,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Σχετικά έγγραφα
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

30s 56 60s 72 60s dntp cm s s s 23

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

TGFp FSH INH INH

Identification of Fish Species using DNA Method

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

,,, (, ) , ;,,, ; -

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Electronic Supplementary Information

Conductivity Logging for Thermal Spring Well

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

ER-Tree (Extended R*-Tree)

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

Supporting Information

Science of Sericulture

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

, Litrrow. Maxwell. Helmholtz Fredholm, . 40 Maystre [4 ], Goray [5 ], Kleemann [6 ] PACC: 4210, 4110H

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Supporting Information

Reading Order Detection for Text Layout Excluded by Image

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Congruence Classes of Invertible Matrices of Order 3 over F 2

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes

College of Life Science, Dalian Nationalities University, Dalian , PR China.

DNA. SPF 20 d 9. 09% % % % % % Testis Injection of Exogenous DNA Results in Expression in Mouse Sperm

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Direct Transformation of Ethylarenes into Primary Aromatic Amides with N-Bromosuccinimide and I 2 -aq NH 3

Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

Design and Fabrication of Water Heater with Electromagnetic Induction Heating

Supplementary Information. Living Ring-Opening Polymerization of Lactones by N-Heterocyclic Olefin/Al(C 6 F 5 ) 3

Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

A summation formula ramified with hypergeometric function and involving recurrence relation

Quick algorithm f or computing core attribute

Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Emulsifying Properties of Egg Yolk as a Function of Diacylglycerol Oil

Experimental Study of Dielectric Properties on Human Lung Tissue

Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level

Supplementary Information for

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

MSM Men who have Sex with Men HIV -

E#ects of Drying on Bacterial Activity and Iron Formation in Acid Sulfate Soils

Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues

Electrolyzed-Reduced Water as Artificial Hot Spring Water

PNS mg kg - 1. Rb 1

Supporting Information

Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang

N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

High order interpolation function for surface contact problem

Octretide joint proton pump inhibitors in treating non-variceal gastrointestinal bleeding a Metaanalysis

VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)

Influence of Flow Rate on Nitrate Removal in Flow Process

PE CVVH PE+HP HP+CVVH HP+CVVH+PE CVVH. ENLAV of HCO - 3 ENLAV-HCO ± μmol /L HP+PE HP+CVVH HP+CVVH+PE

Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία

Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances

Supporting Information

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

Site-Selective Suzuki-Miyaura Cross-Coupling Reactions of 2,3,4,5-Tetrabromofuran

Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes

Separation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection

Vilsmeier Haack reagent-promoted formyloxylation of α-chloro-narylacetamides

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

Nguyen Hien Trang* **

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

, DYY-8B, ; : Centrifuge 11 R. min

Mean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O

CorV CVAC. CorV TU317. 1

) ; GSP ) ;PXD g, 100 ml

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

«ΠΡΟΜΗΘΕΙΑ ΕΞΟΠΛΙΣΜΟΥ ΕΡΓΑΣΤΗΡΙΟΥ»

ΚΛΙΜΑΤΟΛΟΓΙΑ CLIMATOLOGY

ΕΦΑΡΜΟΓΗ ΕΥΤΕΡΟΒΑΘΜΙΑ ΕΠΕΞΕΡΓΑΣΜΕΝΩΝ ΥΓΡΩΝ ΑΠΟΒΛΗΤΩΝ ΣΕ ΦΥΣΙΚΑ ΣΥΣΤΗΜΑΤΑ ΚΛΙΝΗΣ ΚΑΛΑΜΙΩΝ

Potentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph

Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Research on the Effect and Technique of Remediation for Multi-Metal Contaminated Tailing Soils

Supplementary information

ΠΑΝΔΠΗΣΖΜΗΟ ΠΑΣΡΩΝ ΣΜΖΜΑ ΖΛΔΚΣΡΟΛΟΓΩΝ ΜΖΥΑΝΗΚΩΝ ΚΑΗ ΣΔΥΝΟΛΟΓΗΑ ΤΠΟΛΟΓΗΣΩΝ ΣΟΜΔΑ ΤΣΖΜΑΣΩΝ ΖΛΔΚΣΡΗΚΖ ΔΝΔΡΓΔΗΑ

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

The pathway of the ozonation of 2,4,62trichlorophenol in aqueous solution

Transcript:

ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704 8 411 6 609 4 277 6417 % 153 26 101 10 F0 HLA2B2704 919 % F0 F1 78 15 HLA2B2704 mrna HLA2B2704 6 1 2 1 HLA2 B2704 HLA2B2704 Q33 Q78 The Technique of Producing HLA2B2704 Gene Transgenic Mice CHEN Zhan2kun LΒ Hou2shan 3 J IANG Dong2fang WANG Dong AI Jing DING Hai2ming WANG Shen2wu 2) ( Arthritis Research Cencer 2) Central Laboratory Peking University People s Hospital Beijing 100044 China) Abstract To produce HLA2B2704 transgenic mice by microinjection 286 Kunming female mice were induced to give superovulation by injecting hormone The fertilized eggs were collected and microinjected with genomic DNA fragment containing HLA2B2704 DNA into their pronucleus After microinjection the survial and two2cell fertilized eggs were implanted into the oviducts of pseudopregnant female mice to let them develop and produce progeny The intergration of the target gene in F0 and F1 mice was analyzed by PCR The expression of HLA2 B2704 transgene at mrna level was comfirmed by RT2PCR 8 411 fertilized eggs were collected 6 609 of them were microinjected The number of survial and two2cell eggs was 4 277 after microinjection The survial rate was 6417 % These eggs were implanted into 153 pseudopregnant female mice 26 of which were pregnant and 101 offsprings were obtained at last PCR analysis showed that genomes of 10 F0 transgenic mice were integrated with the HLA2B2704 gene The integration rate was 919 % Among 78 F1 of positive F0 transgenic mice 15 F1 mice carried the HLA2B2704 gene HLA2B2704 gene was expressed at the mrna level in skin colon testicle and spleen tissues of the transgenic mice In the positive HLA2B2704 transgenic mice six mice were detersile One mouse showed tumescent at podosoma and toes Two mice appeared photophobia One mouse arised diar2 :2001208203 :2001210219 (No 39478694) 3 Tel :68792769 1965 10 Tel : (010) 68792769 Received :August 3 2001 ;Accepted :October 19 2001 Supported by National Natural Science Foundation of China No 39478694 3 Corresponding author Tel : (010) 68792769

246 18 rhea The transgenic mice carrying the HLA2B2704 genotype and phenotype were produced successfully Key words transgene HLA2B2704 gene mice microinjection 1980 Gordon [1 ] 30 lπ - 20 210 gπml HSV2TK 11212 [4 ] 11213 1 4 23 28 ( HLA2B2704 [2 ] : 8 10 28 30 g 4 5 ; d (2) : HLA2B2704 10 15 10 IU PMS 46 h HLA2B2704 10 IU HCG 1 1 (3) :6 8 ( 30 g ) 1 6 8 111 11111 8 8 10 4 6 11214 ( 6 8 : 8 :00 30 min 11112 PMS ( ) ml ; (c) M16 20 ; (d) HCG( ) 600 800 l M2 HLA2B2704 pbr322 75 % ( ) AutΩnoma Castro 1 cm M2 M16 SINGMA [3 ] 11113 DIAPHOT300 37 PBS PN230 TRANSTOMER SN MICRO2 10 g L - 1 20 l ( 013 g FORGE MF290 BURNER L - 1 ) 10 NIKON CO 2 ( SANYO) G21 3 3 GD21 (NARISHIGE) PCR (PE2480) 112 11211 HLA2B2704 DNA 9 M2 9 (3) :M2 HLA2B2704 DNA pbr322 EcoR M16 CO 2 2 3 h 8 g L - 1 36 V 5 h 615 kb HLA2B2704 DNA Agarose Gel DNA Extraction kit (QIAGEN) DNA 20 :00 30 40 : ( (1 ( Fig 1 4 ) 2 ; (2) 2 ; (3) 1Π10 2 mol L - 1 NaCl 3-20 ; (4) 70 % ( ) 2 ; (5) [ 7 mmol L - 1 Tris (ph 714) 0115 mmol L - 1 37 CO 2 : (a) PBS 115 ml ; ( b) M2 2 5 min (2) : M2 4 (4) : 13 :00 40 4 EDTA] DNA ; (6) DNA ; (7) 0122 m M16

2 : HLA2B2704 247 CO 2 1 2 h 20 g L - 1 (5) : 11216 RT2PCR HLA2B2704 mrna 75 %( ) ( RNA : 015 cm 018 cm 018 HLA2B2704 cm Trizol Reagent ; (2) RT2PCR : HLA2B27 3 135 bp :5 2GGGTCTCACAC2 CCTCCAGAAT23 : 5 2CGGCGGTCCAGGAGCT2 3 : 48 45 min 96 2 min :M2 M2 30 M2 (96 30 s 65 1 min 70 45 s) 40 70 7 min 11217 ( ; (2) ; (3) 1 ; (4) 2 211 Table 1 9 12 8 411 6 609 4 277 6417 % Table 1 Number of used kunming mice and collected eggs per month Fig 1 A microinjection pipette was inserted into the male pronu2 cleus of a fertilized egg for injecting DNA solution (Light field 40 ) Month Number of injected kunming mice (a) Number of mating (b) bπa ( %) Number Number of collected of injectable egg(c) eggs(d) dπc ( %) 9 60 27 45 0 710 376 53 0 10 158 89 56 3 1811 959 50 2 11215 ( DNA F0 F1 3 4 DNA ; 2 mm 200 l PCR ( nonionic detergents PBND) 115 ml ; 112 5 l 10 g L - 1 K 55 3 h ; 153 19 22 d 26 95 100 10 min K; 50 l 131 1 2 PCR 2 l DNA (2) PCR : Dominguez HLA2B27 3 8 d 15 2 3 135 bp 3 5 2GGGTCTCACACCCTCCAGAAT23 101 5 2CGGCGGTCCAGGAGCT23 PCR : 213 PCR 97 2 min ( 96 45 s 11 188 118 62 8 3101 2482 78 2 12 217 152 70 1 2934 2336 77 9 212 F0 HLA2B2704 DNA 13 6 3 5 Fig 2 101 F0 10 65 60 s 70 30 s) 30 919 % F0 70 5 min 10 l PCR F1

248 18 78 15 214 HLA2B2704 mrna Fig 3 Fig 2 Integration detection of HLA2B2704 gene by PCR in transgenic mice M:100 bp DNA ladder ; 1 2 :Negative control (genomic DNA of normal mice) ;3 4 : Genomic DNA of HLA2B2704 transgenic mice ; 5 : Positive control ( human genomic DNA containing HLA2B27 gene) ;6 :Blank control Fig 3 Tissue specific expression of HLA2B2704 gene by RT2PCR analysis M:100 bp DNA ladder ; 1 2 3 4 : Total mrna extracted from co2 lon skin testicle and spleen of positive mice ;5 :Positive control (to2 tal mrna extracted from HLA2B27 positive human white blood cell) ; 6 : Negative control ( total mrna extracted from spleen of normal mice) ; 7 :Blank control 6 3 [5 ] 1 3 : 00 PM PMS 3 1 :00 2 :00 PM HCG 4 8 :00 AM ( HCG 215 ; (2) ( : 6 4 : :10 d 2 1 Table 1 2 :10 d 8 (2) :1 (3) : 2 (4) : : 70 3 1 HLA2B2704 65 20 ( PN230) 2 1 2

2 : HLA2B2704 249 HLA2B2704 HLA2B2704 DNA HLA2B2704 ( References) DNA 210 gπml 1 3 pl 3515 % Pinkert [6 10 % ] :M2 M2 30 M2 : ( ; (2) ; (3) 1 Gordon J W Scangos G A Plotkin D J Genetic transformation of mouse embryos by microinjection of purified DNA Proc Natl Acad Sci 1980 77 :7380 7384 2 HLA2B27 (Lin Jian2hao L Hou2shan Chen Zhan2kun Jiang Dong2 fang Wang Shen2wu Feng Chuan2han Ankylosing spondylitis and HLA2 B27 subtypes :A disease2related research in Chinese Han nationality J Beijing Med Univ) 1994 26(5) :323 326 3 Hogan B Beddington R Costantini F et al Manipulating the Mouse Embyro : A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Press 1994 :132 390 397 4 : ( Tian Xiao2li Chen Lan2ying Hu Rong2li2 ang(eds) : Principle Technology and Application of Transgenic Animal Jilin :Jilin Press of Science and Technology) 1994 :57 58 5 Ryan T M Townes T M Reibly M P et al Human sickle hemoglobin in2 transgenimice Science 1990 247 :566 568 6 Pinkert C A Transgenic Animal Technology : A Laboratory Handbook San Diego :Academic Press Inc 1994 :54 71 76