies on Thermofluid Dynamics with Combustion

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Electronic Supplementary Information

Real-Time PCR Mycoplasma pneumoniae

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

Conjoint. The Problems of Price Attribute by Conjoint Analysis. Akihiko SHIMAZAKI * Nobuyuki OTAKE

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Engineering Tunable Single and Dual Optical. Emission from Ru(II)-Polypyridyl Complexes. Through Excited State Design

ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ

DOI: /j.cnki.bingduxuebao

svari Real-time RT-PCR RSV


, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells

MSM Men who have Sex with Men HIV -

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Supporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention


9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts

Fused Bis-Benzothiadiazoles as Electron Acceptors

Περίπτωση ήπιου μεσογειακού συνδρόμου λόγω αλληλεπίδρασης Hb Adana με ετερόζυγη α+ μεσογειακή αναιμία

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:

2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t.

ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (

CorV CVAC. CorV TU317. 1

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

Research on the Environmental Impact Factors of Electromagnetic Radiation from High - speed Railway

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

Single-site association results for 136 SCARB1 genotyped variants with HDL-C.

Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1

MOTROL. COMMISSION OF MOTORIZATION AND ENERGETICS IN AGRICULTURE 2014, Vol. 16, No. 5,

Supporting Information

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Retrieval of Seismic Data Recorded on Open-reel-type Magnetic Tapes (MT) by Using Existing Devices

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Motion analysis and simulation of a stratospheric airship

Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική. ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ

Approximation Expressions for the Temperature Integral

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL

Analysis of energy consumption of telecommunications network and application of energy-saving techniques

Table of Contents 1 Supplementary Data MCD

Reading Order Detection for Text Layout Excluded by Image

Study on the Electrochemical Behaviors of Vincristine and the Interaction of Vincristine with Tubulin

Diagnosing X-linked Ichthyosis by Monoplast Single-round Duplex PCR

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information

Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής

Experimental Study of Dielectric Properties on Human Lung Tissue

Analysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis

Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Tunable Diode Lasers. Turning Laser Diodes into Diode Lasers. Mode selection. Laser diodes

Shiraia sp. Slf14 III

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Transcript:

4 Vol No4 4 009 8 Life Science Research ug 009 *,, 08 :,,, SYBR Green I,,,, β Ivs--654 (C T) CD7 ( T) : ; ; SYBR Green I; :Q9 : :007-7847(009)04-08-05 Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer MENG Xiang-xian HUNG Jian-hua TN Yong-jun * Institute of Biological Technology State Key Laboratory of Chemo / Biosensing and Chemometrics Hunan University Changsha 08 Hunan China bstract n approach has been developed to genotype point mutations using ligase-mediated induced fluorescence resonance energy transfer FRET When two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex Duplex inseting dye insects into duplex strands to form induced FRET When there is a mismatch among probes and template FRET can not be induced Using this method the homozygotes and heterozygotes were scored accurately and conveniently This method has been validated with the genotyping of two common point mutations Ivs--654 C T and CD7 T and of β-globin gene in thalassemia disease Key words ligase induced fluorescence resonance energy transfer SYBR Green I thalassemia Life Science Research 009 4 8~87 [5] [6] [8] [9] [~] DSH [] DSH [4] DSH Howell [] 999 [5~] DN : 009-05-9 :009-07-6 : 0505007 008SK085 : 97- * 967- E-mail ytan@yahoocom Tel 07-888

84 009 [] Jobs [] DSH- [] N N 69 β- Ivs--654 [] N N N 5 6- -X- ROX N4 N 5 N5 N6 CD7 SYBR Green I T4 DN ligase 0 T4 DN ligase buffer Taq TakaRa Ex tag 0 ExTaq buffer dntp TP MgCl mresco Solon OH β- Ivs--654 CD7 LS-55 Perkin Elmer mersham Name Template N Template N Probe Ivs--654 N Probe Ivs--654 N4 Probe CD7 N5 Probe CD7 N6 Table Oligonucleotides Sequence 5 5 tctaaagaataacagtgataatttctgggttaaggtaatagcaatatttctgcatataaatatttctgc 5 tctaaagaataacagtgataatttctgggttaaggcaatagcaatatttctgcatataaatatttctgc ROX-GTTGCTTT p-ccttccc ROX-CTTCCCT p-gcccccg U T4 DN ligase 0 mol / L Tris-HCl ph 76 0 mmol / L MgCl 0 μl 95 5 min 0 5 s 7 % 0 % ImageMaster VDS-CL mersh- 0 mmol / L DTT 0 mmol / L TP mmol / L am spermidine SYBR Green I 50 μl 7 LS-55 00 nmol / L N/N PCR Perkin Elmer 7 00 nmol / L 5 nmol / L 5 nm T4 DN [8] 5 min 0 min 85 5 min 4 s 49 nm

4 : 85 SYBR Green I ROX 5 nm CCTTCTCC- PCR 49 nm 500 nm 700 nm 4 RDB DN PCR - -0 [5] [4] Reverse Dot Blot RDB β-globin Ivs--654 C T CD7 T DN 5 PCR PCR PCR 50 μl 05 U TakaRa Ex Taq Ex Taq Buffer mmol / L MgCl 0 mmol / L dntp Mixture 50 ng DN 0 nmol / L 0 nmol / L Ivs--654 5 -TCTG TCGTG- 5 - GCGTT TTTTGC- CD7 5 -GTCTGCC GTTCTGCCCTG- 5 - TCCCC 94 5 min 94 0 s 50 for Ivs--654 57 for CD7 5 s 70 0 s % SYBR Green I SYBR Green I ROX SGI,, SYBR Green I, Fig Schematic diagram of the assay When the two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex SYBR Green I dye insects into duplex strands to form induced FRET 50 nm N [] SYBR N N Ivs--654 Green I ROX N N 5 nm 50% 50 nm SYBR Green I N 5 nm ROX 50 nm 5 min ~ N N/N ROX N 5 nm ROX

86 009 0 00 0 50 5 0 500 550 0 650 700 wavelength / nm -654 CD7 4 4 Ivs--654 5 nm 4 SYBR Green I ROX : N+ ; : N/N+ ; : N+ Fig Fluorescence spectra of point mutation detection using ligase-mediated induced FRET Curve N+probes Curve N / N+probes Curve N+probes 4B CD7 5 nm 4 ~ ~ 0 N Marker 0 DN 0 DN 0 DN DN 0 0: N+ ( ); : N+ ; : N / N+ ; : N+ 4 Fig Denaturing polyacrylamide gel electrophoresis Ivs- 0 N+probes without ligase N+probes N / N+ probes N+probes 70 50 0 0 0 t 0 00 00 00 0 t / s 4 β Ivs--654 () CD7 (B) ~ Fig4 Detection of Ivs--654 CD7 B point mutations Curve is mutant homozygote curve is heterozygote curve is wild-type homozygote 70 50 0 0 0 B t 0 00 00 00 0 t / s

4 : 87 logy 00 7 566-57 [7] CHEN X LIVK K J KWOK P Y homogeneous ligase- mediated DN diagnostic test[j] 549-556 using DN ligase[j] Talanta 007 7-9 6 49-5 (References): [] COOPER D N SMITH B COOKE H J et al n estimate of unique DN sequence heterozygosity in the human genome[j] Hum Genet 985 69 0-05 [] CHRISTIE N J CHRISTOPHER IJ WILLIM et al Disease-causing point mutation in human mitochondrial trnmet results in trn misfolding leading to defects in translational initiation and elongation[j] J Biol Chem 008 8 4445-4456 [] MURIZI D P SUSN M DOMCHEK J S et al The relative contribution of point mutations and genomic rearrangements in BRC and BRC in high-risk breast cancer families[j] Cancer Res 008 68 7006-704 [4] FODDE R LOSEKOOT M Mutation detection by denaturing gradient gel electrophoresis DGGE [J] Human Mutation 994 8-94 [5] SYVNEN C LTOSRTL K HRJU L et al primer-guided nucleotide incorporation assay in the genotyping of apolipo protein E[J] Genomics 990 8 684-69 [6] OSIOWY C Sensitive detection of HBsg mutants by a gap ligase chain reaction assay[j] Journal of Clinical Microbio- Genome Res 998 5 [8] MENG X X LI H M WNG K M et al Fidelity genotyping of point mutation by enhanced melting point difference [9 ] TYGI S BRTU D P KRMER F R Multicolor molecular beacons for allele discrimination[j] Nat Biotechnol 998 [0] WLLCE R B SHFFER J MURPHY R F et al Hybridization of synthetic oligodeoxyribonucleotides tophix74 DN The effect of single base pair mismatch[j] Nucl cids Res 979 6 54-557 [] HOWELL W M JOB M GYLLENSTEN U et al Dynamic allele-specific hybridization new method for scoring single nucleotide polymorphisms[j] Nat Biotechnol 999 7 87-88 [] PRINCE J FRUK L HOWELLW M et al Robust and accurate single nucleotide polymorphism genotyping by dynamic allele-specific hybridization DSH Design criteria and assay validation[j] Genome Res 00 5-6 [] JOBS M HOWELL W M STROMQVIST L et al DSH Flexible low cost and high-throughput SNP genotyping by dynamic allele-specific hybridization on membrane arrays [J] Genome Res 00 96-94 [4] MO Q H ZHU H LI L Y et al Reliable and high throughout mutation screening for beta thalassemia by single base extension/ fluorescence polanization assay[j] Genet Testing 004 8 57-59 [5] [M] HUNG P T translation Molecular Cloning Laboratory Manual rd ed [M] Beijing Science Press 00 866-874 005-09